A Nuclear Gene for the Iron–Sulfur Subunit of Mitochondrial Complex II is Specifically Expressed During Arabidopsis Seed Development and Germination

(1)Plant Cell Physiol. 47(1): 14–21 (2006) doi:10.1093/pcp/pci218, available online at www.pcp.oupjournals.org JSPP © 2006. A Nuclear Gene for the Iron–Sulfur Subunit of Mitochondrial Complex II is Specifically Expressed During Arabidopsis Seed Development and Germination Alvaro Elorza 1, 2, 3, Hannetz Roschzttardtz 1, Isabel Gómez 1, Armand Mouras 2, Loreto Holuigue 1, Alejandro Araya 3 and Xavier Jordana 1, * 1. Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, P. Universidad Católica de Chile, Casilla 114-D, Santiago, Chile 2 UMR 0619-Physiologie et Biotechnologie Végétales, Institut National de la Recherche Agronomique et Université Victor Segalen-Bordeaux II, IBVM CR-INRA Bordeaux, BP 81, 33883 Villenave d’Ornon Cedex, France 3 Laboratoire de Réplication et Expression des Gènes Eucaryotes et Rétroviraux, UMR 5097, CNRS et Université Victor Segalen-Bordeaux II, 33076 Bordeaux-Cedex, France ; umbelliferyl-β-D-glucuronide; RACE, rapid amplification of cDNA ends; RT–PCR, reverse transcription–PCR; SDH, succinate dehydrogenase; UTR, untranslated region. Three nuclear genes, SDH2-1, SDH2-2 and SDH2-3, encode the essential iron–sulfur subunit of mitochondrial complex II in Arabidopsis thaliana. SDH2-1 and SDH2-2 probably arose via a recent duplication event and we reported that both are expressed in all organs from adult plants. In contrast, transcripts from SDH2-3 were not detected. Here we present data demonstrating that SDH2-3 is specifically expressed during seed development. SDH2-3 transcripts appear during seed maturation, persist through desiccation, are abundant in dry seeds and markedly decline during germination. Analysis of transgenic Arabidopsis plants carrying the SDH2-3 promoter fused to the β-glucuronidase reporter gene shows that the SDH2-3 promoter is activated in the embryo during maturation, from the bent-cotyledon stage. β-Glucuronidase expression correlates with the appearance of endogenous SDH2-3 transcripts, suggesting that control of this nuclear gene is achieved through transcriptional regulation. Furthermore, progressive deletions of this promoter identified a 159 bp region (–223 to –65) important for SDH2-3 transcriptional activation in seeds. Interestingly, the SDH2-3 promoter remains active in embryonic tissues during germination and post-germinative growth, and is turned off in vegetative tissues (true leaves). In contrast to SDH2-3 transcripts, SDH2-1 and SDH2-2 transcripts are barely detected in dry seeds and increase during germination and postgerminative growth. The opposite expression patterns of SDH2 nuclear genes strongly suggest that during germination the embryo-specific SDH2-3 is replaced by SDH2-1 or SDH2-2 in mitochondrial complex II.. Introduction Succinate:ubiquinone oxidoreductase [succinate dehydrogenase (SDH), EC 1.3.5.1], commonly referred to as complex II, catalyzes the oxidation of succinate to fumarate and the reduction of ubiquinone to ubiquinol. This mitochondrial membrane-associated complex is a functional part of both the citric acid cycle and the aerobic respiratory chain, and has been well characterized in bacteria and heterotrophic eukaryotes (Lemire and Oyedotun 2002, Yankovskaya et al. 2003). In these organisms, complex II contains only four polypeptides: two peripheral membrane proteins, a flavoprotein (SDH1) and an iron–sulfur protein (SDH2), and two small integral membrane proteins (SDH3 and SDH4). The succinate-binding site is formed by the SDH1 polypeptide, which is covalently linked to a FAD molecule acting as acceptor of a hydride ion at an early step of succinate oxidation. This flavoprotein interacts with the SDH2 subunit, which transfers the electrons to the membrane through its three non-heme iron–sulfur centers. SDH3 and SDH4 anchor the SDH1–SDH2 subcomplex to the matrix side of the inner membrane and contain a b-type heme and the ubiquinone-binding site (Yankovskaya et al. 2003). Interestingly, it has been shown recently that plant complex II may contain additional subunits of unknown function (Eubel et al. 2003, Millar et al. 2004). Complex II subunits are all encoded in the nuclear genome in Arabidopsis thaliana, just like complex II from heterotrophic eukaryotes (Scheffler 1998, Figueroa et al. 2001, Figueroa et al. 2002, Millar et al. 2004). Moreover, several of the complex II subunits are encoded by more than one gene in Arabidopsis. For instance, we have described that three nuclear genes, designated SDH2-1 (At3g27380), SDH2-2 (At5g40650). Keywords: Arabidopsis thaliana – Iron–sulfur subunit — Plant mitochondria — Seed-specific expression — Succinate dehydrogenase — Transcriptional regulation. Abbreviations: ABRE, abscisic acid-responsive element; DAF, days after flowering; dpi, days post-imbibition; GUS, β-glucuronidase; LEA, late embryogenesis abundant; MUG, 4-methyl*. Corresponding author: E-mail, xjordana@bio.puc.cl; Fax, +56-2-2225515. 14. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017.

