Document heading doi: 10.1016/S1995-7645(14)60235-2
M
olecular characterization and
in vitro susceptibilities of
β
-lactamase
producing
E
scherichia coli,
K
lebsiella species,
A
cinetobacter baumannii,
P
seudomonas aeruginosa and
S
taphylococcus aureus to
CSE1034
and other
β
-lactams
Manu Chaudhary, Anurag Payasi*
Venus Medicine Research Centre, Hill Top Industrial Estate, Bhatoli Kalan, Baddi, H.P. -173205 India
Asian Pacific Journal of Tropical Medicine
journal homepage:www.elsevier.com/locate/apjtm
*Corresponding author: Dr. Anurag Payasi, Venus Medicine Research Centre, Hill
Top Industrial Estate, Bhatoli Kalan, Baddi, H.P.-173205, India. Tel: 91-1795-302072
Fax: 91-1795-302133
E-mail: [email protected]
Foundation Project: Supported by Venus Medicine Research Centre, Werne, Germany and BFMC, Faridkot, Punjab, India (Grant No. VPG-011-2011).
1. Introduction
Enterobacteriaceae are a family of Gram-negative bacilli that includes Escherichia coli (E. coli), Klebsiella
pneumoniae (K. pneumoniae) and other clinically important
species of the pathogenic bacteria. These organisms cause serious infections such as bacteraemia, pneumonia, urinary tract and wound infections[1]. According to the World
Health Organization (WHO), every year approximately 4.5
billion cases of infections by these organisms have been reported of which 1.9 million end in death[2]. In addition to
Enterobacteriaceae, Pseudomonas species, Acinetobacter species and Staphylococcus species also cause various types of infections in human[3-9]. It is increasingly being reported
that β-lactam antimicrobial agents are widely used to treat the infections caused by these organisms accounting for over 50% of all antibiotics use[10]. However, in recent
years, treatment of Enterobacteriaceae, Pseudomonas spp. Staphylococcus spp. and Acinetobacter spp. is becoming tough because of increasing antibiotic resistance[11,12].
There are many factors involved in the development of antibiotic resistance including over expression of efflux pump[13], acquisition of extended-spectrum β-lactamases ARTICLE INFO ABSTRACT
Keywords Clinical isolates CSE1034
Extended-spectrum-β-lactamases.
Objective:To study the prevalence of extended-spectrum β-lactamases (ESBLs) among 663 clinical isolates obtained from various parts of India and to study the occurrence of different variants of ESBLs among these isolates.
Methods:Phenotypic characterization and susceptibility studies were performed according to the methods described in Clinical and Laboratory Standards Institute guidelines. The occurrence of ESBL variants was analyzed with PCR using the previously reported primers.
Results: Among the six hundred sixty three isolates, the identified isolates were Acinetobacter baumannii (72), Escherichia coli (218), Klebsiella pneumoniae (30), Klebsiella oxytoca (63), Pseudomonas aeruginosa (264) and Staphylococcus aureus (16). PCR results revealed that approximately 89.0% of Pseudomonas aeruginosa isolates were positive for ESBL followed by Escherichia coli (85.3%), Klebsiella pneumoniae (76.6%), Klebsiella oxytoca (73.0%), Acinetobacter baumannii (72.2%) and Staphylococcus aureus (31.2%). The overall prevalence of ESBL was 82.5%. The presence of TEM type ESBLs were the predominant (in 186 isolates), followed by SHV (138), OXA (92), CTX-M (65), AmpC (33), KPC (28) and blaZ (5). Of the drugs involved in the study, CSE1034 was found to be the most efficacious against all of ESBL positive clinical isolates showing susceptibility approximately 95.7% with minimal inhibitory concentration values between 0.125 and 8.000µg/mL for all strains tested. The susceptibilities of penems (meropenem and imipenem and cilastatin) ranged between 83% and 93% for all the isolates. The susceptibilities of other drugs like piperacillin and tazobactam, amoxicillin and clavulanic acid, cefoperazone and sulbactam were <45% for all the isolates.
Conclusions:Results of the present study indicated that majority of the isolates was susceptible to CSE1034 and it could be a potent antibacterial agent for the treatment of severe bacterial infections caused by such organisms.
Article history: Received 23Jun 2014
Received in revised form 29Aug 2014
Accepted 4Sep 2014
Available online 23Sep 2014
(ESBLs) and metallo-β-lactamases[14,15], target site or outer
membrane modification[16].
Among these factors, prevalence of antibiotic resistance to beta-lactam antibiotics among members of
Enterobacteriaceae, Pseudomonas spp. and Acinetobacter spp. because of ESBL has been steadily increasing across the world over the past few years, resulting in the limitation of therapeutic options[11,12,14,15,17]. The overall prevalence
of ESBL producers is found to vary greatly in different geographical areas such as from 66.7% to 73.5% in India[9,18],
54.7% to 59.2% in Iran,41% in United Arab Emirates[19,20].
The ESBL enzyme has resistance not only to broad-spectrum cephalosporins, including oxymino-β-lactam antibiotics but also to other commonly used antibiotics including aminoglycosides and quinolones[21,22]. A number
of studies have demonstrated the decreased susceptibility of
Enterobacteriaceae to cephalosporins and other drugs[23-27].
Similarly, the decreased susceptibility rates of Pseudomonas aeruginosa (P. aeruginosa) and Acinetobacter baumannii (A. baumannii) to β-lactams, carbapenems, quinolones and aminoglycosides have been reported in various countries[11,28-30].
