An Extensive Survey of Ck2 Alpha and Beta Subunits in Arabidopsis: Multiple Isoforms Exhibit Differential Subcellular Localization

Texto completo

(1)Plant Cell Physiol. 47(9): 1295–1308 (2006) doi:10.1093/pcp/pcj100, available online at www.pcp.oxfordjournals.org ß The Author 2006. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oxfordjournals.org. An Extensive Survey of CK2 a and b Subunits in Arabidopsis: Multiple Isoforms Exhibit Differential Subcellular Localization Paula Salinas 1, Daniela Fuentes Loreto Holuigue 1, *. 1, 3. , Elena Vidal. 1, 3. , Xavier Jordana 1, Manuel Echeverria. 2. and. 1. Departamento de Gene´tica Molecular y Microbiologı´a, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, PO Box 114-D, Santiago, Chile 2 UMR CNRS 5096, Ge´nome et De´veloppement des Plantes, Universite´ de Perpignan, France. Casein kinase 2 (CK2) is a ubiquitous enzyme essential for the viability of eukaryotic cells. In the present work we analyzed the Arabidopsis thaliana genome in a search for the genes coding for all CK2 a and b subunits. We found four a subunit and four b subunit genes. Expression analysis showed that all CK2 subunit genes are expressed in inflorescences, stems, leaves and roots. The level of expression of these genes is very similar, except for the one that codes for an a subunit harboring a putative chloroplastic destination peptide (acp), which shows a slightly higher expression level in all tissues. Using transgenic plants and agroinfiltration, we have also characterized the subcellular localization of all proteins encoded by CK2 genes. Our results show that all a subunits are localized in the nucleus, with the exception of acp, which is only found in the chloroplasts. On the other hand, b subunits have a more diverse distribution, with some of them localizing both to the nucleus and to the cytosol, while others are exclusively located in one of these compartments. Remarkably, no CK2b subunit was found in the chloroplasts. Finally, by directly measuring its activity, we have demonstrated that purified Arabidopsis chloroplasts have active CK2 that can be regulated by external addition of CK2b. This study represents a complete survey of the CK2 gene family in Arabidopsis and the first step for future studies on CK2 cellular function in this species. Keywords: Arabidopsis — CK2 — Gene expression — Subcellular localization. Abbreviations: CaMV, cauliflower mosaic virus; CK2, casein kinase 2; GFP, green fluorescent protein; ORF, open reading frame; RT–PCR, reverse transcription–PCR; YFP, yellow fluorescent protein.. Introduction Casein kinase 2 (CK2) is a ubiquitous serine–threonine protein kinase highly conserved in all eukaryotes (Allende and Allende 1995, Pinna 2002, Litchfield 2003, Meggio and. Pinna 2003). It is essential for cell viability, being involved in processes such as cell proliferation, differentiation, survival and apoptosis (Padmanabha et al. 1990, Guo et al. 2001, Ahmed et al. 2002, Litchfield 2003). Interestingly, the majority of the CK2 substrates identified to date (4300 in total) are nuclear proteins involved in DNA/RNA-associated functions, or cellular proteins involved in signal transduction (Meggio and Pinna 2003). This suggests that CK2 acts mainly through these mechanisms in essential cellular processes. Surprisingly, the question of how CK2, an apparently constitutive active enzyme, can regulate these processes in vivo is still open. CK2 is structured as a tetrameric complex formed by two catalytic subunits (a) and two regulatory subunits (b) (Niefind et al. 2001, Litchfield 2003). CK2 subunits localize mainly to the nucleus and cytosol, but they have also been found in other organelles such as mitochondria, endoplasmic reticulum and the external and internal surface of the plasma membrane (Faust and Montenarh 2000, Rodriguez et al. 2005). Increasing evidence indicates that localization and interaction of CK2 subunits with other proteins is a dynamic process (Faust and Montenarh 2000, Filhol et al. 2004, Olsten and Litchfield 2004). In fact, free populations of both subunits have been detected in different cellular compartments, alone or associated with other proteins (Boldyreff and Issinger 1997, Filhol et al. 2004, Bibby and Litchfield 2005). This evidence suggests that the in vivo functions and substrate specificity of CK2 could be regulated by controlling the cellular localization of its a and b subunits. In plants, CK2 has been studied in several species including maize (Riera et al. 2001a), tobacco (Salinas et al. 2001), Arabidopsis (Sugano et al. 1999), wheat (Kato et al. 2002) and mustard (Ogrzewalla et al. 2002). Even though the CK2 substrates identified in plants are not yet as numerous as they are in animals, it has been demonstrated that CK2 is involved in the regulation of several vital physiological processes such as light signaling, circadian rhythm, transcription, translation, the cell cycle, nuclear transport, Ca2þ storage, seed storage and salicylic. 3. These authors contributed equally to this work. *Corresponding author: E-mail, lholuigue@bio.puc.cl; Fax, þ56-2-222 5515. 1295. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017.

(2) 1296. CK2 subunits isoforms in Arabidopsis. acid-mediated defense (Espunya et al. 1999, Lee et al. 1999, Sugano et al. 1999, Hidalgo et al. 2001, Riera et al. 2001a, Meggio and Pinna 2003, Kang and Klessig 2005). In plant cells, CK2 has been found located in the cytosol and the nucleus (Riera et al. 2004); interestingly, in mustard, it was also found in the chloroplast, an organelle that evolved from prokaryotes, organisms that do not code for CK2 genes (Ogrzewalla et al. 2002). The human genome has three genes coding for catalytic a subunits (one of them is a pseudogene), and only one for a regulatory b subunit (Wirkner et al. 1992, Wirkner et al. 1998, Ackermann et al. 2005). In contrast, plants seem to have multiple genes for each subunit (Sugano et al. 1998, Lee et al. 1999, Riera et al. 2001b, Espunya et al. 2005), suggesting a high level of heterogeneity. Even though genes coding for CK2 subunits have been identified in several plant species, there is still no comprehensive and systematic study characterizing all genes coding for CK2 subunits present in a single plant genome. In this work, we have carefully analyzed the complete Arabidopsis genome in order to identify all genes coding for CK2 subunits. We identified four genes coding for a subunits and four genes coding for b subunits. All genes are expressed throughout the plant, but levels of expression vary depending on the gene. Subcellular localization analyses show clear differences among CK2 subunits encoded by these eight genes, indicating that all subunits are targeted to the cytosol and/or the nucleus, with the very interesting exception of acp, which is targeted to the chloroplast. Further supporting our evidence for a chloroplastic localization of CK2, we detected specific CK2 activity in chloroplasts isolated from Arabidopsis leaves. This is the first systematic characterization of all genes coding for CK2 subunits in a single plant genome, and represents the basis for future studies on the in vivo regulation of CK2 activity in plant species.. Results Genes coding for a and b CK2 subunits in Arabidopsis In Arabidopsis, two genes for CK2a subunits (aA, At5g67380; and aB, At3g50000) and three for CK2b subunits (b1, At5g47080; b2, At4g17640; and b3, At3g60250) have been characterized previously (Mizoguchi et al. 1993, Collinge and Walker 1994, Sugano et al. 1998). In order to establish the total number of CK2 subunit genes present in the Arabidopsis genome, we used aB and b2 nucleotide sequences in a BLAST search of the TAIR database (http://www.arabidopsis.org). We found two other putative a subunit genes and another b subunit gene, which we named aC (At2g23080), acp (At2g23070) and b4 (At2g44680), respectively. As will be described later, the protein coded by the acp gene has a predicted. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. 1. 2. 3. 4. αcp αC. β4. 5. β2. αB. β1. β3 αA. Fig. 1 Schematic representation of the chromosomal location for CK2 subunit genes. CK2 subunit genes were located in the genome by using Chromosomal map tool software from the TAIR web page (http://www.arabidopsis.org). Pale grey boxes indicate relevant chromosomal duplicated regions obtained from MIPS and TAIR databases and added to the scheme maintaining the corresponding scale within each chromosome. Lines represent duplicated DNA regions between chromosomes. Lines with crosses represent inverted duplications.. N-terminal chloroplastic destination sequence. Therefore, the Arabidopsis genome codes for four CK2a and four CK2b subunits. A schematic view of the chromosomal location of all CK2 genes is shown in Fig. 1. Relevant duplicated regions within the Arabidopsis genome are also highlighted (Fig. 1). CK2 genes are located in duplicated regions, except for acp and aC. The amino acidic sequences for all Arabidopsis CK2a subunits were deduced from cDNAs (or annotated genes sequences, see Materials and Methods) and they were compared with two sequences of a subunits already crystallized from human and maize (Guerra et al. 1998, Niefind et al. 2001). A high level of identity was found among all proteins, including those classified as putative CK2a: acp and aC (identities among all sequences are between 82 and 90%) (Fig. 2A). As expected, the domains previously described as relevant for catalytic activity, subcellular localization and substrate binding are highly conserved in all the proteins analyzed, supporting their function as CK2a subunits (see underlined domains in Fig. 2A). We used CLUSTALW and treeview software programs to construct a cladogram that included all Arabidopsis CK2a subunits, all predicted rice subunits (http://rapdb. lab.nig.ac.jp/), some of the CK2a subunits already described or predicted in other plant species (Peracchia et al. 1999, Salinas et al. 2001, Ivanov et al. 2003) and some.

