• No se han encontrado resultados

Efecto de suplementar las dietas de pollos broiler con compuestos funcionales de orujo de oliva (Olea europaea) sobre la salud intestinal del animal

N/A
N/A
Protected

Academic year: 2020

Share "Efecto de suplementar las dietas de pollos broiler con compuestos funcionales de orujo de oliva (Olea europaea) sobre la salud intestinal del animal"

Copied!
30
0
0

Texto completo

(1)UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS GRADO EN BIOTECNOLOGÍA. DEPARTAMENTO DE PRODUCCIÓN AGRARIA. Efecto de suplementar las dietas de pollos broiler con compuestos funcionales de orujo de oliva (Olea europaea) sobre la salud intestinal del animal Effects of supplementing broiler chicken diets with bioactive olive pomace extracts (Olea europaea) on intestinal health. TRABAJO FIN DE GRADO Autor: IGNACIO MANUEL QUINTERO MORÓN Tutor: DAVID MENOYO LUQUE. Madrid, Julio de 2019.

(2) UNIVERSIDAD POLITÉCNICA DE MADRID ESCUELA TÉCNICA SUPERIOR DE INGENIERÍA AGRONÓMICA, ALIMENTARIA Y DE BIOSISTEMAS. GRADO DE BIOTECNOLOGÍA. Efecto de suplementar las dietas de pollos boiler con compuestos funcionales de orujo de oliva (Olea europaea) sobre la salud intestinal del animal Effects of supplementing broiler chicken diets with bioactive olive pomace extracts (Olea europaea) on intestinal health. TRABAJO FIN DE GRADO. Ignacio Manuel Quintero Morón. MADRID, 2019. Director: David Menoyo Luque Profesor Titular de Universidad Departamento de Producción Agraria II.

(3) TITULO DEL TFG- Efecto de suplementar las dietas de pollos boiler con compuestos funcionales de orujo de oliva (Olea europaea) sobre la salud intestinal del animal - Effects of supplementing broiler chicken diets with bioactive olive pomace extracts (Olea europaea) on intestinal health. Memoria presentada por Ignacio Manuel Quintero Morón para la obtención del título de Graduado en Biotecnología por la Universidad Politécnica de Madrid. Fdo: Alumno. VºBº Tutor y Director del TFG. D. David Menoyo Luque Profesor Titular de Universidad Departamento de Producción Agraria ETSIAAB - Universidad Politécnica de Madrid. Madrid, 10 de julio, 2019 III.

(4) INDEX List of tables .................................................................................................................... V List of figures ................................................................................................................ VI List of Abbreviations................................................................................................... VII SUMMARY .................................................................................................................. IX CHAPTER 1. INTRODUCTION AND OBJECTIVES .............................................. 1 1.1. Introduction .......................................................................................................... 1 1.2. Objectives .............................................................................................................. 3 CHAPTER 2. MATERIALS AND METHODS ........................................................... 4 2.1. Feeding trial and sampling .................................................................................. 4 2.2. RNA extraction ..................................................................................................... 5 2.3. Reverse transcription (RT).................................................................................. 6 2.4. Quantitative Real-time Polymerase Chain Reaction (qPCR) .......................... 6 2.5. Statistical analysis ................................................................................................ 9 CHAPTER 3. RESULTS .............................................................................................. 10 CHAPTER 4. DISCUSSION AND CONCLUSION .................................................. 13 4.1. Discussion ............................................................................................................ 13 4.2. Conclusion ........................................................................................................... 14 BIBLIOGRAPHY ......................................................................................................... 15. IV.

(5) List of tables Table 1. Ingredients and calculated values of starter diet (1 to 14 days of age). ............. 4 Table 2. Genes and their primer sequences (forward and reverse) used for the expression analysis .............................................................................................................. 7 Table 3. Genes with their standard curves’ slopes and efficiencies. ............................... 8 Table 4. Dietary effects on productive parameters of chickens from 0 to 14 days of age. ....................................................................................................................................... 10. V.

(6) List of figures Figure 1. Differential gene expression according to mRNA relative abundance of every marker analyzed involved in the immune system of the ileum: Toll-Like Receptor 2B (TLR2B), Toll-Like Receptor 4 (TLR4), CXC-Family Chemokine (CXCLi2 / IL8), Interleukin 6 (IL6), Transforming Growth Factorb4 (TGFb4), Chicken B-cell Marker/chB6 (Bu-1) and Cluster of Differentiation 3 – gamma glycoprotein (CD3g). Relative gene expression values are relative to the control diet with no additives (Control), which is set to be 1.00. Bars indicate the 95% confidence interval (n=8). ........................ 11 Figure 2. Differential gene expression according to mRNA relative abundance of both markers analyzed involved in the intestinal permeability: Claudin 1 and Claudin 3. Relative gene expression values are relative to the control diet with no additives (Control), which is set to be 1.00. Bars indicate the 95% confidence interval (n=8)................................................................................ 12. VI.

(7) List of Abbreviations ADFI. Average daily feed intake. ADG. Average daily gain. Bu-1. Chicken B-cell Marker. CD3g. Cluster of Differentiation 3 – Gamma glycoprotein. cDNA. Complementary Deoxyribonucleic acid. CO2. Carbon dioxide. Ct. Cycle threshold. CXCLi2. CXC-Family Chemokine 2. DNA. Deoxyribonucleic acid. E. Efficiency. EC. European Commission. FCR. Feed conversion ratio. FEDNA. Fundación Española para el Desarrollo de la Nutrición Animal. GALT. Gut-associated lymphoid tissues. IFNγ. Interferon gamma. Ig. Immunoglobulin. IL2. Interleukin 2. IL6. Interleukin 6. IL8. Interleukin 8. LPS. Lipopolysaccharides. ME. Metabolizable Energy. mRNA. Messenger Ribonucleic acid. n. Number of samples. ng. Nanograms. nm. Nanometres. NTC. Non-template control. OE. Olive extract. P. P-value. PCR. Polymerase Chain Reaction. PRR. Pattern recognition receptor. qPCR. Quantitative Real-Time Polymerase Chain Reaction. RNA. Ribonucleic acid. TGFb4. Transforming growth factor-b4. VII.