(2) Mitochondrial complex II gene expression in seeds. and SDH2-3 (At5g65165), encode the iron–sulfur subunit in A. thaliana (Figueroa et al. 2001). All three proteins are probably functional as complex II subunits since they are highly conserved compared with their homologs in other organisms. Moreover, they contain the cysteine motifs involved in binding the three iron–sulfur clusters essential for electron transport and they are actively imported into isolated plant mitochondria (Figueroa et al. 2001). The presence of three SDH2 genes in Arabidopsis is intriguing and raises interesting questions about their origin and function. It is worth mentioning that Roos and Tielens (1994) described two differentially expressed SDH2 genes in the larval and adult stages of the sheep nematode Haemonchus contortus, a fact that may be related to a switch in energy metabolism during development. To our knowledge, this is the only report describing more than one SDH2 gene in a eukaryotic organism. Several observations have suggested that Arabidopsis SDH2-1 and SDH2-2 genes arose via a relatively recent duplication event, and that separation with SDH2-3 would be more ancient (Figueroa et al. 2001). First, SDH2-1 and SDH2-2 have similar exon–intron structures and encode nearly identical proteins (96% identity), whereas SDH2-3 has a completely different exon–intron structure and encodes a protein only 67% similar to SDH2-1 and SDH2-2. Secondly, whereas the N-terminal mitochondrial targeting sequences of SDH2-1 and SDH2-2 are similar, a completely different one is attached to SDH2-3. To gain insight into the regulation of nuclear genes encoding mitochondrial proteins and the role of multiple SDH2 genes in complex II biogenesis, we undertook a detailed analysis of SDH2 expression during plant development. Recently we found that SDH2-1 and SDH2-2 are expressed in all organs from adult plants, with the highest mRNA levels in reproductive organs (Elorza et al. 2004). In contrast, we were unable to detect SDH2-3 expression, raising questions about its role. Seed germination and post-germinative growth are crucial for seedling establishment. Germination begins with imbibition, terminates with radicle emergence and is followed shortly after by the mobilization of seed nutrient reserves which provide essential energy and carbon skeletons to support growth until the seedling becomes photoautotrophic (Bewley 1997, Bewley et al. 2000). Several studies have implicated mitochondrial activity and mitochondrial biogenesis in these processes (Ehrenshaft and Brambl 1990, Logan et al. 2001 and references therein). Furthermore, a specific role for the nondecarboxylative portion of the citric acid cycle, comprising the steps catalyzed by SDH and fumarase, has been proposed in oilseeds for the pathway converting storage lipids into soluble carbohydrates (Falk et al. 1998, Oliver et al. 1998, Eastmond and Graham 2001). These data led us to analyze SDH2 gene expression during germination and post-germinative growth. Unexpectedly, we found high levels of SDH2-3 transcripts in dry seeds, prompting us to characterize SDH2-3 expression during seed development. Here, we show that SDH2-3 is spe-. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017. 15. cifically expressed in the embryo during the maturation phase of seed development. SDH2-3 transcripts are abundant in dry seeds and decline during germination. Furthermore, transgenic Arabidopsis plants carrying SDH2-3 promoter fusions to the GUS reporter gene allowed us to show that SDH2-3 expression is regulated at the transcriptional level during seed development, and to define a promoter region involved in this tissuespecific expression.. Results Expression of SDH2 genes during germination In Arabidopsis, germination (radicle emergence) takes place within 24 h of imbibition under optimal conditions. This is followed by a period of 2 d of heterotrophic growth, which is supported by seed storage reserves. By the end of this period, the transition to photoautotrophic growth has occurred (Eastmond and Graham 2001). Since mitochondria are expected to play a central role during reserve mobilization, we studied SDH2 expression during germination and post-germinative growth in the dark, to avoid carbon and