(3) CK2 subunits isoforms in Arabidopsis. 1297. S. cereviciate A' S. cereviciate A O. sative cp O. sative A. thaliana cp A. thaliana C Z. mays 2 O. sativa 2 Z. mays 1 Z. mays 3 N. tabacum A2 N. tabacum A1 N. tabacum A3 A. thaliana A A. thaliana B C. elegans A D. melanogaster A H. sapiens A M. musculus A X. laevis A X. laevis A' H. sapien A' M. musculus A'. A. B. Fig. 2 Protein sequence analyses of CK2a subunits from Arabidopsis. (A) CK2a subunits encoded in the Arabidopsis genome (A.t. aA, At5g67380; A.t. aB, At3g50000; A.t. aC, At2g23080; and A.t. acp, At2g23070) were aligned with two CK2a subunits already crystallized from other species: CK2 A1 from Homo sapiens (H.s aA, AAH50036, CSNK2A1 protein) and CK2a2 from Zea mays (Z.m a2. CAA72290 ZMCK2 protein). Invariant residues are indicated by *, similar residues by: and semi-conservative changes by (according to Blosum62-12-2). Functional domains conserved in these proteins are underlined: ATP-binding site, the basic stretch (NLS), the catalytic loop and the activation segment. (B) Cladogram showing the evolutionary divergence of CK2a subunits from different species. The cladogram was generated using the deduced full-length protein sequence of the genes indicated (the predicted destination peptide for A.t. acp was excluded for this analysis). The PAM250 evolutionary matrix was used for the alignment and sorting of the sequences.. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017.

(4) 1298. CK2 subunits isoforms in Arabidopsis. of the classical CK2a subunits from other species (Fig. 2B). In rice databases, five complete CK2 gene subunit sequences are available: three for a and two for b subunits. Also, by sequence alignment we found one putative pseudogene or partially sequenced gene coding for another a subunit. The cladogram shows that all CK2a subunits from plants are clustered in the same branch, without including any subunit present in other kingdoms. aA and aB are the most closely related sequences. These two subunits are located in duplicated regions within the genome (Fig. 1), strongly suggesting that they were generated by a recent duplication event (Fig. 2B). acp is the least conserved among the a subunits (82%), although its identity is still very high. This gene has an N-terminal extension that is predicted to be a putative chloroplastic destination peptide by three different software programs [ChloroP, PSORT and TargetP (http://www.cbs.dtu.dk/ services/ChloroP/; http://wolfpsort.seq.cbrc.jp/; http:// www.cbs.dtu.dk/services/TargetP/)]. This particular subcellular localization for CK2a in plants has been postulated before in Oryza sativa by sequence alignment (Loschelder et al. 2004), and in mustard, where the protein was shown to be imported into the chloroplast in vitro (Ogrzewalla et al. 2002). However, there are no reports on chloroplastic CK2 in Arabidopsis. Arabidopsis CK2b subunits, like CK2a subunits, also show a high degree of identity among them, but in this case they are less conserved when compared with CK2b from other organisms (Fig. 3A). Strikingly, Saccharomyces cerevisiae codes for a b subunit (b1) that is different from the b subunits from all other organisms analyzed. As far as we know, the reason for this divergence has not been determined. b subunits from Arabidopsis have the same structural features as all previously characterized plant b subunits: a zinc finger domain, a putative destruction box and a short C-terminal region (the human protein is 20 residues longer). In addition, plant b subunits have an N-terminal extension of unknown function that is absent in b subunits from other organisms. The similarity of b1 to b2 and of b3 to b4 (Fig. 3B), and their chromosomal locations in duplicated regions within the Arabidopsis genome (Fig. 1), suggest that these pairs of genes could have arisen from a duplication, as we suggested for aA and aB. Even when b4 has only been postulated as a putative CK2 subunit, the similarity of b4 to the rest of the b subunits strongly supports its function as a CK2 subunit. Expression patterns of all Arabidopsis CK2 subunit genes To understand the significance of the CK2 multigene family in the Arabidopsis genome, we analyzed the transcript levels of all CK2 a and b subunits in the four main tissues of 5-week-old Arabidopsis plants.. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. The tissues chosen were inflorescences and flowers (named as inflorescences), stems, rosette leaves and roots. We first attempted to detect expression of all CK2 genes by Northern blot using specific probes for each transcript (see Materials and Methods). With the exception of aC and b1, transcripts for all other CK2 subunits were detected by Northern blot (Fig. 4A). These genes are expressed in all the tissues analyzed, with slightly different levels of expression among tissues. To check whether aC and b1 genes were expressed at all, we performed semi-quantitative reverse tanscription– PCR (RT–PCR) for these two transcripts, using 18S rRNA and acp as controls. RT–PCR conditions were adapted to each gene to ensure conditions in which amplification was still linear for proper quantification of its mRNA (see Materials and Methods). As shown in Fig. 4B, aC and b1 are indeed expressed and their expression levels are very similar in all the tissues analyzed. The RT–PCR results suggest that the expression levels of aC and b1 genes are lower than those of the acp gene. Due to the limitations of Northern and RT–PCR analyses to compare levels of expression among different genes in the same tissue, we decided to use information from the GeneVestigator database (Zimmermann et al. 2004). This database compiles microarray analysis for global changes in Arabidopsis gene expression under different conditions. In the present analysis, we included results from experiments that were performed in comparable conditions, with samples obtained from the same tissues we had previously analyzed by Northern blot and RT–PCR, from untreated 5-week-old wild-type plants. A total of 75 independent experiments were included in our analysis; all of them are experiments performed by the same group (Schmid et al. 2005) (Fig. 4C). Overall, the information obtained from the GeneVestigator database is in agreement with the results obtained by Northern blot and RT–PCR. These data confirm that all subunits are constitutively expressed in all tissues, but their levels of expression are slightly different. Among a subunits, acp mRNA has stronger expression, while aC displays the lowest level of expression (Fig. 4C). Among b subunits, b2 and b3 exhibit the highest level of expression while b1 and b4 are less expressed, although the differences are not significant (Fig. 4C). We therefore think that lack of detection of b1 expression in our Northern analysis is probably due to technical limitations. In conclusion, all CK2 genes are expressed in all the tissues analyzed, with acp having a slightly higher expression level and aC a lower expression level. This difference in expression is especially interesting because both genes share the promoter region, as will be discussed later..