(8) Th1. T helper 1 lymphocytes. Th2. T helper 2 lymphocytes. TLR2B. Toll-like receptor 2B. TLR4. Toll-like receptor 4. UB. Ubiquitin. WHO. World Health Organization. µl. Microliters. VIII.

(9) SUMMARY The prohibition of antibiotics as growth promoters in animal nutrition has generated the need to find alternatives to enhance intestinal health and function. In this context, the use of plant extracts in animal feeds has been gaining interest because of their antiinflammatory and anti-oxidant properties. The objective of the present study was to evaluate the effect of supplementing broiler chicken diets with an olive pomace extract from Olea europaea (OE) rich in triterpenic acids on productive parameters and the expression of intestinal health related genes. A total of 224 male broiler chickens (Cobb 500) were used in the study. A completely randomized design with 2 treatments was used, a diet with no additives as a Control and a diet supplemented with 1.000ppm (EO) of an olive pomace extract provided by the company Natac. S.A. Weight controls and feed intake were performed at 7 and 14 days to calculate the average daily gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR). After two weeks of feeding the experimental diets (14 days of age), ileum samples were taken to analyze the gene expression of different markers of the immune system and intestinal permeability by real-time PCR (qPCR): Toll-Like Receptor 2B (TLR2B), Toll-Like Receptor 4 (TLR4), CXC-Family Chemokine (CXCLi2), Interleukin 6 (IL6), Transforming Growth Factor-b4 (TGFb4), Chicken B-cell Marker (Bu-1), Cluster of Differentiation 3 - gamma glycoprotein (CD3g), Claudin 1 and Claudin 3. Chickens fed the OE tended (P = 0.06) to have better FCR during the first week of trial. However, this additive did not affect the following week or any of the other productive parameters. The expression of intestinal health related genes was not significantly affected by dietary means. However, broilers fed the OE tended to increase the expression the anti-inflammatory TGFb4 (P = 0.08) and that of CD3g (marker of T lymphocytes). In conclusion the supplementation of starter broiler diets with 1000 ppm of an OE rich in triterpenic acids does not affect productive performance or intestinal health benefits. The tendency of improving FCR during the first week and the expression of TGFb4 deserves future research.. IX.

(10) CHAPTER 1. INTRODUCTION AND OBJECTIVES 1.1. Introduction The use of antibiotics as growth promoters in animal production improves the rate of growth, the conversion of food and reduces mortality and morbidity (Cromwell, 2002). However, bacterial resistance has begun to be generated in animals due to the broad use of antibiotics at sub-therapeutic levels in animal feed. For this reason, the World Health Organization (WHO) suggested the prohibition and withdrawal of antibiotics worldwide for animal consumption (WHO, 2001). Following this regulation, the European Union published Regulation (EC) Nº 1831/2003 informing about changes in the legislation of additives for animal feed. The prohibition of the use of antibiotics, coccidiostats and histomonostats as additives in animal feed was confirmed in this regulation (EC, 2003). For this reason, there is an increasing interest to find alternatives to the use of antibiotics in animal production. The use of phytobiotics is a promising alternative due to their high content of pharmacologically active compounds, as has been demonstrated in a large number of in vitro and in vivo studies in chicken nutrition (Grashorn, 2010). Phytochemicals are a heterogeneous group of substances including aromatic plants, volatile compounds (essential oils) and plant extracts which exert the desired effects on the intestinal health because of their content in secondary metabolites (i.e. polyphenols, terpenes) (Hashemi and Davoodi, 2010). With respect to its antimicrobial action, studies such as Windisch et al. (2008), assure that these compounds contribute to a final reduction of the pathogenic pressure in the gastrointestinal system. It is confirmed that phytobiotics act by modulating microbial colonies, fermentation products (including undesirable toxic substances), nutrient digestibility and reactions of the gut-associated lymphoid tissue (GALT). On the other hand, similar studies that evaluate the effects of phytobiotic additives in bird diets (Settle et al., 2014) assure that in spite of not having found an effect in weight gain or increase in size of the animals, they observe a significant decrease in oxidative stress in birds fed with a phytobiotic feed additive against the effects generated by antibiotics. Therefore, a large number of results and studies, such as those cited above, conclude that more studies are necessary in this area to determine the optimal inclusion in the diet of plant products to obtain a better growth performance and increase digestibility (Hernandez et al., 2004).. 1.