energy sources for seedling growth being switched to mainly photosynthetic reactions. We also analyzed the expression of the fumarase gene (At2g47510, accession No. AF020303), since both SDH and fumarase activities are essential for carbohydrate synthesis from lipid (Eastmond and Graham 2001). RNA was isolated from Arabidopsis and Brassica napus seeds and seedlings at different times after imbibition, and the expression of SDH2 and fumarase genes was examined using Northern analysis. Hybridization to Arabidopsis SDH2-1, SDH2-2 and SDH2-3 mRNAs was performed with genespecific probes generated from the 3′ untranslated regions (UTRs) (Fig. 1A). Since Brassica SDH2 genes have not been characterized, blots were hybridized with probes derived from Arabidopsis SDH2-2 and SDH2-3 coding regions (Fig. 1B). Fumarase transcripts were detected with probes from the coding region of either the Arabidopsis (Fig. 1A) or the Brassica (Fig. 1B) genes. In both species, the steady-state abundance of fumarase, SDH2-1 and SDH2-2 transcripts was very low or undetectable in seeds and increased significantly during germination and post-germinative growth. Unexpectedly, SDH2-3 transcript levels were high in seeds and markedly declined during germination and post-germinative growth. It is worth mentioning that it was the first time we were able to detect significant levels of SDH2-3 expression. In previous studies, SDH2-3 mRNA had been revealed only in reverse transcription–PCR (RT–PCR) and rapid amplification of 3′ cDNA ends (3′ RACE) experiments (Figueroa et al. 2001, Elorza et al. 2004), and data on SDH2-3 expression are very scarce in the existing large expression databases. Either SDH2-3 probes are absent, for instance in the Affymetrix chips (see at http://www.genevestigator.ethz. ch, Zimmermann et al. 2004), or seeds have not been analyzed and expression is barely detected (e.g. by massively parallel.

(3) 16. Mitochondrial complex II gene expression in seeds. Fig. 2 RT–PCR multiplex analysis of SDH2-3 transcripts during silique development. Total RNA was obtained from recently opened flowers (lane 1), short siliques (<5 mm long, lane 2), thin green siliques (5–10 mm long, lane 3), long and thick green siliques (10– 14 mm long, lane 4), siliques with yellow tips (lane 5), yellow siliques (lane 6) and dry mature seeds (lane 7) (see Materials and Methods). SDH2-3 transcripts were analyzed by RT–PCR multiplex as described by Elorza et al. (2004), with 32 amplification cycles. Radioactive PCR products corresponding to SDH2-3 transcripts and 18S rRNA were fractionated on urea–polyacrylamide gels and visualized by autoradiography.. signature sequencing, http://mpss.udel.edu.at, Meyers et al. 2004; see also GEO profiles at http://www.ncbi.nlm.nih.gov). These results suggested that SDH2-3 is specifically expressed during seed development and prompted us to analyze its expression during this developmental phase.. period of cellular expansion and accumulate storage proteins, lipids and carbohydrates in their cotyledons. In the last stage (late maturation), an acute loss of water takes place in the seed and the embryo becomes metabolically quiescent (dormant) and tolerant to desiccation. SDH2-3 mRNA steady-state levels were examined during silique development by the sensitive, semi-quantitative RT– PCR multiplex procedure. Staging of the developing siliques was performed according to their morphology (see Materials and Methods and Fig. 2), and total RNA was extracted from these silique pools, flowers and dry seeds. 18S rRNA was analyzed simultaneously as an internal standard. SDH2-3 transcripts could not be detected in flowers, confirming previous results (Figueroa et al. 2001, Elorza et al. 2004). Furthermore, no significant SDH2-3 expression was observed in siliques at early developmental stages, corresponding to the morphogenesis phase of embryo development (Fig. 2). Expression occurs in long green siliques, where most embryos have completed morphogenesis and entered the maturation phase (Fig. 2, lanes 4 and 5). Transcript levels persist through desiccation (lanes 5 and 6), and dry seeds contain abundant SDH2-3 mRNA (lane 7), confirming the results shown in Fig. 1. The signal obtained for RNA extracted from dry seeds is stronger than that for