(5) CK2 subunits isoforms in Arabidopsis. 1299. S. cerevisiae B1 Z. mays B1 O. sativa B3 Z. mays B3 O. sativa B1 Z. mays B2 A. thaliana B3 A. thaliana B4 N. tabacum B1 N. tabacum B2 A. thaliana B1 A. thaliana B2 D. melanogaster B' D. melanogaster B X. laeves H. sapiens M. musculus C. elegans B a C. elegans B b S. cerevisiave B2 D. melanogaster Btes. A. B. Fig. 3 Protein sequence analyses of CK2b subunits from Arabidopsis. (A) CK2b subunits coded in the Arabidopsis genome (A.t.B1, At5g47080; A.t.B2, At4g17640; A.t.B3, At3g60250; and A.t.B4, At2g44680) were aligned with two other known CK2b subunits: CK2 B from Homo sapiens (H.s., M30448) (already crystallized), and CK2b from Zea. mays (Z.m. B1, AF239816). Invariant residues are indicated by *, similar residues by: and semi-conservative changes by (according to Blosum62-12-2). Characteristic domains of CK2b subunits are shown: the N-terminal extension region only present in CK2b subunit of plants, the KEN box and D-box (putative degradation motifs), the acidic stretch, the modulation of catalytic activity, the zinc finger domain (dimer formation) and the positive regulatory region (binding to catalytic subunit). (B) Cladogram showing the evolutionary divergence of CK2b subunits from different species. The cladogram was generated by using the deduced full-length protein sequence of the genes shown. The PAM250 evolutionary matrix was used for the alignment and sorting of the sequences.. Subcellular localization of Arabidopsis CK2 subunits To analyze the subcellular localization of CK2 subunits, we obtained transgenic Arabidopsis plants expressing aB:green fluorescent protein (GFP), aC:GFP and four distinct b:yellow fluorescent protein (YFP) protein fusions. To exclude potential problems associated with the overexpression of CK2 subunits, we expressed these fusion proteins under the control of the XVE system, inducible by b estradiol (Zuo et al. 2000). We were unable to obtain transgenic plants expressing aA:GFP and acp:GFP. Therefore, we transiently expressed these two constructs under the control of the cauliflower mosaic virus (CaMV) 35S constitutive promoter in Nicotiana benthamiana leaves transformed by agroinfiltration. Expression of all fusion proteins was followed by confocal microscopy. In Arabidopsis, aB:GFP and aC:GFP fusion proteins are only found in the nucleus, in both roots and leaves (Fig. 5A). Interestingly, aB is highly concentrated in. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. a discrete location within the nucleus, presumably the nucleolus (Fig. 5A, aB panel, white arrow). In agroinfiltrated Nicotiana leaves, aA:GFP exhibits a clear nuclear and also nucleolar distribution, similar to aB (Fig. 5B, aA panel, white arrow). In contrast, acp:GFP is only found in punctuated structures within the cytosol that most probably correspond to chloroplasts, as can be deduced by the merged image of the GFP fluorescence (green) and chlorophyll autofluorescence (red) (Fig. 5B, acp panel). To demonstrate that the punctuated structures that co-localize with the chlorophyll autofluorescence are indeed chloroplasts, we agroinfiltrated plants with a construct containing the destination peptide of recA fused to GFP (recA is exclusively located in the chloroplast). Fig. 5B (recA panel) shows that the recA construct also co-localizes with the structures associated with the chlorophyll autofluorescence. Finally, the lower panels in Fig. 5B show that, as expected, in agroinfiltrated Nicotiana leaves GFP alone is distributed in the nucleus and the cytosol,.

(6) 1300. CK2 subunits isoforms in Arabidopsis. α Subunits. A. I. S. L. β Subunits R. I. S. L. B. R. αA. α Subunits. β2 I. 18S. S. L. R. β Subunits nc. I. S. L. R. nc. 18S. αC. β1. β3. αcp. 18S. 18S. 18S. 18S. αcp. β4. 18S. 18S. αB. C. α Subunits. β Subunits. Control (UBQ10). Leaves. αA αB Roots αC αcp Leaves. Stem. Stem. Stem. Flower. Flower. Flower. Roots. 0. 2000. 4000. Arbitrary Units. 6000. 8000. 0. β1 β2 β3 β4. 2000. 4000. Arbitrary Units. 6000. UBQ10 β2. Roots. αcp. Leaves. 8000. 0. 10000. 20000. 30000. 40000. Arbitrary Units. Fig. 4 Expression analysis of CK2 a and b subunits from Arabidopsis. (A) Northern blot analysis for subunits aA, aB, acp, b2, b3 and b4. The 18S rRNA level was used as a loading control. I, inflorescences; S, stems; L, leaves; R, roots. (B) RT–PCR expression analysis for subunits aC and b1. The 18S rRNA was used to control quantitatively the RNA template used in our samples. acp expression was used as a reference to compare expression levels between different genes (acp is the CK2 subunit with the highest expression level in Arabidopsis). Thirty-five cycles of PCR were used to detect aC, b1 and acp, and 15 cycles to detect 18S rRNA. nc, negative control (without DNA). (C) Digital Northern blots for all CK2a and b subunits from Arabidopsis were obtained from the GeneVestigator database (Zimmermann et al. 2004). We selected data from 15 arrays of flowers, three of stems, 39 of leaves and 18 of roots tissues. UBQ10 expression is presented as an example of a constitutively expressed gene. Levels of expression are shown in arbitrary fluorescence units (see Materials and Methods).. following the same pattern observed in the Arabidopsis transgenic plants (Fig. 5D). In the case of b:YFP fusion proteins, their distribution is more variable (Fig. 5C). b1:YFP and b3:YFP localize in the nucleus and the cytosol. In contrast, b2:YFP protein is mostly found in the nucleus. b4:YFP is mainly located in the cytosol with no visible nuclear signal. All the b subunits localized in the nucleus show a detectable accumulation in the nucleolus, as seen for a subunits. As a control, Arabidopsis plants were transformed with GFP or YFP alone under the control of the XVE inducible promoter. As shown in Fig. 5D, GFP is distributed homogenously in the cytosol and the nucleus of leaves and roots of transgenic plants without any punctuated localization. YFP shows the same behavior as GFP (data not shown). A summary of the localization of all CK2 subunits is presented in Table 1. aA, aB and aC subunits localize to. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. the nucleus and are mainly excluded from the cytoplasm, while acp localizes exclusively in chloroplasts. A different situation is observed for b subunits, where b1 and b3 localize to the cytosol and to the nucleus, b2 is exclusively found in the nucleus and b4 is exclusively cytosolic. Importantly, no CK2b subunit was found in the chloroplasts. To exclude the possibility that a putative chloroplastic destination peptide could be excluded from our analysis due to annotation problems, we analyzed an extra 500 bp from each 50 end of all CK2b genes from Arabidopsis; but none of the genes presented a putative chloroplastic destination signal. CK2 activity in Arabidopsis chloroplasts To further analyze the presence of CK2 in chloroplasts of wild-type Arabidopsis plants, we decided to measure CK2 activity in a protein extract obtained from purified chloroplasts. The purity of the chloroplastic fraction.

(7) CK2 subunits isoforms in Arabidopsis. A. C. α subunits. Arabidopsis. αB-GFP. αC-GFP. β subunits. β1-YFP. β2-YFP. Arabidopsis. Leaves. 1301. Roots β3-YFP. B. αA-GFP. β4-YFP. Nicotiana. αcp-GFP. D. GFP recA-YFP. Leaves. Roots. GFP. Leaves Fig. 5 Subcellular localization of CK2:YFP/GFP fusion proteins. (A) Transgenic Arabidopsis plants transformed with XVE inducible constructs coding for CK2a:GFP fusion proteins (for aB, aC) were obtained. Before processing leaf and root samples for confocal microscopy, transgenic plants were treated for 48 h with 50 mM 17-b estradiol to induce the transgene expression. (B) Leaves from N. bentamiana plants were transiently transformed by agroinfiltration with constructs coding for the fusion proteins aA:GFP, acp:GFP and recA:YFP controlled by a constitutive promoter (35S CaMV). At 16 h post-agroinfiltration, leaf samples were analyzed by confocal microscopy. (C) Transgenic Arabidopsis plants transformed with XVE inducible constructs coding for CK2b:YFP fusion proteins (b1, b2, b3 and b4) were obtained. Plants were treated and analyzed as described in (A). (D) Leaf and root samples from a representative Arabidopsis transgenic plant expressing GFP alone under the control of the XVE inducible promoter. Plants were treated and analyzed as described in (A). Green: GFP or YFP fluorescence. Red: chlorophyll fluorescence. White arrow: discrete structure within the nucleus, presumably the nucleolus. Bar ¼ 20 mm.. obtained from Arabidopsis leaves was first verified by bright field and epifluorescence microscopy. As shown in Fig. 6A, all structures observed in the sample were green in the bright field image (left image) and showed chlorophyll fluorescence (right image). We also verified that. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. the chloroplastic fraction was not contaminated with nuclei by analyzing the presence of TFIIB, a protein that localizes only in the nucleus. As shown in Fig. 6B, while TFIIB was detected in a nuclear fraction, it was not found in the chloroplastic fraction..