The increasing rate of the antibiotic resistance and its impact on treatment failure encouraged us to study newly reported concept of antibiotic adjuvant entity by which the increasing failure rate of antibiotics in treatment can be controlled. Information regarding the prevalence of antimicrobial resistance in pathogens can be used for selecting an alternative option.
Data on the prevalence of TEM, SHV, Amp-C, KPC and CTX-M variants in Enterobacteriaceae (E. coli and K.
pneumoniae) and non-fermenting Gram-negative bacilli
(A. baumannii and P. aeruginosa) from Indian hospitals
are needed. Therefore, the current study was undertaken to study the molecular characterisation of the selected ESBL producing isolates. The study also analysed the susceptibility behaviour of these isolates to different antibiotics including CSE1034, a new antibiotic adjuvant entity which is a combination of β-lactam, β-lactamase inhibitor and nonantibiotic adjuvant altogether termed as
CSE1034 with other antibiotics against these isolates. 2. Materials and methods
2.1. Clinical specimen collection and their identification All the specimens were collected from different hospitals of India. The name of hospitals can not be disclosed due to confidential agreement. This study was conducted from
January 2013 to March 2014. All the specimens including blood, urine, sputum and pus were isolated and identified isolates according to the standard microbiological techniques and VITEK-2 (BioMérieux, Marcy l’Etoile,
France)[31]. Before use, all the specimens were inoculated in
Soyabean-Casein Digest Agar (Hi-Media, Mumbai, India),
and incubated at 37°C for overnight. At least three to five
colonies of each specimen were selected from the S
oyabean-Casein Digest Agar plate and were transferred into a tube containing 10 mL of sterile Mueller-Hinton broth (Hi-Media,
Mumbai, India) to produce a suspension which matched the
turbidity standard of 0.5McFarland standard.
2.2. Collection procedure of clinical isolates and quality control points
The clinical isolates were collected using the procedures mentioned in the manual for the laboratory identification and antimicrobial susceptibility testing of bacterial pathogens of public health importance in the developing world. Quality control points were also followed while collecting the strains as mentioned in the above guidelines.
2.3. Antimicrobial agents
CSE1034 containing ceftriaxone sodium 1 g plus sulbactam sodium 0.5 g along with 37 mg adjuvant disodium edetate
(CSE1034 of Venus Remedies Limited, India), amoxicillin plus
potassium clavulanate 1.2 g (Augmentin, GlaxoSmithKline,
Pharmaceuticals Limited, Mumbai, India), piperacillin plus
tazobactam 4.5 g (Zosyn, Wyeth Pharmaceuticals, Mumbai,
India), meropenem 1 g (Meronem, AstraZeneca Pharma India
Limited, Banglore, India), imipenem plus cilastatin 500 mg (Imecila, Nicholas Piramal, Limited, India) cefoperazone plus
sulbactam 1 g (Magnex, Pfizer Limited, Mumbai, India) were
used in the study. All the drugs were reconstituted in sterile water for injection.
2.4. Phenotypic screening of isolates for ESBL
Screening of clinical isolates for ESBL production was performed according to the procedures as recommended by the Clinical and Laboratory Standards Institute (CLSI) [32], using indicator cephalosporins, ceftriaxone (30 µg),
ceftazidime (30µg) and cefotaxime (30µg). The respective zone size was interpreted according to the recommendations of CLSI. Isolates exhibiting zone size ≤22 for ceftazidime and ≤27 with cefotaxime were considered as possible ESBL producers. Further, testing was done using ceftazidime-clavulanic acid (30/10µg) and cefotaxime-clavulanic acid (30/10 µg) to confirm the ESBL production according to the
CLSI[32].
2.5. Detection of varinats of ESBL genes 2.5.1. DNA isolation
DNA isolation from all the clinical isolates phenotypically confirmed to be ESBL positive and was carried out according to the method of alkaline lysis[33]. Five millilitre of overnight
grown culture was used for the DNA isolation. 2.5.2. PCR
The detection of variants of ESBL genes, such as TEM-1, TEM-3, TEM-50, SHV-1, SHV-4, SHV-10, SHV-28, Amp-C, OXA-2, OXA-10, OXA-23, OXA-48, KPC-1, KPC-2, CTX -M-1, CTX-M-9 and Bla-Z was carried out as described previously[34-46]. The primers used in the study are shown
in Table 1. All of the respective primers were obtained from
Sigma Aldrich Chemicals Pvt. Ltd., Banglore, India. For PCR amplifications, about 200 pg of DNA was added to 20µL mixture containing 0.5 mmol/L of dNTPs, 1.25 µmol/L of each primer and 3.0µL/IU of Taq polymerase (Banglore Genei) in
1伊 PCR buffer. Amplification was performed in a Eppendorf thermal cycler (Germany).
Table 1
Oligonucleotides used in the study for each tested genes.