RNA from whole siliques, suggesting that transcripts detected in siliques were in fact derived from seeds.. Expression of the SDH2-3 gene during silique development Seed development is a key process in the life cycle of higher plants. In Arabidopsis, it can be roughly divided into three stages (Baud et al. 2002). Morphogenesis begins with fertilization, and terminates with a bent-cotyledon embryo having acquired the basic architecture of the plant. During maturation, the second phase of development, embryo cells go through a. The SDH2-3 promoter is activated in the embryo during maturation We have previously fused 1,603 bp of the SDH2-3 promoter to the β-glucuronidase (GUS) reporter gene (construct P5), and found that GUS is not expressed in flowers, leaves, stems and roots of adult plants (Elorza et al. 2004). In view of the results described in the previous sections, we used this con-. Fig. 1 Northern blot analysis of SDH2 and fumarase gene expression in germinating Arabidopsis thaliana (A) and Brassica napus (B). (A) Each lane was loaded with 2 µg of total RNA extracted from imbibed seeds (0 dpi, days post-imbibition) and germinating seedlings from 1 to 4 dpi. The blot was hybridized sequentially with SDH2-1-, SDH2-2- and SDH2-3-specific probes (derived from 3′ UTRs), and then with Arabidopsis fumarase and 18S rDNA probes. (B) Each lane was loaded with 8 µg of total RNA extracted from imbibed seeds (0 h post-imbibition) and germinating seedlings from 3 h to 7 dpi. The blot was successively hybridized with Arabidopsis SDH2-2 and SDH2-3 probes (coding sequences), a B. napus fumarase probe and an 18S rDNA probe (loading control).. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017.

(4) Mitochondrial complex II gene expression in seeds. 17. struct to unveil the mechanism of regulation of SDH2-3 expression during silique development. GUS activity was initially quantified in protein extracts from transgenic T2 seeds, and was found to be high in eight out of 12 independent transformed lines (results not shown). Then homozygous plants were obtained for several transgenic lines. Protein extracts were prepared in triplicate from samples equivalent to those employed in Fig. 2, i.e. recently opened flowers and siliques at different developmental stages. GUS activity was assayed in these extracts, and a representative result is shown in Fig. 3A. GUS activity was low in protein extracts from flowers and siliques at early developmental stages, corresponding to the embryo morphogenesis phase (Fig. 3A, samples 1–3). GUS expression was induced concomitantly with embryo maturation (samples 4 and 5), and was maintained through desiccation (samples 5 and 6). This activity profile mimics the expression pattern of the endogenous SDH2-3 transcript (Fig. 2). Results of GUS staining in transgenic flowers and siliques carrying the P5 SDH2-3 construct are shown in Fig. 3B. No GUS staining was observed in flowers (sample 1), as previously described (Elorza et al. 2004). Moreover, young siliques also lack GUS activity (samples 2 and 3). In agreement with quantitative GUS assays, GUS expression was detected in sample 4 and increased as siliques enlarged and became yellow. In addition, this histochemical analysis clearly showed that GUS is specifically expressed in seeds. Finally, embryos were dissected out from developing seeds and then stained for GUS activity. GUS expression was not detected in torpedo embryos (not shown), was induced at the bent-cotyledon stage, during the maturation phase of seed development, and increased as maturation proceeded (Fig. 3C). Staining appeared first in embryo cotyledons and then extended to the other embryo tissues.. Fig. 3 SDH2-3 promoter activity during seed development. Staging of the developing siliques was performed as described in Materials and Methods. Samples 1–6 shown in (A) and (B) correspond to the same stages employed in Fig. 2: flowers (1), short siliques (2), thin green siliques (3), long and thick green siliques (4), siliques with yellow tips (5) and yellow siliques (6). (A) A representative result, obtained for one transgenic line carrying the P5 construct, is shown. Protein extracts were prepared in triplicate from pools of flowers or developing siliques, and GUS activity was measured using 4-MUG as substrate. Thus, data points represent mean and SD of three samples. (B) Flowers and siliques were stained for GUS activity. (C) Bent-cotyledon stage embryos of different sizes were manually dissected out from seeds of green siliques (samples 3 and 4) and stained for GUS activity.. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017. Analysis of the SDH2-3 promoter Arabidopsis transgenic plants carrying progressive deletions of the SDH2-3 promoter fused to the GUS reporter gene have been obtained (Elorza et al. 2004). In this previous work, however, only adult plant tissues and 13-day-old seedlings were stained for GUS activity. To investigate regulatory control regions involved in seed SDH2-3 expression, here we determined GUS activity in mature dry seeds from these transgenic plants. For each construct, GUS activity in seeds was quantified in duplicate seed extracts from 7–9 independent transformed lines. Results are shown in Fig. 4A. Deletion of the promoter to –223 (P3 construct) did not significantly affect GUS activity. Interestingly, removal of the region between –223 and –65 (P2 construct) drastically reduced GUS expression, revealing the presence of important ciselements involved in SDH2-3 transcriptional activation in seeds. The sequence from –230 to the SDH2-3 ATG initiation codon is presented in Fig. 4B. Identification of transcription initiation sites was performed on seed RNA by 5′ RACE, and the major 5′ end was found to map 47–49 nucleotides upstream.

(5) 18. Mitochondrial complex II gene expression in seeds. Fig. 4 Identification of a SDH2-3 promoter region important for expression in seeds. (A) GUS activity was measured in duplicate seed extracts from transgenic lines carrying progressive deletions of the SDH2-3 promoter fused to GUS (previously obtained P5 to P1 constructs, Elorza et al. 2004). Promoter sizes (in bp) are 1,603 (P5), 391 (P4), 223 (P3) and 64 (P2). In the P1 construct, the whole promoter and 16 bp from the 5′ UTR were deleted. Seven to nine independent transgenic lines were used for each construct. Each symbol represents one transgenic line, and SDs have been omitted for clarity. (B) Nucleotide sequence of the SDH2-3 promoter. The sequence from –230 to the SDH2-3 ATG initiation codon is presented. A curved arrow indicates the transcription initiation site mapped by 5′ RACE. The 5′ ends of the regions fused to GUS in P3, P2 and P1 constructs are indicated by arrowheads. Putative ABRE and RY motifs are underlined and double underlined, respectively. The ATG initiation codon is indicated by white letters on a black background.. from the translation initiation codon. The 159 bp promoter region (–223/–65) defined as important for expression in seeds contain motifs putatively involved in this organ-specific expression. In silico analysis of this sequence revealed the. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017. Fig. 5 SDH2-3 promoter activity during germination and post-germinative growth. (A) GUS quantitative assays were performed with protein extracts prepared in triplicate from pools of imbibed seeds and germinating seedlings from 1 to 4 d after imbibition. A representative result, obtained for one transgenic line carrying the P5 construct, is shown. Data points indicate mean and SD of the three samples. (B) Histochemical GUS staining is shown for 4-and 8-day-old seedlings carrying the P5 construct. No GUS activity was detected in the first true leaves, whereas embryonic tissues (cotyledons, hypocotyls) show GUS staining.. presence of two potential abscisic acid-responsive elements (ABREs, underlined in Fig. 4B), characterized by the consensus sequence YACGTGGC and the core ACGT (Busk and Pagès 1998, Leung and Giraudat 1998). Moreover, these putative elements are separated by a short 6 bp sequence and may act in concert. An additional putative ABRE motif is present in the P2 construct (at –62, underlined in Fig. 4B), and an RY-like enhancer element, which might be also involved in seed gene expression, is located eight nucleotides downstream (double underlined in Fig. 4B). The SDH2-3 promoter is inactivated in vegetative tissues To determine whether SDH2-3 expression is also regulated at the transcriptional level during germination, seeds from.