(11) On the other hand, despite the possible beneficial effects of the phytobiotic extracts analyzed above, it is important to optimize their inclusion level in the feed for to obtain the desired effects while being economically feasible (Leskovec et al., 2017). By-products from olive oil mill processing are rich in bioactive substances including polyphenols, triterpenic acids and, oleuropeosides, with anti-inflammatory and antioxidant properties (Benavente-Garcia et al., 2000; Romero et al., 2018). The cultivation of this species has spread worldwide occupying more than nine million hectares. Olive pomace is the main residue in quantitative terms in the production of olive oil (RomeroGarcía et al., 2014). In addition, according to Romero-García et al., (2014), it is a waste that the owners of the extraction facilities of olive oil usually sell it for a minimum amount of money or for free. This allows a simpler recycling after the extraction. In addition, it helps to solve an environmental problem due to the production of large amounts of solid waste generated, which are rich in bioactive compounds (Aliakbarian et al., 2011), as in the case of this study. Olive pomace is a very rich source of triterpene acids containing up to 120 g/kg of these compounds (Romero et al., 2018), mainly maslinic acid (around 70% of the total). In general, pentacyclic triterpenes are secondary metabolites of plants. They belong to the group of triterpenoids, which are polycyclic structures composed of six isoprene units (composed of thirty carbon atoms). They can be classified according to the structure of their carbon skeleton into three subgroups: lupanes, ursanes and oleananes (Jäger et al., 2009). The elements responsible for the physicochemical properties of these compounds are the functional groups attached to the carbon skeleton. In addition, the pentacyclic triterpenes are in the form of glucoside when they bind to monosaccharides and disaccharides in order to form saponins, esterified with phenolic acids or forming acetyl derivatives when they bind to acetyl groups in position 3. Pentacyclic triterpenes are compounds with a high degree of innovation in the market and great interest due to their biological properties, such as anti-inflammatory activity and reduction of oxidative stress (Sánchez-Quesada et al., 2013). As mentioned above, several triterpene compounds of interest appear in the olive tree (mainly maslinic acid, oleanolic acid and ursolic acid). According to Bar-Shira et al. (2003) the immediate post-hatch period is a critical developmental window for the bird to achieve immune competence. This is because the chickens are exposed immediately to environmental antigens and pathogens. The gut2.

(12) associated lymphatic system (GALT) contains immature T and B lymphocytes at hatching and, after two weeks, they reach their complete functionality. Despite inflammation is normally associated with pathogen outbreaks there might be also a moderate intestinal inflammation in response to the high energy diets used under normal productive circumstances (Niewold, 2014). Therefore, the use of additives with immune modulating properties is interesting to boost animal health specially in young animals.. 1.2. Objectives The present study aims to test the effects of supplementing starter broiler chicken diets with an olive pomace extract on animal performance and intestinal health.. 3.

(13) CHAPTER 2. MATERIALS AND METHODS 2.1. Feeding trial and sampling The feeding trial was carried out at Universidad Politécnica de Madrid experimental facilities (Agricultural Production Department, Madrid). All the experimental procedures were accepted by the Animal Ethics Committee of Universidad Politécnica de Madrid and were in compliance with the Spanish Guidelines for the Care and Use of Animals in Research (Boletín Oficial del Estado, 2013). The treatments were conducted on 224 one-day-old male broiler chicks (Cobb 500) from a commercial hatchery (Incubadora Uvesa, Tudela, Navarra, Spain) weighing 50g, approximately. Animals were randomly distributed in 16 floor pens (1.1 m x 1.1 m) with 14 chickens per pen (8 pen/treatment x 2 treatments). The floor pens were bedded with wood shaving and provided with a hopper feeder and a bell drinker. The facility temperature was kept at 33ºC during the first week of age and gradually decreased (at rate of 2ºC per week) to 27ºC at third week of age. The lighting programme started with 24 light hours during the first week and 18 light hours and 6 darkness hours the rest of the trial. The broiler chicks were fed a starter diet formulated in order to achieve nutritional requirements following FEDNA (2018) nutritional recommendations. Diet ingredients and nutritional composition is provided in Table 1. From a basal control diet (Control) an experimental diet was obtained by including 1000 ppm of an olive pomace extract (OE) containing around 25% of triterpenic acids provided by the company Natac (Madrid, Spain). Both diets were provided ad libitum in mash form from 1 to 14 days of age. Table 1. Ingredients and calculated values of starter diet (1 to 14 days of age). Starter diet Ingredients Wheat Soy bean meal 47 Corn Sunflower Soy bean oil Calcium phosphate Calcium carbonate Nutrave 1 Salt. 54,32 30,95 5,00 3,41 2,50 1,43 1,12 0,40 0,34. 4.

(14) L-Lysine DL-Methionine L-Threonine Calculated values (%) ME, Kcal/kg Crude protein Ashes Ethereal extract Lysine Methionine Methionine + cysteine Threonine Tryptophan Calcium Total phosphorus Available phosphorus Sodium. 0,25 0,23 0,05 3.025 22,48 5,80 3,99 1,36 0,55 0,96 0,85 0,28 1,08 0,76 0,58 0,20. Bird weigh and food intake were measured weekly (at 0, 7 and 14 days of age) to calculate the average daily weight gain (ADG), average daily feed intake (ADFI) and feed conversion ratio (FCR). At 14 days of life, chickens were slaughtered by CO2 inhalation. Ileum mucosa samples of one bird per pen were taken in order to analyse in the laboratory and to extract their RNA.. 2.2. RNA extraction Total RNA was extracted from ileal mucosal scraping with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), disrupted with a MiniBeadBeater-16 cell disrupter (BioSpec Products, Bartlesville, OK, USA) and isolated by using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich Corporation, St. Louis, MO, USA) following the manufacturer’s instructions. An “in column” DNase step was performed by using the RNAse-Free DNase Set (Quiagen, Australia) in order to remove genomic DNA contamination. Extracted RNA yield and quality were measured by spectrophotometry (EpochTM, BioTek, Winoosky, VT, USA) combined with the Take3TM Micro-Volume Plate (BioTek, Santa Barbara, CA, USA) by absorbance at wavelengths of 260 and 280 nm.. 5.