(8) 1302. CK2 subunits isoforms in Arabidopsis. Table 1 Subcellular localization of all Arabidopsis CK2 subunits CK2 subunit aA aB aC acp b1 b2 b3 b4. A. Subcellular localizationa Nuclear. Enriched in the nucleolus Nuclear. Enriched in the nucleolus Nuclear. Sometimes enriched in the nucleolus Chloroplastic Homogeneously distributed in the nucleus and the cytosol Homogeneously distributed in the nucleus Homogeneously distributed in the nucleus and the cytosol Cytosolic. B. Chl. N. a. Subcellular localizations listed are those represented in Fig. 5 that were consistently seen in all samples and tissues analyzed.. C 8. Discussion This work presents a systematic molecular characterization of CK2 protein kinase in A. thaliana. We have. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. 6 Activation rate. To measure CK2 activity, we used a peptide that is a specific substrate for CK2 (Marin et al. 1994). Furthermore, we quantified the kinase activity in the absence and presence of 20 mg ml1 heparin, an inhibitor of CK2. The activity inhibited by heparin is considered to be specific CK2 activity. As shown in Fig. 6C, the chloroplastic fraction presents a CK2 activity of 5.6 pmol min1 mg1. This result was consistently obtained in samples from three independent chloroplast preparations. To further support the idea that we are measuring specific CK2 activity due to the presence of a catalytic CK2a subunit in chloroplasts, we evaluated the effect of adding purified CK2b subunit to the reaction assay. As has been shown before by others and by our laboratory (Allende and Allende 1995, Salinas et al. 2001), the activity of pure CK2a can be stimulated about 5- to 10-fold after addition of CK2b to the reaction. As shown in Fig. 6C, chloroplastic fractions that were supplemented with a recombinant CK2b subunit from Xenopus increased their CK2 activity by 7.2-fold, as expected for fractions containing CK2a not saturated with CK2b (Riera et al. 2003). In summary, as reported previously for mustard, Arabidopsis thaliana presents CK2 activity in their chloroplasts. Interestingly, even when we did not find any CK2b subunits located in the chloroplasts, this chloroplastic CK2 activity remains sensitive to CK2b regulation.. 4. 2. 0 Chl. Chl Heparin. Chl βCK2. Chl βCK2 Heparin. Fig. 6 CK2 activity in protein fractions purified from chloroplasts and nuclei. (A) Microscopy images obtained from samples of purified chloroplasts. Bright field (left panel) and fluorescence emission obtained with a filter specific for chlorophyll fluorescence (right panel) are shown. Bar ¼ 10 mm. (B) Western blot analysis to detect the presence of factor TFIIB in fractions enriched in nuclei (N) and fractions enriched in chloroplasts (Chl). (C) CK2 activity expressed as relative activity (the activity of the chloroplast fraction was defined as 1). All samples assayed contain the same amount of protein. Chl: chloroplast fraction alone. Chl/heparin: 20 mg ml1 heparin was added to the phosphorylation reaction. Chl/b: pure recombinant CK2b subunit from Xenopus (50 ng) was added to the reaction before the CK2 activity assay. Chl/b/heparin: pure CK2b from Xenopus and 20 mg ml1 heparin were added to the reaction before the CK2 activity assay. Error bars represent the standard deviation obtained from three independent experiments.. carefully analyzed the Arabidopsis genome in a search for all genes coding for CK2 subunits. We found four genes coding for a subunits and four coding for b subunits. Here, we present the analysis of the gene expression of CK2.

(9) CK2 subunits isoforms in Arabidopsis. subunits and the subcellular localization of the corresponding proteins. The relevance of the present work is based on two main points. First, CK2 is an essential kinase found in all eukaryotes that regulates crucial cellular processes, such as proliferation, differentiation, survival and apoptosis (Allende and Allende 1995, Ahmed et al. 2002, Pinna, 2002, Litchfield 2003, Pyerin et al. 2005). In spite of that, and even when CK2 has been extensively studied since it was first described in 1954 (Burnett and Kennedy 1954), there are important questions that still remain unsolved: how is CK2 activity regulated in the cell? How is its substrate specificity defined? (Pinna 2002, Olsten and Litchfield 2004). With regard to this, it has been proposed that the differential subcellular localization and subunit composition of CK2 could be an important clue to resolve these questions (Filhol et al. 2004, Bibby and Litchfield 2005). Arabidopsis thaliana is today the most important plant model, and diverse genomic-based tools have been developed allowing reverse and direct genetic approaches as well as functional studies using the whole organism. Therefore, we believe that the characterization of all the CK2 genes in Arabidopsis is an important step to encourage functional studies of CK2 that might be relevant not only for plants, but also for other species. Multiplicity of genes coding for a and b CK2 subunits in Arabidopsis In animal genomes analyzed to date, the CK2 subunits are encoded by a maximum of four genes. For example, Caenorhabditis elegans has one gene for the a subunit and one for the b subunit; humans have two genes for a subunits and one for b subunits; and yeast has two genes for a subunits and two for b subunits. In contrast, in plant genomes, multiple genes coding for CK2 subunits have been found. As reported here, the Arabidopsis genome has eight genes coding for CK2 subunits (four a and four b), the rice genome has at least six genes coding for putative CK2 subunits (four a and two b) (http:// rapdb.lab.nig.ac.jp/index.html), and in maize six genes coding for CK2 subunits have been identified and characterized to date (the maize genome has not been completely sequenced) (Peracchia et al. 1999, Riera et al., 2001, Riera et al., 2003). This important difference in the gene number can be explained to some extent by gene duplication. In A. thaliana, duplicated genes are common because almost 60% of its genome arose by duplication (Blanc et al. 2000, The Arabidopsis Genome Initiative, 2000) (http://mips.gsf.de/ proj/thal/db/gv/rv/rv_frame.html). Analysis of the genomic context surrounding CK2 genes shows that for each pair of the following genes: aA and aB, b1 and b2, b3 and b4, it is possible to find one of them on each of two self-duplicated. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. 1303. regions (Fig. 1), suggesting that these pairs of genes could be functionally redundant. On the other hand, aC and acp are the more diverse sequences among Arabidopsis a subunits and, coincidently, both genes are encoded in one of the few regions of the Arabidopsis genome that has not been duplicated (The Arabidopsis Genome Initiative, 2000) (Fig. 1). Supporting the idea of functional redundancy, we were unable to find any obvious phenotype in single T-DNA insertional mutant plants for all putatively duplicated CK2 subunits genes [we did not analyze mutant plants for aC and acp because no knock-out mutants are available for these two genes (data not shown)]. Further supporting the idea of functional redundancy, putative duplicated genes for a subunits, aA and aB, are present in the same subcellular localization (mainly nuclear and nucleolar), while the remaining putative non-duplicated a subunits, aC and acp, are present in different localizations (nuclear and chloroplastic, respectively). Our results also provide evidence against the hypothesis that putative duplicated genes are functionally redundant, especially after analyzing b subunits. For example, b3 and b4, two putative duplicated genes, have different subcellular localizations: b3 localizes in the cytosol and the nucleus, while b4 is only found in the cytosol. Even though these two proteins are extremely similar, one of them is selectively excluded from the nucleus, suggesting that the subcellular localization of CK2 subunits is a finely regulated process. In contrast to our results, a recent publication reports that b4 has a nuclear and a cytosolic localization in Arabidopsis cell cultures transiently transformed by bioballistics (Perales et al. 2006). Differences in the biological system (culture cells vs. whole plants) and the transformation technique used (transient vs. stable), and also changes in physiological conditions could be possible explanations for this discrepancy. On the other hand, b1 and b3, that do not appear to come from a self-duplication event, show the same subcellular localization. Also, they both bind CCA1 in vitro, increasing its phosphorylation by some a subunits (Sugano et al. 1998). Several reports indicate that in animals different CK2 subunits are not functionally redundant (Litchfield et al. 2001). For example, mice have two a subunits, a and a0 , but only the disruption of a0 produces male sterility (Xu et al. 1999). In addition, Drosophila melanogaster has three b subunits: CK2b, CK2b0 and CK2btes, but only mutations in the CK2b subunit affect the circadian rhythm (Akten et al. 2003). In sum, this evidence suggests that, even when functional redundancy must occur within CK2 genes in Arabidopsis, some functional specialization also exists. It seems reasonable to propose that after duplication, certain CK2 genes evolved to code for proteins with.