Primer Primer sequences (5'-3') Amplicon (base pair)
References TEM-1 F-5' ATGAGTATTCAACATTTCCG-3' 858 [41]
R-5' CCAATGCTTATTCAGTGAGG-3'
TEM-3 F-ATAAAATTCTTGAAGAC-3' 652 [41]
R-TTACCAATGCTTAATCA-3'
TEM-50 F-AAGACGAAAGGGCCTCGTG 1074 [38]
R-GGTCTGACAGTTACCAATGC
SHV-1 F-5' CTGGGAAACGGAACTGAATG-3' 308 [41]
R-5' GGGGTATCCCGCAGATAAAT-3'
SHV-4 F-5' TCAGCGAAAAACACCTTGC-3' 322 [34]
R-5' CGATCGTCCACCATCCAGTG-3'
SHV-10 F-5' CCGATAAGACCGGAGTTCGC-3' 248 [34]
F-5' AGTCATATCGCCCGGCAC-3'
SHV-28 F-5' ATTTGTCGCTTCTTTACTCGC-3' 1052 [40]
R-5' GGTCAAAGGTAACGCCATAAA-3'
AmpC F-5CCCCGCTTATAGAGCAACAA-3 634 [35]
R-5TCAATGGTCGACTTCACACC-3
OXA-2 5’-GCCAAAGGCACGATAGTTGT-3’ 701 [38]
5’-GCGTCCGAGTTGACTGCCGG-3’
OXA-10 5’-TCTTTCGAGTACGGCATTAGC-3’ 759 [38]
5’-CCAATGATGCCCTCACTTTCC-3’
OXA-23 5’-GATCGGATTGGAGAACCAGA-3’ 501 [46]
5’-ATTTCTGACCGCATTTCCAT-3’
OXA-48 5’-GCGTGGTTAAGGATGAACAC-3’ 438 [42]
5’-CATCAAGTTCAACCCAACCG-3’
KPC-1 F: 5'-CTTGCTGCCGCTGTGCTG-3' 489 [45]
R: 5’-GCAGGTTCCGGTTTTGTCTC-3'
KPC-2 F: 5'-GCTACACCTAGCTCCACCTTC-3' 989 [43]
R: 5'-GCATGGATTACCAACCACTGT-3'
CTX-M-1 F: 5' GACGATGTCACTGGCTGAGC3' 499 [41]
R: 5’ AGCCGCCGACGCTAATACA3’
CTX-M-9 F: 5' TATTGGGAGTTTGAGATGGT3' 932 [38]
R: 5’ TCCTTCAACTCAGCAAAAGT3
Bla-Z F: 5' AAGAGATTTGCCTATGCTTC3' 517 [36]
R: 5’ GCTTGACCACTTTTATCAGC3 F: Sense primer; R: Antisense primer. 2.5.3. Gel electrophoresis
The amplified products were separated in 1.5% agarose
gel containing 2.5µL of 10 mg/mL ethidium bromide. The gel was run at 70 v for 1 h. The gel images were taken under ultraviolet light using gel documentation system (Bio-Rad, USA). A100 bp ladder (Banglore Genie) was used to measure
the molecular weights of amplified products. The images of ethidium bromide stained DNA bands were visualized using a gel documentation system (Bio-Rad, USA).
2.6. Antibiotic susceptibility testing
Susceptibility to various classes of antibiotics were done by two methods: minimum inhibitory concentration (MIC) and
antibiotic susceptibility (AST).
2.7. MIC
MIC was determined according to the guidelines of CLSI[32].
E. coli ATCC 35218(TEM), K. pneumoniae ATCC700603(SHV), Enterobacter cloacae ATCCBAA-1143(AmpC)(E. cloacae), K. pneumoniae ATCCBAA-1705 (KPC), E. coli NCTC13302(OXA)
and E. coli NCTC13353 (CTX-M-15), were procured from
LGC, Promochem, Bangalore, India, which were used as positive controls. MIC value represents the lowest dilution at
which bacteria fail to grow. Serial two fold dilutions of the drugs from 0.03125 to 1024µg/mL were made using C
ation-Adjusted Mueller-Hinton (Hi Media, Mumbai, India) broth in
wells of 96-well plate. 2.8. AST
AST testing of the drugs were determined by disc diffusion method according to the CLSI. Positive controls were the same which were used in MIC study. Inoculum containing 106 CFU/mL of test strain was spread with a sterile swab on
a Petri dish containing Mueller-Hinton agar and the plates were dried. Then, disc of the respective antibiotic was placed in the plate and allowed to diffuse at room temperature. The plates were incubated in the upright position at 37 °C for 18
h. After incubation the zone of inhibition around the disc was measured in millimeter, and then was averaged and the mean values were recorded. The discs of CSE1034(30:15µg),
piperacillin plus tazobactam (100:10µg), amoxicillin plus
clavulanic acid (20:10µg), cefoperazone plus sulbactam (75:30 µg), imipenem plus cilastatin (10µg) and meropenem (10µg)
were obtained from HiMedia (Mumbai, India). All the test were repeated 3 times and results were expressed as mean依
SD values. 3. Results
3.1. Isolation of clinical isolate from specimens
Out of 3816 clinical specimens, 1365 specimens were sterile; 2451 specimens showed the growth of which 1788 isolates were of Mycoplasma, Candida albicans, Haemophilus influenzae, Mycobacterium tuberculosis, Salmonells typhi, Staphylococcus epidermidis, Sterptococcus pyogenes, Nisseria spp., Burkholderia spp. which were not part of study. The remaining specimens showed the growth of 663 isolates which includes P. aeruginosa (264/663, 39.8%)
followed by E. coli (218/663, 32.8%), A. baumannii (72/663, 10.8%), Klebsiella oxytoca (K. oxytoca) (63/663; 9.5%), K.
pneumoniae (30/663; 4.5%) and Staphylococcus aureus (S.
aureus)(16/663; 2.4%)(Table 2).
Table 2
Isolation of target clinical isolates from different clinical specimens.
Name of the specimens
Number of
specimens baumanniiA. coliE. pneumoniaeK. oxytocaK. aeruginosa S. aureusP.