(15) 2.3. Reverse transcription (RT) Reverse transcription of around 2400 ng of extracted RNA was performed with the SuperScript VILO Master Mix (Invitrogen, Carlsbad, CA, USA).. 2.4. Quantitative Real-time Polymerase Chain Reaction (qPCR) Quantitative Real-time Polymerase Chain Reaction (qPCR) was performed to analyse every housekeeping and target gene expression in every sample. 7300 Real Time PCR System (Applied Biosystems, Foster City, CA, USA) was used to measure relative gene expressions according to already tested and published primer conditions, shown in table 2. SYBR® Green Master Mix (Applied Biosystems, Foster City, CA, USA) was used as the fluorescent agent. 20 µL of solution per sample were used to perform the qPCR. 10 µL of the total volume corresponded to SYBR® Green Master Mix and the rest of the reaction solution, up to 18 µL, was filled up with different primer volumes (according to its conditions and concentrations) and RNA/DNA-free water. Finally, 2 µL of DNA sample in the appropriate concentrations were added to each well in the PCR plate. Each sample analysis was performed in duplicate, samples destined to standard curve was performed in triplicate and a non-template control (NTC), which was added as a negative control with RNA/DNA-free water instead of the DNA sample, was also included in triplicate. Amplification parameters, such as cycle threshold (Ct) or slope formed by standard curve, were given by the qPCR software, 7300 System SDS (Applied Biosystems, Foster City, CA, USA) after the process. Gene qPCR efficiencies, shown in table 3, were calculated using the information from the standard curves, created by a pool of cDNA from all samples, and applying the equation E = 10 -1/slope (Pfaffl, 2004).. 6.

(16) Table 2. Genes and their primer sequences (forward and reverse) used for the expression analysis Gene UB. 5’-Primer sequence Forward-3’ GGGATGCAGATCTTCGTGAAA. 5’-Primer sequence Reverse- 3’ CTTGCCAGCAAAGATCAACCTT. References (De Boever et al., 2008). B-actin. GTGATGGACTCTGGTGATGG. TGGTGAAGCTGTAGCCTCTC. (Wang et al., 2009). CXCLi2. TCCTGGTTTCAGCTGCTCTGT. CGCAGCTCATTCCCCATCT. (Chen et al., 2015). TLR2B CGCTTAGGAGAGACAATCTGTGAA GCCTGTTTTAGGGATTTCAGAGAATTT. (Chen et al., 2015). TLR4. AGTCTGAAATTGCTGAGCTCAAAT. GCGACGTTAAGCCATGGAAG. (Chen et al., 2015). Bu-1. GGTGTCCAGTGAAGGTGTG. GATGCAAAGGATGGGTGTC. (Bar-Shira et al., 2003). IL6. GAGGGCCGTTCGCTATTTG. ATTGTGCCCGAACTAAAACATTC. (Kishimoto et al., 1995). TGFb4. CGGCCGACGATGAGTGGCTC. CGGGGCCCATCTCACAGGGA. (Chen et al., 2015). CD3g. CAGGGATTGTGGTCGCAGAT. TACTGTCCATCATTCCGCTCAC. (Bar-Shira et al., 2003). Claudin 1. TGGCCACGTCATGGTATGG. AACGGGTGTGAAAGGGTCATAG. (Chen et al., 2015). Claudin 3. GCCAAGATCACCATCGTCTC. CACCAGCGGGTTGTAGAAAT. (Gilani et al., 2017). 7.

(17) Table 3. Genes with their standard curves’ slopes and efficiencies. Gene UB B-actin CXCLi2 TLR2B TLR4 Bu-1 IL6 TGFb4 CD3g Claudin 1 Claudin 3. Slope -3.84 -3.86 -3.83 -3.92 -3.77 -3.85 -3.75 -3.37 -3.93 -3.58 -3.74. Efficiency 1.82 1.82 1.82 1.80 1.84 1.82 1.85 1.98 1.80 1.90 1.85. Target genes selected in order to study the intestinal immunity of the chicks were: INMMUNE SYSTEM -. CXCLi2 (IL8): it was the first chicken CXC chemokine identified, with functions of chemotactic and angiogenic factor, also called chCAF (Poh et al., 2008). It is an efficient chemokine inductor of the migration of monocytes to sites of infection (Stäheli, 2014).. -. TLR2B: it is a toll-like receptor protein that can recognize the two major microbe patterns, which are lipoproteins and LPS (Fukui et al., 2001).. -. TLR4: toll-like receptor that belongs to a group of evolutionarily conserved pattern recognition receptors (PRRs) and it works as a defensin receptor of monocytes (Yang et al., 2010). This receptor specifically recognizes bacterial LPS and its activation leads to the synthesis of pro-inflammatory cytokines and chemokines (Vaure and Liu, 2014).. -. Bu-1: also called B-cell marker chB6, is expressed on chicken B-cells. It is used as an allotypic marker to study B-cell development (Tregaskes et al., 1996).. -. IL6: this interleukin is a multifunctional cytokine that plays a major role in regulating immune responses, acute phase reactions and haematopoiesis. It is produced by different cells and acts on B cells, T cells, hepatocytes, haematopoietic progenitor cells and cells of the central nervous system (Schneider et al., 2001). IL6 can modulate the Th1/Th2 response by inhibiting Th1 differentiation (Diehl et al., 2000).. 8.

(18) -. TGF-b4: this isoform of TGF-b has been described only in chicken. It has been shown to play an essential role in establishing immunological tolerance and antiinflammatory roles (Bock et al., 1991). -. CD3γ: it is an antigen expressed on avian T lymphocytes and is involved in signal transduction pathways leading to T cell activation (Bar-Shira et al., 2003).. INTESTINAL PERMEABILITY -. Claudin 1: integral membrane protein involved in the formation of tight junctions (Kim et al., 2019).. -. Claudin 3: it is part of the family of proteins which have barrier and fence functions within tight-junctions between cells (Kim et al., 2019). They also have additional roles in the differentiation and physiological function of chick intestine (Ozden et al., 2010).. 2.5. Statistical analysis Differences between means induced by OE relative to the Control diet were detected through a t-test analysis using the PROC TTEST from SAS (release 9.2, SAS Institute Inc., Cary, NC, USA) (Yuan et al., 2006). For genes displaying efficiencies different from 2 (E ≠ 2), Ct values were adjusted according to the model described by Steibel et al. (2009).. 9.