(10) 1304. CK2 subunits isoforms in Arabidopsis. different subcellular localizations, and probably also with differential substrate specificity. Concerning the expression of CK2 genes in Arabidopsis, we demonstrated in this work that in adult plants grown under normal conditions, all genes analyzed are expressed with slight differences among them. Regardless of this fact, we showed that aC is the least expressed CK2 subunit and acp is the most expressed subunit. Interestingly, the coding regions for these two genes are located in opposite directions, 222 bp apart (Fig. 1). It is probable that their corresponding transcription factors need to compete for the same physical region within the chromosome, acp regulators being more efficient in this process. In addition, even when we did not find important differences in the expression among CK2 genes, we could expect that some genes are indeed selectively expressed in certain developmental stages of the plant. Supporting this idea, Riera et al. (2001a) reported that maize b subunits are differentially expressed at particular stages of seed development. Analysis of the expression of CK2 genes in the GeneVestigator database indicated that treatment with different compounds or hormones, or under different stress conditions does not change the expression level of any CK2 gene. Accordingly, we were not able to detect changes in the expression of CK2 genes by Northern blot after treatment with salicylic acid (data not shown). Even though we did not isolate any splicing variants of a and bCK2 genes, some alternative splicing forms have been proposed in the Arabidopsis database for two of the b subunits. b1 has two isoforms besides the one showed here; one isoform has amino acids 245, 246 and 247 deleted; the other one has a reading frameshift and in consequence the protein loses its last 32 amino acids (this protein would completely lose the a subunit-interacting domain). It has been predicted that b4 would have a splicing variant where Gly239 is deleted from the protein. The relevance of these splicing variants for the in vivo CK2 function is still unknown. An important contribution of this work is the analysis of the subcellular localization of all CK2 subunits from Arabidopsis. We showed that, with the exception of acp (see below for more details about acp), Arabidopsis a subunits are found mainly in the nucleus, and aA and aB are particularly accumulated in the nucleolus. The nucleolar localization of a subunits has been reported before in maize, but not in animals (Martel et al. 2002, Riera et al. 2004). In human cells, a subunits are also located in the nucleus, but they are not particularly enriched in the nucleolus (Martel et al. 2002, Filhol et al. 2003). The meaning of this difference is unknown, but even though plant and animal nucleoli are involved in the same cellular functions, they show different structural organization (Shaw 1995). Louvet et al. (2006) showed that in human cells, CK2 activity. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. regulates nucleolar organization, a function that CK2 may also have in plants. All the evidence described above suggests that, particularly in plants, CK2 has a highly demanding function in the nucleolus that could be relevant for the structural organization of this organelle or for an appropriate response to particular conditions. Indeed, the association of CK2 with the nucleolus most probably has several other functions. In fact, besides the classical function of rRNA synthesis, the nucleolus has also been associated with the cellular response to stress and apoptosis (Pendle et al. 2005), processes where CK2 participation has also been demonstrated (Gerber et al. 2000, Kato et al. 2003, Yamane and Kinsella 2005). Surprisingly, no Arabidopsis a subunit was found in the cytosol. The sensitivity of the method we employed cannot rule out that a small percentage of CK2 does localize in this cellular compartment. Indeed, in animals, the evidence shows that a subunits are five times more abundant in the nucleus than in the cytosol (Martel et al. 2002, Filhol et al. 2003), and it has been reported that several proteins specifically retain CK2 within the cytosol. For example, FAF1 is required to keep CK2 associated with the cytosolic face of the nuclear membrane (Ahmed et al. 2002), and CKIP1 is necessary to maintain CK2 associated with the cytosolic face of the plasma membrane (Olsten et al. 2004). Concerning the localization of b subunits in Arabidopsis, our results are similar to those described for maize b subunits (Riera et al. 2004). One important difference we found in Arabidopsis vs. all other systems is that Arabidopsis b4 is exclusively localized in the cytosol. No other CK2b has previously been found excluded from the nucleus; however, this work is the first study in plants where all CK2bs have been systematically analyzed. It cannot be ruled out that in maize, where the subcellular localization of three b subunits has been reported, an exclusively cytosolic subunit exists that has not yet been characterized. Interestingly, a subunits are almost absent from the cytosol, especially in plants, while b subunits in all organisms are mainly concentrated in this cellular location. Considering that b subunits have a regulatory role on the a subunits, how can it be explained that they are located in a cellular compartment where the a subunit is not present? At least two explanations exist. First, CK2b subunits may regulate not only CK2 activity but also other enzymes. In fact, in mammalian cells, CK2b regulates the activity of two cytosolic kinases other than CK2a: c-Mos and A-Raf (Boldyreff and Issinger 1997, Chen et al. 1997). Secondly, b is probably able to move between different cellular compartments. For example, b subunits could be maintained in the cytosol and after a certain stimulus they could migrate to the nucleus..

(11) CK2 subunits isoforms in Arabidopsis. CK2 subunits from animals and plants show another difference in addition to those already discussed. Plant CK2b subunits are approximately 90 amino acids longer in their N-terminus, compared with animal CK2b subunits. Nothing is known about the function of this extra domain; however, a high level of conservation was found in this region among all known plant bCK2 proteins. Interestingly, by successfully using a Xenopus CK2b subunit that does not have the N-terminal extension present in plant b subunits, we demonstrated that this plant N-terminal extension does not seem to be required to stimulate the CK2 kinase activity present in plant chloroplasts. Although we cannot rule out that the N-terminus could play a role in a subunit stimulation in vivo, we think that another function could be associated with this extension, such as substrate recognition or subcellular localization. Finally, if all a subunits can interact with all b subunits, a wide diversity of CK2 holoenzymes could be expected in Arabidopsis. However, some restrictions to this diversity exist. These restrictions are mainly due to the differential subcellular localization of CK2 subunits, as we showed here; and also to a possible differential affinity between different as and bs, as already demonstrated in maize (Riera et al. 2001a). Chloroplastic CK2 in Arabidopsis An important result presented here is the existence of a chloroplastic CK2 in Arabidopsis. Chloroplastic CK2 activity has been previously described in mustard, where it was proposed to mediate redox modulation of the transcription process (Ogrzewalla et al. 2002). Ogrzewalla and colleagues showed that mustard acp is imported into chloroplasts in vitro. Our results go further; we have demonstrated that under normal growing conditions, Arabidopsis acp is only found in the chloroplast. This result is supported by evidence that a CK2 activity can be detected in this organelle. This conclusion is particularly relevant because Arabidopsis and mustard acps have not only a putative N-terminal chloroplastic destination peptide, but also a conserved nuclear localization signal in the same position as the rest of the a subunits (Fig. 2A). An in silico search for plant genes coding for CK2a subunits allowed us to find other CK2a subunits having a putative chloroplastic destination peptide (for example in O. sativa and Beta vulgaris) (Loschelder et al. 2004). This suggests that plants acquired a chloroplastic CK2 gene very early in evolution, before plant family divergence. Interestingly, prokaryotes do not code for CK2 genes. Therefore, we can speculate that in the course of evolution, and probably by random insertions, a nuclear acp gene acquired a chloroplastic destination sequence that resulted in an improved fitness that was later maintained throughout evolution.. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. 1305. Several interesting issues arise from our finding of a chloroplastic CK2a in Arabidopsis. First, we found acp transcripts in tissues such as roots and flowers which have plastids different from chloroplasts, suggesting a role for acp in processes common to all plastids. Secondly, we were unable to find, by in silico analysis, any CK2b subunit gene with a chloroplastic destination sequence in any plant species. This could indicate that acps do not require a CK2b subunit to function in vivo; or that a CK2b subunit, normally located in another cellular location, could be relocated to the chloroplast. Thirdly, it is possible that acp allows the chloroplast to regulate a process that is mainly relevant to eukaryotic cells. Finally, the presence of CK2 in the chloroplasts, and also in the nucleolus, could be related to the important role these organelles play in the plant responses to stress (Ogrzewalla et al. 2002, Durrant and Dong 2004, Pendle et al. 2005). In conclusion, we have demonstrated that all CK2 genes coding for a and b subunits in Arabidopsis are expressed in the same tissues and at similar levels, but their proteins localize differentially within the cell. This strongly suggests that subcellular localization is probably one of the most important mechanisms responsible for the specificity of CK2 activity in vivo.. Materials and Methods Plant material and growth conditions Seeds of A. thaliana ecotype Columbia 0 (Col-0) were grown in vitro in a growth chamber (22 28C, 16 h light) (75 mmol m2 s1). Transgenic plants (Col-0) were generated by the floral dip transformation method (Bechtold et al. 1993). Seeds from Agrobacterium-infiltrated plants were selected on standard MS medium (Murashige and Skoog 1962) containing 30 mg l1 hygromycin (Sigma, Seelze, Germany). Database search and sequence analysis of Arabidopsis CK2 genes To identify CK2 subunit genes in the Arabidopsis genome, we performed a BLAST search of the TAIR database (http:// www.arabidopsis.org). To deduce the amino acid sequence of CK2 genes, open reading frames (ORFs) and intron positions for putative Arabidopsis CK2 genes were defined considering: TAIR annotation, analysis of available expressed sequence tags (ESTs) and cDNAs sequences, and alignment with CK2 genes from other plant species. For aA and aB genes, we considered the translational start sites previously described (Mizoguchi et al. 1993). For the rest of the CK2 genes (aC, acp, b1, b2, b3 and b4), we considered the positions of ORFs and introns annotated at the TAIR database. Sequence alignments and digital Northern analyses The search for equivalent genes from other organisms was done using the BLAST program in the Entrez database http:// www.ncbi.nlm.nih.gov. Sequence analysis was performed using the MultAlin (http://prodes.toulouse.inra.fr/multalin/multalin.html) (Corpet 1988) and BoxShade (https://www.ch.embnet.org/.