(6) Mitochondrial complex II gene expression in seeds. three homozygous transgenic lines harboring the P5 construct were germinated in the dark for 4 d. Protein extracts were prepared and GUS activity was measured. Similar results were obtained for the three lines, and those for one of them are shown in Fig. 5A. GUS activity remained fairly constant between 0 and 4 d after imbibition, indicating that the SDH2-3 promoter is still active in embryonic tissues during germination and post-germinative growth. Since the SDH2-3 promoter is not active in vegetative tissues and flowers from adult plants (Elorza et al. 2004 and Fig. 3B), we investigated when it is inactivated. Four- and 8-dayold seedlings were analyzed via histochemical GUS staining (Fig. 5B). In 4-day-old seedlings, GUS activity appeared strong in cotyledons and hypocotyl, confirming the quantitative data. In 8-day-old seedlings, decreased GUS activity was seen in cotyledons and hypocotyl, and, most importantly, no GUS staining was observed in first true new leaves. This result clearly showed that the SDH2-3 promoter is turned off in vegetative tissues.. Discussion Considering that in most organisms there is a single SDH2 gene, as expected for a supposedly housekeeping gene with a well-defined function, the presence of three genes in Arabidopsis raises questions about their roles during plant development and led us to undertake a detailed analysis of their expression. We recently reported that SDH2-1 and SDH2-2 genes, which have similar structures and encode nearly identical proteins, have similar expression patterns (Elorza et al. 2004). These results are consistent with the fact that SDH2-1 and SDH2-2 arose via a relatively recent duplication event and are probably redundant (Elorza et al. 2004). Here we have found a highly tissue-specific expression pattern for the SDH2-3 gene. This gene, which is structurally different and would have diverged for a long time from SDH2-1 and SDH2-2, is highly expressed in the embryo during seed development. Altogether, our results suggest that, after its emergence from a common ancestor, SDH2-3 differentiated to acquire a specific role in seed maturation and/or early germination. SDH2-3 is expressed in the embryo during seed development SDH2-3 transcripts accumulate during the maturation phase of seed development and remain high during the desiccation phase and in dry seeds (Fig. 2). Parcy et al. (1994) monitored the expression pattern of multiple marker mRNAs during Arabidopsis seed development and identified classes of coordinately expressed mRNAs. The seed-specific expression of SDH2-3 described here overlaps with that of genes encoding abundant seed storage proteins (e.g. At2S3, CRC and PAP85) and late-embryogenesis abundant (LEA) proteins. The expression of these proteins is under tight developmental control, since they are not expressed in vegetative tissues and their. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017. 19. expression is restricted to the maturation and/or desiccation phases of embryogenesis, as is the case for SDH2-3. To gain insight into the mechanism of SDH2-3 gene regulation during silique development, its promoter was fused to the GUS reporter gene and analyzed in transgenic plants (Fig. 3). The correlation between SDH2-3 mRNA appearance (Fig. 2) and GUS expression (Fig. 3) during embryo maturation suggests that control of this gene is achieved through transcriptional regulation. Furthermore, histochemical GUS staining revealed that SDH2-3 is specifically expressed in the embryo from the bent-cotyledon to dry seed stages. Progressive deletions of the promoter defined a promoter region (–223 to –65) important for high expression in seeds (Fig. 4). Two potential ABRE elements, separated by 6 bp and which may act in concert, are present in this region and might represent seed-specific elements (Fig. 4B). ABRE elements have been implicated in seed storage and LEA protein gene regulation (Busk and Pagès 1998). ABRE functions effectively when two copies are located in tandem, or when it is associated with a coupling or enhancer element (Nambara and Marion-Poll 2003). One kind of element is the RY motif, which acts as an enhancer for seed-specific transcription. Consistently, genome-wide profiling of Arabidopsis seed transcripts revealed that ABREs are over-represented in the promoters of highly expressed genes (Nakabayashi et al. 2005). Moreover, multiple copies of ABRE or the presence of the RY motif in combination with ABRE were associated with particularly high expression. In this context, it has to be pointed out that an additional putative ABRE element and an RY-like motif are located downstream from –64 (P2 construct, Fig. 4B). Our results clearly demonstrate that these two elements present in P2 are not sufficient for high SDH2-3 expression in seeds, but they do not exclude the possibility that they are necessary. Further work will be needed to ascertain the functional role of these or other sequences. SDH2-3 expression decline during germination The steady-state abundance of SDH2-3 transcripts is high in seeds and markedly declines during germination and postgerminative growth (Fig. 1A). In contrast, SDH2-1, SDH2-2 and fumarase transcript levels are barely detected in dry seeds and then increase. These opposite expression patterns suggest that during germination and post-germinative growth a SDH23-containing complex II is replaced by a complex II containing SDH2-1 or SDH2-2. It is likely that transcript level decreases observed for SDH2-1, SDH2-2 and fumarase at 2 d postimbibition were due to the fact that transition to photoautotrophic growth does not occur in the dark. Similar results were obtained in B. napus, leading to the important conclusion that the presence of two types of iron– sulfur subunit (SDH2-1/2-2 and SDH2-3 types) is not specific to Arabidopsis (Fig. 1B). It is worth mentioning that a SDH2-1/ 2-2-like gene has been described previously in maize and rice (Figueroa et al. 1999, Kubo et al. 1999), and that database.