(19) CHAPTER 3. RESULTS The productive parameters of the chickens are shown in Table 4. In the first week of life (0 - 7 days), the animals fed with OE showed a tendency to increase the feed conversion ratio (FCR) with respect to the Control (P = 0.06). However, no significant differences were observed in average daily gain (ADG) and average daily feed intake (ADFI). Differences between treatments in the productive performances during the second week of age of the chicks were not obtained (7 - 14 days). Table 4. Dietary effects on productive parameters of chickens from 0 to 14 days of age. Control. OE. 0-7d ADGa,b,g 14.5±0.37 14.7±0.49 c ADFI ,g 19.4±0.30 18.5±0.49 d FCR , g/g 1.34±0.03 1.25±0.01 7-14d ADG,g 32.2±0.46 32.3±0.85 ADFI,g 41.5±0.61 41.4±0.86 FCR, g/g 1.29±0.01 1.28±0.01 a Values are means ± standard error b ADG, average daily gain. c ADFI, average daily feed intake. d FCR, feed conversion ratio.. P value 0.71 0.13 0.06 0.93 0.93 0.80. The results of the gene analysis are shown in figures grouped according to whether they refer to markers of the immune system or intestinal permeability. Each gene in the figures contains two columns. The first one refers to the control diet (Control), which takes the value 1.00, while the second one shows the effect of the supplementation of the olive extract (OE) in relation to the Control. In this way, the effect that OE produces is analyzed according to the response in the broiler chicken ileum.. 10.

(20) Figure 1. Differential gene expression according to mRNA relative abundance of every marker analyzed involved in the immune system of the ileum: Toll-Like Receptor 2B (TLR2B), Toll-Like Receptor 4 (TLR4), CXC-Family Chemokine (CXCLi2 / IL8), Interleukin 6 (IL6), Transforming Growth Factor-b4 (TGFb4), Chicken B-cell Marker/chB6 (Bu-1) and Cluster of Differentiation 3 – gamma glycoprotein (CD3g). Relative gene expression values are relative to the control diet with no additives (Control), which is set to be 1.00. Bars indicate the 95% confidence interval (n=8).. 11.

(21) The relative expression of the genes of the immune system in the ileum is shown in Figure 1. No significant difference was observed in the analysis of the TLR2B, TLR4, CXCLi2, IL6 and Bu-1 genes. However, OE tends to upregulate the relative expression values of mRNA in the markers TGFb4 (P = 0.12) and CD3g (P = 0.08) compared to the Control diet. On the other hand, moving on to analyze the expression of genes related to intestinal permeability (Figure 2), significant variations were not observed in none of the two study genes due to their high P value in both cases (PClaudin1 = 0.49 and PClaudin3 = 0.64).. Figure 2. Differential gene expression according to mRNA relative abundance of both markers analyzed involved in the intestinal permeability: Claudin 1 and Claudin 3. Relative gene expression values are relative to the control diet with no additives (Control), which is set to be 1.00. Bars indicate the 95% confidence interval (n=8).. 12.

(22) CHAPTER 4. DISCUSSION AND CONCLUSION 4.1. Discussion The objective of this study was to evaluate the effect of the incorporation of an olive pomace extract in the diet of broiler chickens up to 14 days of age on the productive parameters of chickens and the expression of genes related to intestinal health. Broilers fed the OE diet tended to have better FCR during the first week of life. However, this tendency disappeared during the second week of the trial. Abo Omar (2005) showed positive effects on growth performance in broilers fed diets supplemented with olive extracts. Also, Herrero-Encinas et al. (2017) found improvements in performance in broilers fed an olive extract from 21 to 42 days of age. On the other hand, studies such as those carried out by Leskovec et al. (2018) with olive leaf extracts, or that of (King et al., 2014) with an olive pomace extract supplied in water reported no significant effects in agreement with our study. Thus, the potential beneficial effects of the bioactive compounds of extracts from Olea europaea on productive parameters might depend on the composition and concentration of the bioactive substances, bird age, mode of supplementation (water vs. feed) and environmental conditions. Plant extracts may exert their beneficial effects on growth performance among others because of their antioxidant and/or immunomodulatory effects (Chen et al., 2003). Previous studies conducted with olive extracts rich in triterpenes showed better animal performance related to its anti-inflammatory function rather than the antioxidant one (Gisbert et al., 2017; Liehr et al., 2017). In the present study no significant regulation of intestinal immune and barrier function genes were observed by dietary means. This is in agreement with the lack of differences observed in animal performance. However, the expression of CD3g and TGFb4 tended to be upregulated with the inclusion of 1000 ppm of an olive extract with 25% triterpenes. CD3g is an antigen shown in T lymphocytes of the adaptive immune response (Bar-Shira et al., 2003). Plant extracts have been shown to immunostimulate cellular (T lymphocytes) immunity in animals fed with certain enriched diets (Guo et al., 2004). TGFb has been shown to have an essential role in the control of T-cell homeostasis to permit normal immune responses (Gorelik and Flavell, 2002). In addition, TGFb plays. 13.

