• No se han encontrado resultados

Vías de comunicación

1.6. Diagnostico dimensión ambiental

1.6.2. Ambiente construido

1.6.2.3 Vías de comunicación

2.6.1 Expression vectors

A previously-constructed pBK-CMV vector containing AGR2 (pBK-CMV-AGR2, kindly provided by Dr Dong Barraclough, Institute of Ageing and Chronic Disease, University of Liverpool) was used as a template for subcloning WT and mutant AGR2 into the PiggyBac expression vector (System Biosciences, see Appendix 2), as described in Section 2.6.3. For recombinant protein expression in E. coli, two previously constructed expression vectors were used: an IMPACT-TWIN1 vector (Intein Mediated Purification with an Affinity Chitin- binding Tag-Two Intein, New England Biolabs) expressing residues 21-175 of AGR2 (AGR221- 175) with a cleavable N-terminal chitin-binding tag (kindly provided by Dr Dong Barraclough,

Institute of Ageing and Chronic Disease, University of Liverpool), and a Champion™ pET151 Directional TOPO® vector (Life Technologies) expressing residues 41-175 of AGR2 (AGR2 41- 175) with a cleavable N-terminal polyhistidine tag (Patel, 2013, see Appendix 1).

Chapter 2 Materials and Methods

52

2.6.2 Primer design

Primers were designed using the Invitrogen OligoPerfect ™ Designer [736]. Melting temperature was set at 60°C (range: 57-63°C) and GC content at 50 % (range: 20-80 %). After generation, primers were manually edited by addition or deletion of bases within the sequence so that the final base at the 3’ end was either guanine or cytosine, to aid anchoring of the primer to the template strand. A 5’ XbaI restriction site was added to forward primers where required and a 5’ EcoRI site added to the reverse primer, where required (Table 2.4). Where restriction sites were added, further guanine and/or cytosine nucleosides were added to the 5’ end of the restriction site to aid better digestion of the sequence, as described by New England Biolabs [737]. Primers were then synthesised by Integrated DNA Technologies (IDT).

Primer Sequence Tm (°C) WT AGR2 Forward GCTCTAGAATGGAGAAAATTCCAGTGTCAGC 60.4 WT AGR2 Reverse CCGGAATTCTTACAATTCAGTCTTCAGCAACTG 60.7 E60A AGR2 Forward CTGGACTCAGACATATGAAGAAGCTCTATATAAATCCAAGAC 60.8 E60A AGR2 Reverse GTCTTGGATTTATATAGAGCTTCTTCATATGTCTGAGTCCAG 60.8 Y63A AGR2 Forward ACTCAGACATATGAAGAAGCTCTAGCTAAATCCAAGACAAGCAACAAACC 65.4 Y63A AGR2 Forward GGTTTGTTGCTTGTCTTGGATTTAGCTAGAGCTTCTTCATATGTCTGAGT 65.4 K64A AGR2 Forward GACATATGAAGAAGCTCTATATAAATCCAAGACAAGCAACAAACCC 62.6 K64A AGR2 Reverse GGGTTTGTTGCTTGTCTTGGATTTATATAGAGCTTCTTCATATGTC 62.6 ∆1-20 AGR2 Forward GCTCTAGAATGAGAGATACCACAGTCAAACCTGG 61.9 ∆21-40 AGR2 Forward (incl. signal sequence) GCTCTAGAATGGAGAAAATTCCAGTGTCAGCATCTTGCTCCTTGTGGCCCTCTC CTACACTCTGGCCCCCCAGACCCTCTCCAGAGG 73.0 ∆KTEL AGR2 Reverse CCGGAATTCTTAGAGAGCTTTCTTCATGTTGTCAAGC 62.6

Table 2.4. Primers used for AGR2 subcloning and mutagenesis. Restriction sites (if present) are underlined.

Chapter 2 Materials and Methods

53

2.6.3 Sub-cloning of AGR2

The open reading frame (ORF) containing only the AGR2 coding sequence was amplified from the pBK-CMV-AGR2 into the PiggyBac transposon vector (catalogue no. PB533A-2, see Appendix 2) using the primers detailed in Table 2.4, and using REDTaq® ReadyMix™ PCR reaction mix (Sigma) with the method described by the manufacturer, but using the following cycling parameters:

PCR reaction mix Template 10 ng Forward primer 125 ng Reverse primer 125 ng REDTaq ReadyMix 12.5 µL PCR water to 25 µL PCR cycling parameters

Step Temp. (°C) Time

(seconds) Initial denaturation 95 120 Denaturation 95 30 Annealing 60 30 30 cycles Elongation 72 30 Final elongation 72 420

After amplification, the reaction mix was run on a 0.7 % (w/v) agarose gel (see Section 2.7) to separate the amplified insert from parental plasmid DNA. The insert was excised and purified using a QuiaQuick Gel Extraction kit (Qiagen), as described by the manufacturer. 1 µg each of the PiggyBac vector and insert were then digested with XbaI and EcoRI HF enzymes (New England Biolabs) for 1 h at 37°C, as described by the manufacturer. Enzymes were then heat inactivated for 20 min at 65°C and the digested DNA was purified using a QiaQuick PCR Cleanup kit (Qiagen). 0.025 pmol of digested vector was mixed with 0.075 pmol digested insert and ligated overnight at room temperature using T4 DNA ligase (New England Biolabs), as described by the manufacturer. The ligase was inactivated by incubation at 65°C for 10 min and One-shot ® Top10 chemically competent E.coli cells were then transformed with 5 µL of ligation mixture as described in Section 2.5.2.