(7) 20. Mitochondrial complex II gene expression in seeds. searches have allowed us to identify a SDH2-3 homolog in several monocots (unpublished results). Thus, the presence of two types of SDH2 genes appears to be conserved among angiosperms. The expression profiles of SDH2-1, SDH2-2 and fumarase genes mirror those of the genes involved in fatty acid βoxidation or the glyoxylate cycle (Rylott et al. 2001). These results suggest that the increased expression of SDH2-1 and SDH2-2 is part of an overall metabolic program that enables the mobilization of storage reserves, and argue against a role for SDH2-3 in lipid mobilization and conversion to soluble carbohydrates during the post-germinative period of seedling growth. The imbibing seed resumes metabolic activity within minutes of water entering its cells, and rapid increases in respiration rate accompany the earliest stages of germination (Bewley and Black 1994). For instance, Logan et al. (2001) studied mitochondrial biogenesis during maize embryo germination, and showed that succinate-dependent O2 consumption and citric acid cycle activity were low in embryos from dry seeds, but increased rapidly during imbibition. Resumption of protein synthesis is another early event during imbibition, and utilizes mRNAs conserved in the dry seed (Rajjou et al. 2004). Therefore, it is tempting to speculate that SDH2-3 transcripts accumulate in the dry seed to allow for their rapid translation at early germination, before SDH2-1 and SDH2-2 are expressed.. Materials and Methods Plant material and growth conditions Arabidopsis thaliana ecotype Columbia-0 (Col-0) plants were grown hydroponically at 22°C, under a 16 h light/8 h dark cycle (Gibeaut et al. 1997). Staging of developing siliques (Fig. 2, 3) was performed according to their morphology. Besides recently opened flowers and dry seeds, five samples were collected: short siliques [<5 mm long, 1–3 d after flowering (DAF)], thin green siliques (5– 10 mm long, 4–5 DAF), long and thick green siliques (10–14 mm long, ∼2 mm thick, 6–9 DAF), siliques with yellow tips (10–11 DAF) and yellow siliques (12–14 DAF). For germination experiments, seeds were surface sterilized with a solution of 10% (v/v) commercial bleach for 10 min, rinsed thoroughly and plated on sterile distilled water-soaked filter papers. Germination and seedling growth were carried out in the dark. Brassica napus seeds were incubated at 22–24°C, and Arabidopsis seeds were first cold treated at 4°C for 48 h and then incubated at 22–24°C. RNA preparation and analysis Tissues were harvested into liquid nitrogen. Total RNA was isolated by the method of Vicient and Delseny (1999) and further purified using the RNeasy Plant mini kit (Qiagen, Valencia, CA, USA), according to the manufacturer’s protocol. Northern analyses were performed by standard procedures, with 32 P-labeled probes (Ausubel et al. 1994). To obtain gene-specific probes to analyze Arabidopsis transcripts (Fig. 1A), DNA fragments from the 3′ UTRs were PCR amplified using the following primer pairs: for SDH2-1, 5′ AACAGATTACTCACATCAAGCA 3′ and 5′ TAGGTTTAAGTTTACTCGAGTTT 3′; for SDH2-2, 5′ AACAGATCACACACATCAAGCA 3′ and 5′ AGCAGAGTTTTATTGCTTGTTG 3′; and for SDH2-3, 5′ GAGAGGCTACAGGCAATAACTGAG. Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017. 