(23) a central role in the change of isotype from IgM to IgA, which makes it a factor that induces tolerance (Fujihashi et al., 2001). In chickens TGF-β4 also has anti-inflammatory properties (Kaiser & Stäeli, 2014). An upregulation of this cytokine has been previously reported in broiler chickens fed an olive extract similar to the one used in the present study (Herrero-Encinas et al., 2018). This is in line with the known anti-inflammatory properties of triterpenes (Gisbert et al., 2017; Liehr et al., 2017). Regarding the section of tight junction forming molecules (Claudin 1 and Claudin 3) in the intestine of animals, no significant results can be observed in this study either. This agrees with Patra et al. (2018), where the effect of essential oils on the expression of Claudin 1 was analyzed without observing either significance in chickens.. 4.2. Conclusion In conclusion the supplementation of starter broiler diets with 1000 ppm of an OE rich in triterpenic acids does not affect productive performance or intestinal health benefits. The tendency of improving FCR during the first week and the expression of TGFb4 deserves future research.. 14.

(24) BIBLIOGRAPHY Abo Omar, J. M. (2005). CARCASS COMPOSITION AND VISCERAL ORGAN MASS OF BROILER CHICKS FED DIFFERENT LEVELS OF OLIVE PULP (Vol. 13). Retrieved from http://journal.iugaza.edu.ps/index.php/IUGNS/article/viewFile/188/174 Aliakbarian, B., Casazza, A. A., & Perego, P. (2011). Valorization of olive oil solid waste using high pressure–high temperature reactor. Food Chemistry, 128(3), 704–710. https://doi.org/10.1016/J.FOODCHEM.2011.03.092 Applegate, T. J., Klose, V., Steiner, T., Ganner, A., & Schatzmayr, G. (2010). Probiotics and phytogenics for poultry: Myth or reality? 1. J. Appl. Poult. Res, 19, 194–210. https://doi.org/10.3382/japr.2010-00168 Bar-Shira, E., Sklan, D., & Friedman, A. (2003). Establishment of immune competence in the avian GALT during the immediate post-hatch period. Developmental & Comparative. Immunology,. 27(2),. 147–157.. https://doi.org/10.1016/S0145-. 305X(02)00076-9 Bock, G., Marsh, J., & Ciba Foundation. (1991). Clinical applications of TGF-[beta]. Wiley. Boletín Oficial del Estado. (2013). Real Decreto por el que se establecen las normas básicas aplicables para la protección de los animales utilizados en experimentación y otros fines científicos, incluyendo docencia. Boletín Oficial del Estado. 34, 11370-11421. Chen, H., Li, D., Chang, B., Gong, L., Dai, J., & Yi, G. (2003). Effects of Chinese herbal polysaccharides on the immunity and growth performance of young broilers. Poultry Science, 82(3), 364–370. https://doi.org/10.1093/ps/82.3.364 Chen, J., Tellez, G., Richards, J. D., & Escobar, J. (2015). Identification of Potential Biomarkers for Gut Barrier Failure in Broiler Chickens. Frontiers in Veterinary Science, 2, 14. https://doi.org/10.3389/fvets.2015.00014 Cromwell, G. L. (2002). WHY AND HOW ANTIBIOTICS ARE USED IN SWINE. 15.

(25) PRODUCTION.. Animal. Biotechnology,. 13(1),. 7–27.. https://doi.org/10.1081/ABIO-120005767 De Boever, S., Vangestel, C., De Backer, P., Croubels, S., & Sys, S. U. (2008). Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Veterinary Immunology. and. Immunopathology,. 122(3–4),. 312–317.. https://doi.org/10.1016/J.VETIMM.2007.12.002 Diehl, S., Anguita, J., Hoffmeyer, A., Zapton, T., Ihle, J. N., Fikrig, E., & Rincón, M. (2000). Inhibition of Th1 Differentiation by IL-6 Is Mediated by SOCS1. Immunity, 13(6), 805–815. https://doi.org/10.1016/S1074-7613(00)00078-9 EC. (2003). Commission of the European Communities, Commission Regulation (EC) No.1831/2003. Official Journal of European Union, 268: 29–43. FEDNA (Fundación Española Desarrollo Nutrición Animal). (2018). Necesidades nutricionales para avicultura. Normas FEDNA. 2rd Ed. In: G. Santomá, G. G. Mateos (Eds). Fundación Española para el Desarrollo Nutrición Animal, Madrid, Spain. Fujihashi, K., Kato, H., Van Ginkel, F. W., Koga, T., Boyaka, P. N., Jackson, R. J., Kato, R., Hagiwara, Y., Etani, Y., Goma, I., Fujihashi, K., Kiyono, H., & McGhee, J. R. (2001). A revisit of mucosal IgA immunity and oral tolerance. Acta Odontologica Scandinavica, 59(5), 301–308. https://doi.org/10.1080/000163501750541174 Fukui, A., Inoue, N., Matsumoto, M., Nomura, M., Yamada, K., Matsuda, Y., & Seya, T. (2001). Molecular cloning and functional characterization of chicken toll-like receptors. A single chicken toll covers multiple molecular patterns. The Journal of Biological. Chemistry,. 276(50),. 47143–47149.. https://doi.org/10.1074/jbc.M103902200 Gilani, S., Howarth, G. S., Kitessa, S. M., Tran, C. D., Forder, R. E. A., & Hughes, R. J. (2017). New biomarkers for increased intestinal permeability induced by dextran sodium sulphate and fasting in chickens. Journal of Animal Physiology and Animal Nutrition, 101(5), e237–e245. https://doi.org/10.1111/jpn.12596 Gisbert, E., Andree, K.B., Quintela, J.C., Calduch-Giner, J.A., Ipharraguerre, I.R., Pérez-. 16.