Blood 749 16 46 6 13 41 1 Urine 1088 8 129 4 8 34 4 Sputum 731 35 23 17 33 31 1 Pus 1248 13 20 3 9 158 10 Total 3816 72 218 30 63 264 16 3.2. Detection of ESBL
Among the 663 isolates, phenotypical 87.6%(n=581) isolates
were found to be ESBL positive by disc diffusion method.
with PCR revealed approximately 82.5% (n=547) isolates
were ESBL positive, and there was 5.1% decrease in the ESBL positive isolates when analyzed with genotypic method. PCR results indicated that approximately 89.0% of P. aeruginosa
isolates were positive for ESBL followed by E. coli (85.3%),
K. pneumoniae (76.6%), K. oxytoca (73.0%), A. baumannii (72.2%) and S. aureus (31.2%)(Table 3). For further study only genotypically characterized ESBL isolates were used.
Table 3
Detection of ESBLs among clinical isolates by disc diffusion and PCR methods.
Name of species
(total)
No. of isolates positive for
ESBL by disc diffusion (%)
No. of isolates positive for ESBL by PCR(%) A. baumannii (72) 54(75.0) 52(72.2) E. coli (218) 196(89.9) 186(85.3) K. pneumoniae (30) 24(80.0) 23(76.6) K. oxytoca (63) 54(85.7) 46(73.0) P. aeruginosa (264) 245(92.8) 235(89.0) S. aureus (16) 8(50.0) 5(31.3) Total (663) 581(87.6) 547(82.5) 3.3. Diversity of ESBLs
PCR analyses using specific primers for class A, C and D
β-lactamase genes revealed the following frequencies: TEM type ESBLs (blaTEM-1, blaTEM-3, blaTEM-50) were the most
frequently detected, followed by SHV type ESBLs (SHV-1,
SHV-4, SHV-10, SHV-28), OXA type ESBLs (OXA-2, OXA-10,
OXA-23, OXA-48) , CTX-M type ESBLs (CTX-M-1, CTX-M-9),
AmpC , KPC type ESBLs (KPC-1, KPC-2) and blaZ(Table 4).
3.4. MIC
The MIC values of CSE1034, piperacillin plus tazobactam, amoxicillin plus clavulanic acid, cefoperazone plus sulbactam, imipenem plus cilastatin and meropenem were determined against all of the selected clinical isolates and presented in Table 5. MIC values of CSE1034 for 95.7%,
92.3%, 91.3%, 93.5%, 94.9%, and 93.3% isolates of E. coli, A. baumannii, K. pneumoniae, K. oxytoca, P. aeruginosa and S. aureus, respectively were between 0.125 and 8.000µg/mL whereas penems (meropenem and imipenem plus cilastatin)
MIC ranged from 0.125 to 1.000 µg/mL for 83.9% to 93.3%
isolates for the same isolates. Piperacillin plus tazobactam exhibited MIC valueof 4.000-16.000µg/mL for 45.7% isolates of E. coli while 38.5%, 34.8%, 41.3%, 38.7% and 36.0% isolates of A. baumannii, K. pneumoniae, K. oxytoca, P. aeruginosa and S. aureus respectively with MIC values of 8.000 to 16.000
µg/mL, respectively. Amoxycillin plus clavulanic acid exhibited MIC values of 4.000-8.000 µg/mL against 35.5%,
28.8%, 26.0%, 26.0%, 25.9% and 25.3% isolates of E. coli, A. baumannii, K. pneumoniae, K. oxytoca, P. aeruginosa and S. aureus, respectively. Cefoperazone plus sulbactam produced
MIC values 8.000-16.000 µg/mL against 31.2%, 25.0%, 21.7%,
21.7%, 23.8%, and 22.7% isolates of E. coli, A. baumannii, K. pneumoniae, K. oxytoca, P. aeruginosa and S. aureus, respectively. The detailed results are shown in the Table 5. 3.5. AST
The antibiotic susceptibility profile was determined by disc diffusion method and results are presented in Table 6. Of the drugs included in the study, CSE1034 seems to be more efficacious. Approximately, more than 90% isolates
were susceptible to CSE1034 with AST values between 23 and 29 mm. Imipenem plus cilastatin was found second most active agent with approximately 90% isolates of E. coli, A.
baumannii, K. pneumoniae, K. oxytoca, P. aeruginosa and S. aureus were susceptible with AST values 16-35 mm whereas >80% isolates showed susceptibility to meropenem with 16 -29 mm. Piperacillin plus tazobactam was susceptible in <45% isolates with AST values 22-35 mm. Amoxycillin plus clavulanic acid found to be susceptible to <35% isolates with
AST values 18-31 mm. Cefoperazone plus sulbactam found to be susceptible to <31% with AST values 21-30 mm. The detailed results are shown in the Table 6.
4. Discussion
ESBLs continue to be the leading cause of resistance to β-lactam antibiotics among Gram-negative bacteria. There has been increased incidence and prevalence of ESBLs which show a wide spread in hospital settings worldwide[47].
In this study, 663 clinical isolates of Gram-negative and
Gram-positive isolates were collected from various clinical specimens and were subjected to screening for ESBLs. In our study, approximately 87.6% of the isolates were observed to
be ESBL positive by disc diffusion methods. However, when the same strains were processed to check the positivity of ESBL with PCRas it is considered as gold standard only 82.5% of isolates were confirmed to be ESBL positive. These
results suggest that disc diffusion method may have some false detection. Previous studies also demonstrated the steadily increasing frequency of ESBLs 50% to 85% in A.
baumannii[48,49], 4% to 78% in Klebsiella species[50-52], 46%
to 79% in E. coli[53,54], 45% to 53.9% in P. aeruginosa[55,56].
Table 4
Distribution of variants of ESBL enzymes in different bacterial species.
