Identificación y validación previa de requerimientos

2.12.1 RT-PCR

RT-PCR (reverse transcriptase polymerase chain reaction) allows trace amounts of

RNA to be analysed by first transcribing the RNA into DNA with reverse

transcriptase. The polymerase chain reaction then allows amplification of the DNA

from a region of the genome when part of the nucleotide sequence is known. The

oligonucleotide primers are designed as forward and reverse sequences i.e. a

sequence complementary to each strand of the DNA helix and at opposite ends to

the section to be amplified.

Membranous labyrinths were dissected on ice for extraction of RNA. Liver, lung,

heart and eye were also taken for use as controls. Tissue was used directly

following dissection or frozen in liquid nitrogen until required.

The Rneasy Mini Protocol (Qiagen) was used for isolation of total RNA from

tissue. Briefly, each sample (up to 30 mg tissue) in 350pl RLT buffer with 0.1% p-

Mercaptoethanol (Sigma) added was homogenised for 20 seconds. This was then

centrifuged at 12000g for 3 minutes and the supernatant carefully removed leaving

a pellet to which 70% ethanol was added.

Optical densities at 260nm / 280nm wavelengths were measured to assess the purity

of RNA extracted from each sample.

A mastermix, comprising nuclease-free water (Gibco), primers (Oswel,

as the amount of enzyme required to catalyse the incorporation of lOnMol of dNTP

into an acid insoluble form in 30 minutes at 74 °C ), dNTP (25pmol each dNTP),

megalovirus AMV (reverse transcriptase), Taq polymerase (all from Promega) was

pipetted into a sterile centrifuge tube. Storage buffer A comprised 5mM Tris-HCl

pH 8.0, lOOmM NaCl, 0.1 mM EDTA, ImM DTT, 50% glycerol,1% Triton X-100.

Nuclease-free water replaced the RNA as a negative control and Actin primer as a

positive control. Initially different concentrations of MgS0 4 (1, 1.5 and 2pL) were

added and the water adjusted to assess the optimum concentration. One pi of upper

and Ipl of lower primer were added to 5pi RNA.

Sequences of primers prepared commercially (Oswel Scientific, Southampton)

were constructed from NCBI data on HESl in newt, C pyrrhogaster.

U1 5 ' -TTATTAACCCTCACTAAAGGGAAGAGAAACCTGGCACA

GTCTCG -3'

Sequence for T3 RNA polymerases in red

LI 5 ' -TTGTAATACGACTCACTATAGGGCGAAAGCCTGCTCGG

TACTTTCC-3'

Sequence for T7 RNA polymerases in red

Amplified product^ 371 bp

Hesl forward primer sequence was 45 base pairs in length and Hes 1 reverse primer

Sequences of primer constructed (Oswel) on a-actin in newt, C. pyrrhogaster. U1 5 ' TTATTAACCCTCACTAAAGGGAAG GAGCGCAAGTACTCT GTCTGG-3' LI 5 ' -TTGTAATACGACTCACTATAGGGCGAA GGCCCGTGTCT TCTTATCC-3' Amplified product = 295 bp

Sequences for both Hes 1 and a-actin primers were designed with T3 and T7 RNA

polymerases for future use in in situ hybridisation. Mouse p- actin primers were

available from previous molecular studies in this laboratory and were not

specifically designed for this work.

Mouse P- actin primers

Forward CCAACCGTGAAAAGATGACC

Reverse CCTTCTGCATCCTGTCAGC

Amplified product^ 606 bp

PCRs were run using a Techne Genius for 30 minutes at 42°C (1 cycle), then at

94°C for 2 minutes ( 1 cycle) and followed by for 45 seconds at 94°C to denature

the sample, 58°C to anneal primers and 72°C for synthesis of new strands (40

PCR samples with ethidium bromide and DNA molecular weight marker XIV, 100

base pair ladder (Boehringer Mannheim) were run on a 1.5% agarose gel, at lOOV

for 30minutes. The gel was examined using UYP Biodocit system ™ and images

recorded digitally.

2.12.2 Western Blot

Proteins can be separated according to size by polyacrylamide gel electrophoresis.

Smaller molecules will migrate more speedily through the gel whilst those of a

larger size will be retarded. Proteins are treated with sodium dodecyl sulphate

(SDS), a negatively charged detergent. This binds to hydrophobic regions of the

protein molecules and breaks down the secondary and tertiary structure. Movement

of molecules to the positive electrode, when voltage is applied, is due to the

proteins intrinsic charge being overwhelmed by the binding o f negatively charged

detergent molecules. The gel acts as a molecular sieve. Identification of a specific

protein is achieved by exposing all the proteins to a specific antibody.

Tissue was homogenised in Laemmli sample buffer and a running gel prepared for

use in a MV120 mini vertical gel system (Savant instruments. New York). The

running gel was made up using 30% acrylamide, 1.5M Tris, 10 % SDS, TEMED

and ammonium persulfate. A stacking gel (pH 6.8) was applied above the miming

gel (pH 8.8) according to the published procedure (Harlow and Lane, 1999). The

stacking gel causes the proteins to separate poorly, forming thin defined bands

whilst the miming gel has narrow pores allowing the smaller proteins to move more

Biotech) protein molecular weight marker, were loaded into each lane of the

stacking gel and the gel run at 150V for Ihour 30 minutes.

During western blotting the separated proteins were transferred to a sheet of

nitrocellulose (Amersham Pharmacia Biotech) by blotting via electrophoresis at

30V. The nitrocellulose membrane was incubated in block, 10% horse serum in tris

buffered saline with Tween (TBS-T), for an hour before incubation with primary

antibody. Primary antibodies; H esl, A thl, and p27^'^^ (Abeam) were diluted in

block 1:500. After incubation overnight in primary antibody 5 washes in TBS-T

were carried out over 30 minutes. Horseradish peroxidase (HRP) conjugated

secondary was applied at 1:5000, in block. This was developed by

chemiluminescence using a kit purchased from ECL Amersham Pharmacia Biotech.

Detection was carried out by exposure of X-ray film to the membrane blot for

Chapter 3