(26) Sánchez, J. (2017). Olive oil bioactive compounds increase body weight, and improve gut health and integrity in gilthead sea bream (Sparus aurata). British Journal of Nutrition, 117, 351-363. https://doi.org/10.1017/S0007114517000228. Gorelik, L., & Flavell, R. A. (2002). Transforming growth factor-β in T-cell biology. Nature Reviews Immunology, 2(1), 46–53. https://doi.org/10.1038/nri704 Grashorn, M. A. (2010). Use of phytobiotics in broiler nutrition-an alternative to infeed antibiotics? Journal of Animal and Feed Sciences (Vol. 19). Retrieved from https://www.researchgate.net/profile/Michael_Grashorn/publication/228490537_U se_of_phytobiotics_in_broiler_nutrition__An_alternative_to_infeed_antibiotics/links/0c960529ee180bfd45000000/Use-ofphytobiotics-in-broiler-nutrition-An-alternative-to-infeed-an Guo, F. C., Kwakkel, R. P., Williams, B. A., Parmentier, H. K., Li, W. K., Yang, Z. Q., & Verstegen, M. W. (2004). Effects of Mushroom and Herb Polysaccharides on Cellular and Humoral Immune Responses of Eimeria tenella-Infected Chickens. Poultry Science, 83(7), 1124–1132. https://doi.org/10.1093/ps/83.7.1124 Hashemi, S.R., Davoodi, H. (2010). Phytogenics as new class of feed additive in poultry insdustry. Journal of Animal and Veterinary Advances, 9, 2295-2304. http://dx.doi.org/10.3923/javaa.2010.2295.2304. Hernandez, F., Madrid, J., Garcia, V., Orengo, J., & Megias, M. D. (2004). Influence of two plant extracts on broilers performance, digestibility, and digestive organ size. Poultry Science, 83(2), 169–174. https://doi.org/10.1093/ps/83.2.169 Herrero-Encinas, J., Blanch, M., Pastor, J., Ipharraguerre, I., Menoyo, D. (2017). Effects of feeding a bioactive extract from Olea europaea to broiler chickens on growth performance. Proc. 21st. European Symposium on Poultry Nutritrion, 192. (Abst.). Herrero-Encinas, J., Blanch, M., Pastor, J., Ipharraguerre, I., Menoyo, D. (2018). Feeding a bioactive extract from Olea europaea to broiler chickens exerts a positive immunoregulatory effect without mayor effects on gut microbiota. Poultry Science, 97, (E-Suppl. 1) (Abst.). Jäger, S., Trojan, H., Kopp, T., Laszczyk, M., & Scheffler, A. (2009). Pentacyclic Triterpene Distribution in Various Plants – Rich Sources for a New Group of Multi-. 17.

(27) Potent. Plant. Extracts.. Molecules,. 14(6),. 2016–2031.. https://doi.org/10.3390/molecules14062016 Kaiser, P. and P. Stäeli. (2014). Avian Cytokines and Chemokines. In: Avian Immunology, second edition. K.A. Schat, B. Kaspars, P. Kaiser (Eds) pp. 189-204. Kim, N. Y., Pyo, J.S., Kang, D.W., & Yoo, S.M. (2019). Loss of claudin-1 expression induces epithelial-mesenchymal transition through nuclear factor-κB activation in colorectal cancer. Pathology - Research and Practice, 215(3), 580–585. https://doi.org/10.1016/j.prp.2019.01.015 King, A. J., Griffin, J. K., & Roslan, F. (2014). In Vivo and in Vitro Addition of Dried Olive Extract in Poultry. Journal of Agricultural and Food Chemistry, 62(31), 7915– 7919. https://doi.org/10.1021/jf4050588 Kishimoto, T., Akira, S., Narazaki, M., & Taga, T. (1995). Interleukin-6 Family of Cytokines and gp130. REVIEW ARTICLE Blood (Vol. 86). Retrieved from www.bloodjournal.org Lee, S. H., Lillehoj, H. S., Hong, Y. H., Jang, S. I., Lillehoj, E. P., Ionescu, C., Ionescu, C., & Bravo, D. (2010). In vitro effects of plant and mushroom extracts on immunological function of chicken lymphocytes and macrophages. British Poultry Science, 51(2), 213–221. https://doi.org/10.1080/00071661003745844 Leskovec, J., Levart, A., Žgur, S., Jordan, D., Pirman, T., Salobir, J., Rezar, V. (2018). Effects of olive leaf and marigold extracts on the utilization of nutrients and on bone mineralization using two different oil sources in broilers. The Journal of Poultry Science, 55, 17-27. https://doi.org/10.2141/jpsa.0170059. Liehr, M., Mereu, A., Pastor, J.J., Quintela, J.C., Staats, S., Rimbach, G., Ipharraguerre, I.R. (2017). Olive oil bioactives protect pigs against experimentally-induced chronic inflammation independently of alterations in gut microbiota. PloS ONE, 12, e0174239. https://doi.org/10.1371/journal.pone.0174239. Niewold, T.A. (2014). Why anti-inflammatory compounds are the solution for the problem with in feed antibiotics. Quality Assurance and Safety of Crops & Foods, 6, 112-122. https://doi.org/10.3920/QAS2012.0234. Ozden, O., Black, B. L., Ashwell, C. M., Tipsmark, C. K., Borski, R. J., & Grubb, B. J.. 18.