Chapter 2 Materials and Methods

54

2.6.4 Mutagenesis

Due to the size of the PiggyBac expression vector (approximately 7,400 bp with AGR2 insert), point mutations were introduced into the pBK-CMV-AGR2 expression vector and pET151 expression vector by site-directed mutagenesis using the QuickChange Lightning kit (Agilent), and mutated inserts were then subcloned into the PiggyBac vector as described above. The following reaction conditions were used for site-directed mutagenesis: PCR reaction mix Template 10 ng Forward primer 125 ng Reverse primer 125 ng REDTaq ReadyMix 12.5 µL 10 x reaction buffer 5 µL dNTP mix 1 µL QuickSolution 1.5 µL

QuickChange Lightning enzyme 1 µL

PCR water to 50 µL

Site-directed mutagenesis cycling parameters

Step Temp. (°C) Time

(min.) Initial denaturation 95 2 Denaturation 95 1 Annealing 55 1 18 cycles Elongation 68 14 Final elongation 68 14

Methylated, parental DNA was removed with treatment with Dpn1 enzyme for 1 h at 37°C, and 2 µL Dpn1-digested plasmid DNA was transformed into XL10-Gold ultracompetent E.coli cells in the same way as described for One-shot ® Top10 chemically competent cells in Section 2.5.2.

For the ∆1-20 AGR2 and ∆KTEL AGR2 truncation mutations, AGR2 was amplified from the pBK-CMV-AGR2 vector using the appropriate primers detailed in Table 2.4. For the ∆21-40 AGR2 truncation, a forward primer containing the AGR2 signal sequence (Table 2.4) was used to amplify the 41-175 region of AGR2 from the pET151 expression vector. In this way, the signal sequence was joined directly to residue 41, effectively deleting the 21-40

Chapter 2 Materials and Methods

55 region. All truncation mutations were amplified using REDTaq ® ReadyMix ™ PCR reaction mix and were subsequently purified, digested and ligated as described in Section 2.6.3.

The presence of DNA inserts was checked by submitting purified DNA (see Section 2.6.5) to restriction digest with XbaI and EcoRI as described in Section 2.6.3. Appropriate base changes were confirmed by DNA sequencing of purified DNA (Beckman Coulter Genomics).

2.6.5 DNA purification

For use in cloning, mutagenesis and sequencing reactions, transformed cells were grown as 5 mL cultures as described in Section 2.5.2. Cultures were then centrifuged at 3,500 rpm in a Sigma 4K15 refrigerated centrifuge for 10 min at 4°C to pellet the bacteria, and plasmid DNA was isolated using a QIAprep® spin mini kit (Qiagen), using the protocol described by the manufacturer. Purified DNA was stored at -20°C.

For use in transfection of mammalian cells, transformed cells were picked from a single colony on an agar plate and grown in 100 mL LB broth for 20 h in a 37°C incubator with agitation at 220 rpm. Cells were then pelleted by centrifugation at 3,500 rpm as above and plasmid DNA purified using a Plasmid Midi Prep kit (Qiagen), using the protocol described by the manufacturer. Purified DNA was stored at -20°C.

DNA concentration was measured by absorbance at 260 nm using a NanoDrop 1000 spectrophotometer (Thermo Scientific) and DNA purity was monitored by the ratio of absorbance at 260 nm to 280 nm.

2.6.6 Agarose gel electrophoresis

TAE buffer (50 x) 2 M Tris-HCl, pH 8.0 1 M glacial acetic acid

50 mM EDTA

Agarose gels were prepared by adding the required amount of agarose (Bioline) into 1 x TAE buffer, diluted from a concentrated stock with dH2O. Agarose was dissolved by

Chapter 2 Materials and Methods

56 nucleic acid dye (Nippon Genetics) was added at a final dilution of 1:20,000 and the solution was poured into a horizontal casting tray. After solidification, gels were submerged in 1 x TAE buffer in a horizontal electrophoresis tank (Geneflow). Samples diluted 1:5 with 6 x DNA loading buffer (New England Biolabs) were loaded, along with 5 µL of a 100 bp DNA ladder (New England Biolabs) or 1 kbp ladder (Fermentas) and gels were run until the desired separation was achieved at 100 V at room temperature. Bands were visualised using a UV transilluminator and gels were imaged using a Bio-Rad Gel Doc EQ system.

Documento similar