(12) 1306. CK2 subunits isoforms in Arabidopsis. software/BOX_form.html) software programs. The dendograme analysis was carried out with the TreeView software (http:// taxonomy.zoology.gla.ac.uk/rod/rod) (Page 1996). Digital Northern analyses were performed as described (Zimmermann et al. 2004) using the GeneVestigator database (http://www.genevestigator.ethz.ch/). We selected data from 75 hybridizations performed with different tissues from 5-week-old plants. For this selection, we considered the indications provided by the GeneVestigator database (percentage present calls, samples processed from the same group to avoid biases due to sample handling, processing and scanning). Northern and RT–PCR analyses Tissue samples from inflorescences, stems, leaves (rosette) and roots were carefully collected from 5-week-old plants grown in vitro. Total RNA was extracted from frozen samples using the TRIzolÕ Reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s protocol. For Northern blot analysis, membrane preparation and hybridizations were carried out as previously described (Blanco et al. 2005). acp transcript was detected with a probe that recognizes the sequence coding for the putative chloroplastic destination peptide; the rest of the CK2 transcripts were detected with probes that recognize a region of their 30 untranslated region. All probes were cloned in pGEM-T easy vector (PROMEGA, San Luis Obispo, CA, USA) and verified by sequencing. Primers used are as follows. Forward (F), Reverse (R): At5g67380 CK2 aA F, TAAGACGTTTCAGACATTCG; R, GAGAAGTCAATGAAACACAGAG; At3g50000 CK2 aB F, CCTATTTCGCTCAAGTCAGGG; R, CCGGAGGGAGTAAT AAGAATTCTC; At2g23080 CK2aC F, CGAACTCAGTA AAACCGAAGC; R, GCTATGATTATATAATGAAGCTTTG; At2g23070 CK2 acp F, ATGGCCTTAAGGCCTTG; R, CTA GCTTTCGACGGCGCAC; At5g47080 CK2 b1 F, AAATGAC TAAATCAGACACTGAG; R, AAGTTTGACGACAAAACCC; At4g17640 CK2 b2 F, CCGTGAAGGAAACAAGG; R, GGGA AATTGTGATAACTATTTGG; At3g60250 CK2 b3 F, ACAA AATCCAACTAACTGGGG; R, GCTCTGCATTCTCAATGG TG; At2g44680 CK2 b4 F, AAGCAAAGCAAAATCCATCC; R, CTCCTCTCAACAGTCTTGTGG; At2g01010 18S F, GACGG AGAATTAGGGTTCGATTC; R, CCAACTAAGAACGGCCA TGCAC (Invitrogen). For semi-quantitative RT–PCR experiments, the same primers described above were used and the protocol was performed as described (Chen et al. 2004). The cDNA was synthesized using an ImProm II kit (Promega) and PCRs were done with AmpliTaq Gold Polymerase (Applied Biosystems, Foster City, CA, USA). The amount of total RNA used was 5 mg per reaction and the number of cycles in the PCRs was modified depending on the gene expression level to avoid saturation of the amplified fragment. For 18S rRNA, the number of cycles used was 15, 20 and 30, while for CK2 subunits genes the number of cycles was 25, 30, 35 and 40. In the case of CK2 subunits, the amplification reaction was still linear at 35 amplification cycles and for 18S rRNA linearity was maintained until 15 cycles. RT–PCRs were analyzed by electrophoresis in 1.5% agarose. All Northern blot and RT–PCR experiments were repeated at least three times with independent biological samples. DNA constructs To analyze the subcellular localization of CK2 subunits, we used two different types of constructs suited for two different. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. techniques: (i) genes controlled by an inducible promoter [XVE system inducible by 17-b estradiol (Sigma) in the pER8 vector (Zuo et al. 2000)], for stable transformation of Arabidopsis plants; and (ii) genes controlled by a constitutive promoter [CaMV 35S promoter in pCAMBIA1302 vector (CAMBIA, Australia, http://www. cambia.org.au/daisy/cambia/home.htm)], for transient expression in N. bentamiana leaves via agroinfiltration. CK2 genes cloned in the inducible vector were always placed downstream of the GFP or YFP gene, while CK2 genes cloned in the constitutive vector were placed upstream of the GFP gene. To make the inducible gene constructs, full-length GFP or YFP cDNAs without their stop codons were first subcloned into pER8 [XhoI/ApaI (Zuo et al. 2000)] to generate pERG or pERY vectors. Then, full-length Arabidopsis CK2 subunit (aB, aC, b1, b2, b3 and b4) cDNAs were amplified from cDNA prepared from leaves and cloned into pERG or pERY vectors (ApaI/SpeI). Sequences obtained for each CK2 subunit produced proteins of: 332 amino acids for aA, aB and aC subunits, 432 amino acids for the acp subunit, 286 amino acids for b1, 281 amino acids for b2, 276 amino acids for b3 and 282 amino acids for b4. To make the constitutive gene constructs, cDNAs from aA and acp subunits were cloned in the pCAMBIA1302 vector into BglII/SpeI restriction sites. The recA:YFP construct was kindly provided by Dr. Lee Meisel. In this construct, the recA chloroplastic destination peptide is cloned in-frame upstream of the full-length YFP cDNA in the pBI2 vector. All final constructs were verified by sequencing before they were transferred to the plants. Subcellular localization analysis and image processing Transgenic plants used for subcellular localization analysis were grown in vitro for 2 weeks. Prior to visualization, plants were incubated in liquid MS medium in the presence of 50 mM 17-b estradiol (Sigma) during 48 h. For transient expression analysis, 1-month-old N. benthamiana plants were agroinfiltrated with the corresponding constructs as previously described (Kopertekh and Schiemann 2005). After 2 d, leaves were taken for microscopic visualization. Confocal images for GFP and YFP constructs were obtained with an Axiovert 200 inverted, LSM 510 Meta confocal Microscope (Carl Zeiss, Oberkochen, Germany). A wavelength of 514 nm was used to excite YFP and a wavelength of 488 nm for GFP and chlorophyll. The emission was detected by using the filters BP 530–600 for YFP and BP 505–550 for GFP. The LP 650 filter was used to filter out the chlorophyll. Images were processed with the Zeiss LSM Image and Adobe Photoshop software packages. Chloroplastic and nuclear extracts Chloroplasts were isolated from 2-week-old Arabidopsis seedlings according to Aronsson and Jarvis (2002) and were observed by epifluorescence microscopy to verify their purity and quality. Purified chloroplasts were lysed on ice by sonication (five cycles of 10 s) using a UP 50 H ultrasonic processor (200 mm amplitude and 40 W output power (Dr. Hielscher GmbH, Teltow, Germany)]. Lysed chloroplasts were cleared by centrifugation at 12,000g during 15 min at 48C. The protein concentration of the supernatants was determined using the Bio-Rad Laboratories kit (Bio-Rad, Hercules, CA, USA). These samples were directly assayed for CK2 activity as outlined below. Nuclear extracts were prepared from 10 g of 2-week-old Arabidopsis seedlings grown in vitro, according to the procedure previously described (Uquillas et al. 2004). To check for major nuclear contamination in the chloroplast preparations, we performed Western blot analysis against TFIIB,.