Species (no. of ESBL positive
isolates by PCR, n=547) TEM-1 TEM-3 TEM-50 SHV-1 SHV-4 SHV-10 SHV-28 AmpC OXA-2OXA-10 OXA-23 OXA-48 KPC-1KPC-2 CTX-M-1 CTX-M-9 Bla-Z
A. baumannii (52) 5 5 6 10 7 - - 3 4 - - 12 - - - - -E. coli (186) 37 32 - 24 20 10 5 14 - - - 23 - - - 21 -K. pneumoniae (23) 5 5 - 1 - - - 6 6 - - -K. oxytoca (46) 10 - - 10 - - - 6 8 8 - 4 -P. aeruginosa (235) 34 33 14 31 - 20 - 16 5 - - 42 - - 15 25 -S. aureus (5) - - - 5
Increased prevalence of ESBL in our community is suggested to be due to intense prescription of the third generation cephalosporins in hospitals and the dissemination of these organisms by inappropriate hygienic measures. The results of the antibiotic susceptibility testing performed on the all chosen clinical isolates showed that CSE1034 was the most active agent and susceptibility rates of it against the studied isolates were very close to the penems (meropenem and
imipenem plus cilastatin). CSE1034 however was observed to show an intermediate and resistant trend against higher OXA types and a few Amp-C types. Earlier studies also supports the higher susceptibilities of CSE1034 against these isolates[56,57]. Less susceptibility of piperacillin
plus tazobactam in Enterobacteriaceae (E. coli and K.
pneumoniae) and non-Enterobacteriaceae (A. baumannii
and P. aeruginosa) has been reported in India[58-60],which
is in line with current findings with susceptibility <50%
against most pathogens. Several studies have also reported meropenem resistance in Enterobacteriaceae and
non-Enterobacteriaceae isolated from India and abroad[59,61].
In the current study, resistance to meropenem was 18.7% for P. aerugionsa which are in line with the result
of an earlier study where resistance to meropenem for P. aeruginosa was 20.3%[49]. The resistance to meropenem in
A. baumannii was 17.3% in our study which was observed
to be in accordance with a previous report[49]. Furthermore,
our data shows 17.4% of K. pneumoniae and 9.3% of E. coli
isolates were resistant to meropenem. The resistance to meropenem in these isolates probably results from reduced accumulation of drug or over activation of efflux pump[62].
A very high susceptibility of CSE1034 against these isolates is likely to be associated with synergistic activity of components.
Results of this study demonstrate that the frequency of ESBL mediated resistance among the clinical isolates has been increasing and the drugs commonly used for the treatment of infections appear to be resistant caused by ESBL producing organisms. Data obtained from this investigation clearly demonstrate the potent in vitro activity of CSE1034 against ESBL producing organisms. Hence, in the case of infection with ESBL producing organisms, CSE1034 can be a drug to be chosen for the treatment.
Conflict of interest statement
We declare that we have no conflict of interest.
Table 5
Comparative MIC values of ESBL producing strains.
Name of micro-organisms
MIC values of drugs (µg/mL)
Total No. of strains (547
clinical isolates)
Ceftriaxone plus sulbactam
(CSE1034) Piperacillin plus tazobactam Amoxicillin plus clavulanic acid Cefoperazone plus sulbactam Imipenem plus cilastatin Meropenem S I R S I R S I R S I R S I R S I R E. coli 186 0.125-8.000 16-32 64-128 4-16 32-64 128-256 4-8 16 32-512 8-16 32 64-512 0.125-1.000 2 4-32 0.50-1.00 2 4-32 A. baumannii 52 0.250-8.000 16-32 64-128 8-16 32-64 128-512 4-8 16 32-512 8-16 32 64-512 0.125-1.000 2 4-16 0.50-1.00 2 4-64 K. pneumoniae 23 0.250-8.000 16-32 64-128 8-16 32-64 128-256 4-8 16 32-512 8-16 32 64-512 0.125-1.000 2 4-16 0.25-1.00 2 4-32 K. oxytocca 46 0.500-8.000 16-32 64-128 8-16 32-64 128-256 4-8 16 32-512 8-16 32 64-512 0.125-1.000 2 4-32 0.50-1.00 2 4-32 P. aeruginosa 235 1.000-8.000 16-32 64-128 8-16 32-64 128-512 4-8 16 32-512 8-16 32 64-512 0.125-1.000 2 4-16 0.5-1.00 2 8-64 S. aureus 5 0.125-8.000 16-32 64-128 8-16 32-64 128-256 4-8 16 32-512 8-16 32 64-512 0.125-1.000 2 4-16 0.25-1.00 2 4-16
E. coli ATCC35218(TEM) 1 0.500 4 8 8 0.250 0.25
K. pneumoniae ATCC700603 (SHV) 1 0.500 4 8 8 0.250 0.25
Enterobacter cloacae ATCCBAA-1143(AmpC) 1 2.000 8 8 8 0.500 0.25
K. pneumoniae ATCCBAA-1705(KPC) 1 8.000 16 32 16 1.000 2.00
E. coli NCTC13302(OXA) 1 8.000 32 16 32 2.000 2.00
E. coli NCTC13353(CTX-M-15) 1 1.000 8 8 8 0.500 0.50
S: Susceptible; I: Intermediate; R: Resistance. E. coli ATCC25922 was used as a quality control strain.