(28) (2010). Developmental Profile of Claudin-3, -5, and -16 Proteins in the Epithelium of Chick Intestine. The Anatomical Record: Advances in Integrative Anatomy and Evolutionary Biology, 293(7), 1175–1183. https://doi.org/10.1002/ar.21163 Patra, A. K., Amasheh, S., & Aschenbach, J. R. (2018). Modulation of gastrointestinal barrier and nutrient transport function in farm animals by natural plant bioactive compounds – A comprehensive review. Critical Reviews in Food Science and Nutrition, 1–30. https://doi.org/10.1080/10408398.2018.1486284 Pfaffl, M. W. (2004). Quantification strategies in real-time PCR. Retrieved from http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.313.4948&rep=rep1&ty pe=pdf Poh, T. Y., Pease, J., Young, J. R., Bumstead, N., & Kaiser, P. (2008). Re-evaluation of chicken CXCR1 determines the true gene structure: CXCLi1 (K60) and CXCLi2 (CAF/interleukin-8) are ligands for this receptor. The Journal of Biological Chemistry, 283(24), 16408–16415. https://doi.org/10.1074/jbc.M800998200 Romero-García, J. M., Niño, L., Martínez-Patiño, C., Álvarez, C., Castro, E., & Negro, M. J. (2014). Biorefinery based on olive biomass. State of the art and future trends. Bioresource. Technology,. 159,. 421–432.. https://doi.org/10.1016/J.BIORTECH.2014.03.062 Romero, C., Medina, E., Mateo, M. A., & Brenes, M. (2018). New by-products rich in bioactive substances from the olive oil mill processing. Journal of the Science of Food and Agriculture, 98(1), 225–230. https://doi.org/10.1002/jsfa.8460 Sanchez-Quesada, C., Lopez-Biedma, A., Warleta, F., Campos, M., Beltran, G., Gaforio, J.J. (2013). Bioactive Properties of the Main Triterpenes found in Olives, Virgin Olive Oil, and Leaves of Olea europaea. Journal Agricultural and Food Chemistry, 61, 12173–12182. SAS Institute. (1990). SAS/STAT® User’s Guide. Version 6, 4th ed. SAS Inst. Inc., Cary, NC. Schneider, K., Klaas, R., Kaspers, B., & Staeheli, P. (2001). Chicken interleukin-6. European. Journal. of. Biochemistry,. https://doi.org/10.1046/j.1432-1327.2001.02334.x. 19. 268(15),. 4200–4206..

(29) Settle, T., Leonard, S. S., Falkenstein, E., Fix, N., Van Dyke, K., & Klandorf, H. (2014). Effects of a Phytogenic Feed Additive Versus an Antibiotic Feed Additive on Oxidative Stress in Broiler Chicks and a Possible Mechanism Determined by Electron Spin Resonance. International Journal of Poultry Science, 13(2), 62–69. https://doi.org/10.3923/ijps.2014.62.69 Stäheli, P. (2014). Avian Cytokines and Chemokines. Avian Immunology, 189–204. https://doi.org/10.1016/B978-0-12-396965-1.00010-8 Steibel, J. P., Poletto, R., Coussens, P. M., & Rosa, G. J. M. (2009). A powerful and flexible linear mixed model framework for the analysis of relative quantification RT-PCR. data.. Genomics,. 94(2),. 146–152.. https://doi.org/10.1016/J.YGENO.2009.04.008 Tregaskes, C. A., Bumstead, N., Davison, T. F., & Young, J. R. (1996). Chicken B-cell marker chB6 (Bu-1) is a highly glycosylated protein of unique structure. Immunogenetics, 44(3), 212–217. https://doi.org/10.1007/BF02602587 Vaure, C., & Liu, Y. (2014). A Comparative Review of Toll-Like Receptor 4 Expression and Functionality in Different Animal Species. Frontiers in Immunology, 5, 316. https://doi.org/10.3389/fimmu.2014.00316 Wang, P. H., Ko, Y. H., Chin, H. J., Hsu, C., Ding, S. T., & Chen, C. Y. (2009). The effect of feed restriction on expression of hepatic lipogenic genes in broiler chickens and the function of SREBP1. Comparative Biochemistry and Physiology Part B: Biochemistry. and. Molecular. Biology,. 153(4),. 327–331.. https://doi.org/10.1016/J.CBPB.2009.04.003 WHO Global Strategy for Containment of Antimicrobial Resistance. (2001). Retrieved from https://www.who.int/drugresistance/WHO_Global_Strategy_English.pdf Windisch, W., Schedle, K., Plitzner, C., & Kroismayr, A. (2008). Use of phytogenic products as feed additives for swine and poultry1. Journal of Animal Science, 86(suppl_14), E140–E148. https://doi.org/10.2527/jas.2007-0459 Yang, Y., Jiang, Y., Yin, Q., Liang, H., & She, R. (2010). Chicken intestine defensins activated murine peripheral blood mononuclear cells through the TLR4-NF-κB pathway. Veterinary Immunology and Immunopathology, 133(1), 59–65.. 20.

(30) https://doi.org/10.1016/J.VETIMM.2009.07.008 Yuan, J., Reed, A., Chen, F., & Stewart, C. N. (2006). Statistical analysis of real-time PCR data. BMC Bioinformatics, 7(1), 85. https://doi.org/10.1186/1471-2105-7-85. 21.

(31)

Referencias

Documento similar

MBC patients with BM have disease-specific complica- tions with particular impacts on HRQoL. Thus, the main objective of the present study was to evaluate the aplic- ability

The results presented on chapter 2 showed that at 15 ºC the radial root specific hydraulic resistance of the GF677 rootstock and olive (Olea europaea) tree starts to

Carotenes total contents presented a similar pattern that chlorophylls decreasing during ripening process but significant differences only appeared on green stage

To evaluate the effect of compounds on the expression of parameters related to HRI (ROS, hormone levels, and gene expression), a factorial ANOVA was conducted for each olive

We studied the concentrations of Olea and all of the pollen types during the Olea Main Pollen Season in the three cities of the Region of Murcia Aerobiological Network, in

The objective of the present study was to evaluate the effect of two exogenous GA enzymes, alone or in combination, with a neutral metalloprotease on apparent total tract

The Dwellers in the Garden of Allah 109... The Dwellers in the Garden of Allah

fastidiosa se encuentra establecida en el municipio de Parras, Coahuila y está asociada con las especies frutales Carya sp., Cydonia sp., Ficus carica, Olea europaea y