(13) CK2 subunits isoforms in Arabidopsis an exclusively nuclear protein. For this purpose, anti-human TFIIB rabbit polyclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) was diluted 1 : 3,000 and incubated with membranes containing 20 mg of proteins from nuclear and chloroplastic extracts. Western LightningTM chemiluminiscence reagent plus (PelkinElmer Lifescience, Boston, MA, USA) was used to detect the secondary antibody. CK2 activity assay CK2 activity was assayed in nuclear and chloroplastic extracts as described (Hidalgo et al. 2001). Each sample contained: 200 mM peptide RRRDDDSDDD (CK2-specific substrate, Sigma), 200 mM [ -32P] ATP (500–800 c.p.m. pmol1) and 5 mg of nuclear or 10 mg of chloroplastic extracts. To analyze the effect of CK2b on the chloroplastic extract, prior to the CK2 activity assay, samples were incubated for 10 min at room temperature with 50 ng of purified CK2b subunit from Xenopus laevis (donated by Dr. Catherine Connelly). All activity assays were repeated at least three times using independent biological samples.. Acknowledgments The authors are greatly indebted to Nam Chua (Laboratory of Plant Molecular Biology, The Rockefeller University) for providing the PER8 vector; to Lee Meisel (Faculty of Ecology and Natural Resources, Millenium Nucleus in Plant Cell Biology, Universidad Andrés Bello) for providing the recA:YFP construct; and to Catherine Connelly (Faculty of Medicine, Universidad de Chile) for providing purified CK2b subunit from X. laevis. We also thank BioP&P for editorial and graphic work. This work was supported by research grants 1020593 and 1060494 from Fondecyt-Conicyt, Chile, and cooperation ECOS-CONICYT grant C00B03.. References Ackermann, K., Neidhart, T., Gerber, J., Waxmann, A. and Pyerin, W. (2005) The catalytic subunit a0 gene of human protein kinase CK2 (CSNK2A2): genomic organization, promoter identification and determination of Ets1 as a key regulator. Mol. Cell. Biochem. 274: 91–101. Ahmed, K., Gerber, D.A. and Cochet, C. (2002) Joining the cell survival squad: an emerging role for protein kinase CK2. Trends Cell Biol. 12: 226–230. Akten, B., Jauch, E., Genova, G.K., Kim, E.Y., Edery, I., Raabe, T. and Jackson, F.R. (2003) A role for CK2 in the Drosophila circadian oscillator. Nat. Neurosci. 6: 251–257. Allende, J. and Allende, C. (1995) Protein kinases. 4. Protein kinase CK2: an enzyme with multiple substrates and a puzzling regulation. FASEB J. 9: 313–323. Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408: 796–815. Aronsson, H. and Jarvis, P. (2002) A simple method for isolating importcompetent Arabidopsis chloroplasts. FEBS Lett. 529: 215–220. Bechtold, N., Ellis, J. and Pelletier, G. (1993) In-planta agrobacteriummediated gene-transfer by infiltration of adult Arabidopsis thaliana plants. C.R. Acad. Sci. Ser. III 316: 1194–1199. Bibby, A. and Litchfield, D. (2005) The multiple personalities of the regulatory subunit of protein kinase CK2: CK2 dependent and CK2 independent roles reveal a secret identity for CK2? Int. J. Biol. Sci. 1: 67–79. Blanc, G., Barakat, A., Guyot, R., Cooke, R. and Delseny, M. (2000) Extensive duplication and reshuffling in the Arabidopsis genome. Plant Cell 12: 1093–1102. Blanco, F., Garreton, V., Frey, N., Dominguez, C., Perez-acle, T., Van Der Straeten, D., Jordana, X. and Holuigue, L. (2005) Identification of. Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017. 1307. NPR1-dependent and independent genes early induced by salicylic acid treatment in Arabidopsis. Plant Mol. Biol. 59: 929–946. Boldyreff, B. and Issinger, O.-G. (1997) A-Raf kinase is a new interacting partner of protein kinase CK2 b subunit. FEBS Lett. 403: 197–199. Burnett, G. and Kennedy, E.P. (1954) The enzymatic phosphorylation of proteins. J. Biol. Chem. 21: 969–980. Chen, F., Ro, D.-K., Petri, J., Gershenzon, J., Bohlmann, J., Pichersky, E. and Tholl, D. (2004) Characterization of a root-specific Arabidopsis terpene synthase responsible for the formation of the volatile monoterpene 1,8-cineole. Plant Physiol. 135: 1956–1966. Chen, M., Li, D., Krebs, E. and Cooper, J. (1997) The casein kinase II beta subunit binds to Mos and inhibits Mos activity. Mol. Cell. Biol. 17: 1904–1912. Collinge, M.A. and Walker, J.C. (1994) Isolation of an Arabidopsis thaliana casein kinase II beta subunit by complementation in Saccharomyces cerevisiae. Plant Mol. Biol. 25: 649–658. Corpet, F. (1988) Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16: 10881–10890. Durrant, W.E. and Dong, X. (2004) Systemic acquired resistance. Annu. Rev. Phytopathol. 42: 185–209. Espunya, M.C., Combettes, B., Dot, J., Chaubet-Gigot, N. and Martinez, M.C. (1999) Cell-cycle modulation of CK2 activity in tobacco BY-2 cells. Plant J. 19: 655–666. Espunya, M.C., Lopez-Giraldez, T., Hernan, I., Carballo, M. and Martinez, M.C. (2005) Differential expression of genes encoding protein kinase CK2 subunits in the plant cell cycle. J. Exp. Bot. 56: 3183–3192. Faust, M. and Montenarh, M. (2000) Subcellular localization of protein kinase CK2. Cell Tissue Res. 301: 329–340. Filhol, O., Martiel, J. and Cochet, C. (2004) Protein kinase CK2: a new view of an old molecular complex. EMBO J. 5: 351–355. Filhol, O., Nueda, A., Martel, V., Gerber-Scokaert, D., Benitez, M., Souchier, C., Saoudi, Y. and Cochet, C. (2003) Live-cell fluorescence imaging reveals the dynamics of protein kinase CK2 individual subunits. Mol. Cell. Biol. 23: 975–987. Gerber, D.A., Souquere-Besse, S., Puvion, F., Dubois, M.-F., Bensaude, O. and Cochet, C. (2000) Heat-induced relocalization of protein kinase CK2. Implication of CK2 in the contex of cellular stress. J. Biol. Chem. 275: 23919–23926. Guerra, B., Niefind, K., Pinna, L.A., Schomburg, D. and Issinger, O.G. (1998) Expression, purification and crystallization of the catalytic subunit of protein kinase CK2 from Zea mays. Acta Crystallogr. D 54: 143–145. Guo, C., Yu, S., Davis, A.T., Wang, H., Green, J.E. and Ahmed, K. (2001) A potential role of nuclear matrix-associated protein kinase CK2 in protection against drug-induced apoptosis in cancer cells. J. Biol. Chem. 276: 5992–5999. Hidalgo, P., Garreton, V., Berrios, C.G., Ojeda, H., Jordana, X. and Holuigue, L. (2001) A nuclear casein kinase 2 activity is involved in early events of transcriptional activation induced by salicylic acid in tobacco. Plant Physiol. 125: 396–405. Ivanov, K.I., Puustinen, P., Gabrenaite, R., Vihinen, H., Ronnstrand, L., Valmu, L., Kalkkinen, N. and Makinen, K. (2003) Phosphorylation of the potyvirus capsid protein by protein kinase CK2 and its relevance for virus infection. Plant Cell 15: 2124–2139. Kang, H.-G. and Klessig, D.F. (2005) Salicylic acid-inducible Arabidopsis CK2-like activity phosphorylates TGA2. Plant Mol. Biol. 57: 541–557. Kato, J., Tomohisa, , Delhase, M., Hoffmann, A. and Karin, M. (2003) CK2 is a C-terminal IkB kinase responsible for NF-kB activation during the UV response. Mol. Cell 12: 829–839. Kato, K., Kidou, S., Miura, H. and Sawada, S. (2002) Molecular cloning of the wheat CK2alpha gene and detection of its linkage with Vrn-A1 on chromosome 5A. Theor. Appl. Genet. 104: 1071–1077. Kopertekh, L. and Schiemann, J. (2005) Agroinfiltration as a tool for transient expression of cre recombinase in vivo. Transgenic Res. 14: 793–798. Lee, Y., Lloyd, A.M. and Roux, S.J. (1999) Antisense expression of the CK2 alpha-subunit gene in Arabidopsis. Effects on light-regulated gene expression and plant growth. Plant Physiol. 119: 989–1000. Litchfield, D.W. (2003) Protein kinase CK2: structure, regulation and role in cellular decisions of life and death. Biochem. J. 369: 1–15..