Table 6
Comparative antimicrobial susceptibility of ESBL producing strains. Name of micro-organisms Total No.
of strains
Inhibition zone of drugs (mm)
Ceftriaxone plus sulbactam (CSE1034) Piperacillin plus tazobactam Amoxicillin plus clavulanic acid Cefoperazone plus sulbactam Imipenem plus cilastatin Meropenem S I R S I R S I R S I R S I R S I R E. coli 186 25-29 20-22 10-19 22-29 18-20 7-17 19-22 15-18 7-14 21-25 16-20 10-15 23-33 20-22 11-19 23-29 20-22 11-19 A. baumannii 52 23-28 14-20 7-13 22-25 18-20 11-17 18-24 15-17 8-14 21-28 18-20 13-17 16-27 14-15 10-13 16-27 14-15 10-13 K. pneumoniae 23 23-29 20-22 8-19 22-28 18-20 9-17 19-24 15-18 11-14 21-29 16-20 10-15 23-29 20-22 15-19 23-29 20-22 13-19 K. oxytocca 46 24-29 20-22 11-19 22-30 18-20 8-17 19-25 15-18 9-14 21-30 16-20 12-15 23-35 20-22 9-19 23-29 20-22 9-19 P. aeruginosa 235 23-29 14-20 10-13 22-35 15-20 11-14 18-27 15-17 11-14 22-29 18-20 13-17 19-33 16-18 10-15 19-24 16-18 7-15 S. aureus 5 23-30 14-20 10-13 22-25 15-20 11-14 21-31 15-20 13-16 21-25 16-20 12-15 19-30 14-15 7-13 19-33 14-15 10-13
E. coli ATCC35218(TEM) 1 29 22 21 21 27 26
K. pneumoniae ATCC700603 (SHV) 1 31 23 22 22 29 29
E. cloacae ATCCBAA-1143(AmpC) 1 28 15 20 19 30 27
K. pneumoniae ATCCBAA-1705(KPC) 1 25 23 17 18 25 22
E. coli NCTC13302(OXA) 1 26 19 13 17 24 23
E. coli NCTC13353(CTX-M-15) 1 27 20 22 21 28 24
Acknowledgements
Researchers are thankful to Venus Medicine Research
Centre, Werne, Germany for providing assistance (Grant No. VPG-011-2011) to carry out this study.
References
[1] Rozenberg-Arska M, Visser MR. Enterobacteriaceae. Infectious diseases. 2nd ed. New York: Mosby; 2004.
[2] Jarząb A, Górska-Frączek S, Rybka J, Witkowska D. [Enterobacteriaceae infection-diagnosis, antibiotic resistance and prevention]. Postepy Hig Med Dosw 2011; 65: 55-72. Polish. [3] Pressler T, Bohmova C, Conway S, Dumcius S, Hjelte L, Høiby
N, et al. Chronic Pseudomonas aeruginosa infection definition: EuroCareCF working group report. J Cys Fibro 2011; 10(Suppl 2):
S75-S78.
[4] Mesaros N, Nordmann P, Plésiat P, Roussel-Delvallez M, Van Eldere J, Glupczynski Y, et al. Pseudomonas aeruginosa: resistance and therapeutic options at the turn of the new millennium. Clin Microbiol Infect 2007; 13: 560-578.
[5] Karageorgopoulos DE, Falagas ME. Current control and treatment of multidrug-resistant Acinetobacter baumannii infections. The Lancet Infect Dis 2008; 8: 751-762.
[6] Fishbain J, Peleg AY. Treatment of Acinetobacter infections. Clin Infect Dis 2010; 51: 79-84.
[7] Rubinstein E, Kollef MF, Nathwani D. Pneumonia caused by methicillin-resistant Staphylococcus aureus. Clin Infect Dis 2008;
46(Suppl 5): S378-S85.
[8] Kloos WE, Bannerman TL. Update on clinical significance of coagulase-negative staphylococci. Clin Microbiol Rev 1994; 7: 117-140.
[9] Dalela G. Prevalence of extended spectrum beta-lactamase (ESBL) producers among Gram-negative bacilli from various clinical isolates in a tertiary care hospital at Jhalawar, Rajasthan, India. J Clin Diagn Res 2012; 6: 182-187.
[10] Kumar S, Mehra SK, Kanta RC. Extended spectrum β-lactamases among clinical isolates of Enterobacteriaceae ssp.: prevalence and susceptibility pattern at a tertiary care hospital. Scholar J App Med Sci 2014; 2: 862-864.
[11] Owlia P, Azimi L, Gholami A, Asghari B, Lari AR. ESBL- and MBL-mediated resistance in Acinetobacter baumannii: a global threat to burn patients. Infez Med 2012; 20: 182-187.
[12] Afunwa RA, Odimegwu DC, Iroha RI, Esimone CO. Antimicrobial resistance status and prevalence rates of extended spectrum beta-lactamase (ESBL) producers isolated from a mixed human population. Bos J Basic Med Sci 2011; 11: 91-96.
[13] Fischer N, Raunest M, Schmidt TH, Koch DC, kandt C. Efflux pump-mediated antibiotics resistance: insights from computational structural biology. Interdiscip Sci 2014; 6: 1-12. [14] Chandramohan L, Revell PA. Prevalence and molecular
characterization of extended-spectrum-β -lactamase-producing Enterobacteriaceae in a pediatric patient population. Antimicrob Agents Chemother 2012; 56: 4765-4770.
[15] Peshattiwar PD, Peerapur BV. ESBL and MBL mediated resistance in Pseudomonas aeruginosa: an emerging threat to clinical
therapeutics. J Clin Diagn Res 2011; 5: 1552-1554.
[16] Delcour AH. Outer membrane permeability and antibiotic resistance. Biochim Biophy Acta 2009; 1794: 808-816.