(14) 1308. CK2 subunits isoforms in Arabidopsis. Litchfield, D.W., Bosc, D.G., Canton, D.A., Saulnier, R.B., Vilk, G. and Zhang, C. (2001) Functional specialization of CK2 isoforms and characterization of isoform-specific binding partners. Mol. Cell. Biochem. 227: 21–29. Loschelder, H., Homann, A., Ogrzewalla, K. and Link, G. (2004) Proteomics-based sequence analysis of plant gene expression—the chloroplast transcription apparatus. Phytochemistry 65: 1785–1793. Louvet, E., Junera, H.R., Berthuy, I. and Hernandez-Verdun, D. (2006) Compartmentation of the nucleolar processing proteins in the granular component is a CK2-driven process. Mol. Biol. Cell 17: 2537–2546. Marin, O., Meggio, F. and Pinna, L.A. (1994) Design and synthesis of two new peptide substrates for the specific and sensitive monitoring of casein kinases-1 and -2. Biochem. Biophys. Res. Commun. 198: 898–905. Martel, V., Filhol, O., Nueda, A. and Cochet, C. (2002) Dynamic localization/association of protein kinase CK2 subunits in living cells: a role in its cellular regulation?. Ann. NY Acad. Sci. 973: 272–277. Meggio, F. and Pinna, L.A. (2003) One-thousand-and-one substrates of protein kinase CK2?. FASEB J. 17: 349–368. Mizoguchi, T., Yamaguchi-Shinozaki, K., Hayashida, N., Kamada, H. and Shinozaki, K. (1993) Cloning and characterization of two cDNAs encoding casein kinase II catalytic subunits in Arabidopsis thaliana. Plant Mol. Biol. 21: 279–289. Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15: 473–497. Niefind, K., Guerra, B., Ermakowa, I. and Issinger, O. (2001) Crystal structure of human protein kinase CK2: insights into basic properties of the CK2 holoenzyme. EMBO J. 20: 5320–5331. Ogrzewalla, K., Piotrowski, M., Reinbothe, S. and Link, G. (2002) The plastid transcription kinase from mustard (Sinapis alba L.): a nuclearencoded CK2-type chloroplast enzyme with redox-sensitive function. Eur. J. Biochem. 269: 3329–3337. Olsten, M.E.K., Canton, D.A., Zhang, C., Walton, P.A. and Litchfield, D.W. (2004) The pleckstrin homology domain of CK2 interacting protein-1 is required for interactions and recruitment of protein kinase CK2 to the plasma membrane. J. Biol. Chem. 279: 42114–42127. Olsten, M. and Litchfield, D. (2004) Order or chaos? An evaluation of the regulation of protein kinase CK2. Biochem. Cell Biol. 82: 681–693. Padmanabha, R., Chen-Wu, J., Hanna, D. and Glover, C. (1990) Isolation, sequencing, and disruption of the yeast CKA2 gene: casein kinase II is essential for viability in Saccharomyces cerevisiae. Mol. Cell. Biol. 10: 4089–4099. Page, R.D. (1996) TreeView: an application to display phylogenetic trees on personal computers. CABIOS 12: 357–358. Pendle, A.F., Clark, G.P., Boon, R., Lewandowska, D., Lam, Y.W., Andersen, J., Mann, M., Lamond, A.I., Brown, J.W.S. and Shaw, P.J. (2005) Proteomic analysis of the Arabidopsis nucleolus suggests novel nucleolar functions. Mol. Biol. Cell 16: 260–269. Peracchia, G., Jensen, A.B., Culianez-Macia, F.A., Grosset, J., Goday, A., Issinger, O.-G. and Pages, M. (1999) Characterization, subcellular localization and nuclear targeting of casein kinase 2 from Zea mays. Plant Mol. Biol. 40: 199–211. Perales, M., Portoles, S. and Mas, P. (2006) The proteasome-dependent degradation of CKB4 is regulated by the Arabidopsis biological clock. Plant J. 46: 849–860.. Pinna, L.A. (2002) Protein kinase CK2: a challenge to canons. J. Cell Sci. 115: 3873–3878. Pyerin, W., Barz, T. and Ackermann, K. (2005) Protein kinase CK2 in gene control at cell cycle entry. Mol. Cell. Biochem. 274: 189–200. Riera, M., Figueras, M., Lopez, C., Goday, A. and Pages, M. (2004) Protein kinase CK2 modulates developmental functions of the abscisic acid responsive protein Rab17 from maize. Proc. Natl Acad. Sci. USA 101: 9879–9884. Riera, M., Pages, M., Issinger, O.-G. and Guerra, B. (2003) Purification and characterization of recombinant protein kinase CK2 from Zea mays expressed in Escherichia coli. Protein Express. Purif. 29: 24–32. Riera, M., Peracchia, G., de Nadal, E., Arino, J. and Pages, M. (2001a) Maize protein kinase CK2: regulation and functionality of three b regulatory subunits. Plant J. 25: 365–374. Riera, M., Peracchia, G. and Pages, M. (2001b) Distinctive features of plant protein kinase CK2. Mol. Cell. Biol. 227: 119–127. Rodriguez, F., Allende, C.C. and Allende, J.E. (2005) Protein kinase casein kinase 2 holoenzyme produced ectopically in human cells can be exported to the external side of the cellular membrane. Proc. Natl Acad. Sci. USA 102: 4718–4723. Salinas, P., Bantignies, B., Tapia, J., Jordana, X. and Holuigue, L. (2001) Cloning and characterization of the cDNA coding for the catalytic alpha subunit of CK2 from tobacco. Mol. Cell. Biochem. 227: 120–135. Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M., Scholkopf, B., Weigel, D. and Lohmann, J.U. (2005) A gene expression map of Arabidopsis thaliana development 37: 501–506. Shaw, P.J. (1995) The nucleolus. Annu. Rev. Cell Dev. Biol. 5: 93–121. Sugano, S., Andronis, C., Green, R., Wang, Z. and Tobin, E. (1998) Protein kinase CK2 interacts with and phosphorylates the Arabidopsis circadian clok-associated 1 protein. Proc. Natl Acad. Sci. USA 95: 11020–11025. Sugano, S., Andronis, C., Ong, M.S., Green, R.M. and Tobin, E.M. (1999) The protein kinase CK2 is involved in regulation of circadian rhythms in Arabidopsis. Proc. Natl Acad. Sci. USA 96: 12362–12366. Uquillas, C., Letelier, I., Blanco, F., Jordana, X. and Holuigue, L. (2004) NPR1-independent activation of immediate early salicylic acid-responsive genes in Arabidopsis. Mol. Plant-Microbe Interact. 17: 34–42. Wirkner, U., Voss, H., Ansorge, W. and Pyerin, W. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit a (CSNK2A1). Genomics 48: 71–78. Wirkner, U., Voss, H., Lichter, P., Weitz, S., Ansorge, W. and Pyerin, W. (1992) Human casein kinase II subunit a: sequence of a processed (pseudo) gene and its localization on chromosome 11. Biochim. Biophys. Acta 1131: 220–222. Xu, X., Toselli, P.A., Russell, L.D. and Seldin, D.C. (1999) Globozoospermia in mice lacking the casein kinase II alpha prime catalytic subunit. Nat. Genet. 23: 118–121. Yamane, K. and Kinsella, T.J. (2005) CK2 inhibits apoptosis and changes its cellular localization following ionizing radiation. Cancer Res. 65: 4362–4367. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem, W. (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol. 136: 2621–2632. Zuo, J., Niu, Q. and Chua, N. (2000) An estrogen receptor-based transactivator XVE mediates highly inducible gene expression in transgenic plant. Plant J. 24: 265–273.. (Received May 29, 2006; Accepted July 31, 2006). Downloaded from https://academic.oup.com/pcp/article-abstract/47/9/1295/2329728 by Pontificia Universidad Catolica de Chile user on 21 December 2017.

(15)