[17] Behroozi A, Rahbar M, Yousefi JV. Frequency of extended spectrum beta-lactamases (ESBLs) producing Escherichia coli and Klebseilla pneumonia isolated from urine in an Iranian 1000-bed tertiary care hospital. Afr J Microbiol Res 2010; 4: 881-884. [18] Hawkey PM. Prevalence and clonality of extended-spectrum
beta-lactamases in Asia. Clin Microbiol Infect 2008; 14: 159-165. [19] Ghafourian S, Bin Sekawi Z, Sadeghifard N, Mohebi R, Kumari
Neela V, Maleki A, et al. The prevalence of ESBLs producing Klebsiella pneumoniae isolates in some major hospitals, Iran. Open Microbiol J 2011; 5: 91-99.
[20] Al-Zarouni M, Senok A, Rashid F, Al-Jesmi SM, Panigrahi D. Prevalence and antimicrobial susceptibility pattern of extended-spectrum beta-lactamase-producing Enterobacteriaceae in the United Arab Emirates. Med Princ Pract 2008; 17: 32-36.
[21] Pitout JD. Infections with extended-spectrum beta-lactamase-producing Enterobacteriaceae: changing epidemiology and drug treatment choices. Drugs 2010; 70: 313-333.
[22] Endimiani A, Paterson DL. Optimizing therapy for infections caused by Enterobacteriaceae producing extended-spectrum beta-lactamases. Semin Respir Crit Care Med 2007; 28: 646-655. [23] Wani KA, Thakur MA, Fayaz AS, Fomdia B, Gulnaz B, Maroof
P. Extended spectrum β-lactamase mediated resistance in Escherichia coli in a tertiary care hospital. Int J Health Sci 2009;
3: 155-163.
[24] Duttaroy B, Mehta S. Extended spectrum b lactamases (ESBL) in clinical isolates of Klebsiella pneumoniae and Escherichia colli. Indian J Pathol Microbiol 2005; 48: 45-48.
[25] Kibret M, Abera B. Antimicrobial susceptibility patterns of E. coli from clinical sources in northeast Ethiopia. Afr Health Sci 2011;
11(Suppl 1): S40-S45.
[26] Sharma S, Bhat GK, Shenoy S. Virulence factors and drug resistance in Escherichia coli isolated from extraintestinal infections. Indian J Med Microbiol 2007; 25: 369-373.
[27] Giske CG, Monnet DL, Cars O, Carmeli Y, ReAct-Action on Antibiotic Resistance. Clinical and economic impact of common multidrug resistant Gram-negative bacilli. Antimicrob Agents Chemother 2008; 52: 813-821.
[28] Mansoor T, Musani MA, Khalid G, Kamal M. Pseudomonas aeruginosa in chronic suppurative otitis media: sensitivity spectrum against various antibiotics in Karachi. J Ayub Med Coll Abbottabad 2009; 21: 120-123.
[29] Tripathi P, Banerjee G, Saxena S, Gupta MK, Ramteke PW. Antibiotic resistance pattern of Pseudomonas aeruginosa isolated from patients of lower respiratory tract infection. Afr J Microbiol Res 2011; 5: 2955-2959.
[30] Mohajeri P, Farahani A, Feizabadi MM, Davoodabadi A, Noroozi B. The prevalence of ESBL isolates of Acinetobacter baumannii using pulsed-field gel electrophoresis. Zahedan J Res Med Sci 2014; 16: 20-23.
[31] Collee JG, Duguid JP, Fraser AG, Marmion BP, Simmons A. Laboratory strategy in the diagnosis of infective syndromes. In: Collee JG, Fraser AG, Marmion BP, Simmons A, editors. Mackie and McCartney practical medical microbiology. 14th ed. New York: Churchill Livingstone; 1996, p. 53-94.
[32] Clinical Laboratory Standard Institute. Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. Pennsylvania: Clinical Laboratory Standard Institute; 2013.
[33] Sambrook JF, Russell DW. Molecular cloning: a laboratory manual. New York: Cold Spring Harbor Laboratory Press; 2001. [34] Chanawong A, M’zali FH, Heritage J, Lulitanond A, Hawkey PM.
Discrimination of SHVβ-lactamase genes by restriction site insertion-PCR. Antimicrob Agents Chemother 2001; 45: 2110-2114. [35] Féria C, Ferreira E, Correia JD, Gonçalves J, Caniça M. Patterns
and mechanisms of resistance to lactams and beta-lactamase inhibitors in uropathogenic Escherichia coli isolated from dogs in Portugal. J Antimicrob Chemother 2002; 49: 77-85. [36] Gao J, Ferreri M, Liu XQ, Chen LB, Su JL, Han B. Development of
multiplex polymerase chain reaction assay for rapid detection of Staphylococcus aureus and selected antibiotic resistance genes in bovine mastitic milk samples. J Vet Diagn Invest 2011; 23: 894 -901.
[37] Kansal R, Pandey A, Asthana AK. Beta-lactamase producing Acinetobacter species in hospitalized patients. Indian J Pathol Microbiol 2009; 52: 456-457.
[38] Hassan H, Abdalhamid B. Molecular characterization of extended-spectrum beta-lactamase producing Enterobacteriaceae in a Saudi Arabian tertiary hospital. J Infect Dev Ctries 2014; 8: 282 -288.
[39] Hussain M, Hasan F, Shah AA, Hameed A, Jung M, Rayamajhi N, et al. Prevalence of class A and AmpCβ-lactamases in clinical Escherichia coli isolates from Pakistan institute of medical science, Islamabad, Pakistan. Jpn J Infect Dis 2011; 64: 249-252. [40] Jemima SA, Verghese S. SHV-28, an extended-spectrum
beta-lactamase produced by a clinical isolate of Klebsiella pneumoniae in south India. Indian J Med Microbiol 2009; 27: 51-54.
[41] Khosravi AD, Hoveizavi H, Mehdinejad M. Prevalence of Klebsiella pneumoniae encoding genes for CTX-M-1, TEM-1and
SHV-1 extended-spectrum beta-lactamases (ESBL) enzymes in clinical specimens. Jundishapur J Microbiol 2013; doi: 10.5812/ jjm.8256.
[42] Nordmann P, Naas T, Poirel L. Global spread of carbapenemase-producing Enterobacteriaceae. Emerg Infect Dis 2011; 17: 1791 -1798.
[43] Pournaras S, Protonotariou E, Voulgari E, Kristo I, Dimitroulia E, Vitti D, et al. Clonal spread of KPC-2 carbapenemase-producing Klebsiella pneumoniae strains in Greece. J Antimicrob Chemother 2009; 64: 348-352.
[44] Strateva T, Ouzounova-Raykova V, Markova B, Todorova A, Marteva-Proevska Y, Mitov I. Problematic clinical isolates of Pseudomonas aeruginosa from the university hospitals in Sofia, Bulgaria: current status of antimicrobial resistance and prevailing resistance mechanisms. J Med Microbiol 2007; 56: 956-963. [45] Tenover FC, Kalsi RK, Williams PP, Carey RB, Stocker S, Lonsway
D, et al. Carbapenem resistance in Klebsiella pneumoniae not detected by automated susceptibility testing. Emerg Infect Dis 2006; 12: 1209-1213.
[46] Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents 2006; 27: 351-353.
[47] MiróE, Mirelis B, Navarro F, Rivera A, Mesa RJ, Roig MC, et al. Surveillance of extended spectrum SHVβ-lactamases from clinical samples and fecal carriers in Barcelona, Spain. J Antimicrob Chemother 2005; 56: 1152-1155.
[48] Mittal N, Nair D, Gupta N, Rawat D, Kabra S, Kumar S, et al. Outbreak of Acinetobacter spp. septicemia in a neonatal ICU. Southeast Asian J Trop Med Public Health 2003; 34: 365-366. [49] Kamel GM, Ezzeldeen NA, El-Mishad YM, Ezzat RF. Susceptibility
pattern of Pseudomonas aeruginosa against antimicrobial agents and some plant extracts with focus on its prevalence in different sources. Global Vet 2011; 6: 61-72.
[50] Hoşoğlu S, Gündes S, Kolayli F, Karadenizli A, DemirdağK, Günaydin M, et al. Extended-spectrum beta-lactamases in ceftazidime-resistant Escherichia coli and Klebsiella pneumoniae isolates in Turkish hospitals. Indian J Med Microbiol 2007; 25: 346-350.
[51] Cordero L, Rau R, Taylor D, Ayers LW. Enteric gram-negative bacilli bloodstream infections: 17 years’ experience in a neonatal intensive care unit. Ame J Infect Control 2004; 32: 189-195. [52] Xiong Z, Zhu D, Zhang Y, Wang F. [Extended-spectrum
β-lactamase in Klebsiella pneumoniae and Escherichia coli isolates]. Zhonghua Yi Xue Za Zhi 2002; 82: 1476-1479. Chinese. [53] Varaiya AY, Dogra JD, Kulkarni MH, Bhalekar PN. Extended
spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae in diabetic foot infection. Indian J Pathol Microbiol 2008; 51: 370-372.
[54] Chaudhuri BN, Rodrigues C, Balaji V, Iyer R, Sekar U, Wattal, Chitnis DS, Dhole TN, Joshi S. Incidence of ESBL producers amongst Gram-negative bacilli isolated from intra-abdominal infections across India (based onSMART study, 2007 data). J Assoc Physicians India 2011; 59: 287-292.
[55] Sasirekha B. Prevalence of ESBL, Ampc β-lactamases and MRSA among uropathogens and its antibiogram. EXCLI J 2013; 12: 81-88. [56] Chaudhary M, Payasi A. Antimicrobial susceptibility pattern and
molecular characteriz ation of Klebsiella pneumoniae clinical isolates from North India patients. Int J Med Med Sci 2013; 46: 1218-1224.
[57] Chaudhary M, Payasi A. Rising antimicrobial resistance of Pseudomonas aeruginosa isolated from clinical specimens in India. J Proteomics Bioinform 2013; 6: 005-009.
[58] Kumar MS, Lakshmi V, Rajagopalan R. Occurrence of extended spectrum beta-lactamases among Enterobacteriaceae spp. isolated at a tertiary care institute. Indian J Med Microbiol 2006;
24: 208-211.
[59] Gupta E, Mohanty S, Sood S, Dhawan B, Das BK, Kapil A. Emerging resistance to carbapenems in a tertiary care hospital in north India. Indian J Med Res 2006; 124: 95-98.
[60] Jaggi N, Sissodia P, Sharma L. Control of multidrug resistant bacteria in a teritiary care hospital in India. Antimicrob Resis Infect Control 2012; 1: 23.
[61] Grundmann H, Livermore DM, Giske CG, Canton R, Rossolini GM, Campos J, et al. Carbapenem-non-susceptible Enterobacteriaceae in Europe: conclusions from a meeting of national experts. Euro Surveill 2010; 15: 19711.
[62] Sinha M, Srinivasa H. Mechanisms of resistance to carbapenems in meropenem-resistant Acinetobacter isolates from clinical samples. Indian J Med Microbiol 2007; 25: 121-125.