3′ and 5′ AGTTTTAAACATTGATTCTTATTG 3′. To analyze Brassica SDH2 transcripts (Fig. 1B), probes were derived from Arabidopsis coding sequences. The following primer pairs were used: for Arabidopsis SDH2-2 coding region, 5′ CTAGATGCTTTGATTAAGAT 3′ and 5′ AAATCCATTAGGTACTGCCT 3′; and for Arabidopsis SDH2-3 coding region, 5′ ATGTCGTCTGTCTTGCGGTTGTT 3′ and 5′ AGACACTCTCTGTTCTCACTAACGGA 3′. The fumarase probes were obtained by RT–PCR, using total RNA from either Arabidopsis flowers or B. napus seedlings, and the primers 5′ AAGCTCTGGCTGCACACGAT 3′ and 5′ ATCAATCGGAGGGACCAATC 3′. The PCR products were cloned into a pGEM-T plasmid (Promega, Madison, WI, USA). RT–PCR multiplex experiments were carried out as previously described (Elorza et al. 2004). 5′ RACE experiments were performed according to the supplier’s protocol (Invitrogen, Carlsbad, CA, USA). Three nested oligonucleotides were used: 5′ TTTCTCTTTCGTTATGTCTTGGGAT 3′, 5′ TTTGGATAAGTCTTGAGCCGCT 3′ and 5′ CGCTTTATGTCCATTTAAGATTGGA 3′. PCR products were cloned into a pGEM-T Easy plasmid and several clones were sequenced to identify transcription initiation sites. GUS assays Soluble extracts of plant tissues were assayed for GUS activity by fluorometric measurements, using 4-methylumbelliferyl-β-D-glucuronide (MUG, Sigma, St. Louis, MO, USA) as substrate (Jefferson 1987). Protein concentrations were determined by the Bradford method (Bradford 1976), and GUS activities were calculated as nmol MU h–1 mg–1 of protein. Histochemical GUS staining was performed as described (Elorza et al. 2004). Samples were incubated at 37°C overnight into GUS buffer [100 mM sodium phosphate buffer, pH 7.0, 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide, 0.1% (v/v) Triton X100, 0.1% (w/v) sodium lauroyl sarcosine] plus 1 mM 5-bromo-4chloro-3-indolyl-β-D-glucuronide (X-Gluc, BD Biosciences Clontech, Palo Alto, CA, USA) (Jefferson 1987).. Acknowledgments The authors are greatly indebted to Simon Litvak and Laura Tarragó-Litvak for their continued support and encouragement. This work was supported by research grants 1020930 and 7020930 (Cooperación Internacional) from Fondecyt-Chile, and PICS grant 2179 from CNRS-France. PhD student work was supported by ConicytChile grants 2000073 (to A.E.) and AT-4040013 (to H.R.).. References Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (1994) Current Protocols in Molecular Biology. Wiley Interscience, New York. Baud, S., Boutin, J-P., Miquel, M., Lepiniec, L. and Rochat, C. (2002) An integrated overview of seed development in Arabidopsis thaliana ecotype WS. Plant Physiol. Biochem. 40: 151–160. Bewley, J.D. (1997) Seed germination and dormancy. Plant Cell 9: 1055–1066. Bewley, J.D. and Black, M. (1994) Seeds. Physiology of Development and Germination. Plenum Press, New York. Bewley, J.D., Hempel, F.D., McCormick, S. and Zambryski, P. (2000) Reproductive development. In Biochemistry and Molecular Biology of Plants. Edited by Buchanan, B.B., Gruissem, W. and Jones, R.L. pp. 988–1043. American Society of Plant Physiologists, Rockville, MD. Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72: 248–254..

(8) Mitochondrial complex II gene expression in seeds Busk, P.K. and Pagès, M. (1998) Regulation of abscisic acid-induced transcription. Plant Mol. Biol. 37: 425–435. Eastmond, P.J. and Graham, I.A. (2001) Re-examining the role of the glyoxylate cycle in oilseeds. Trends Plant Sci. 6: 72–77. Elorza, A., León, G., Gómez, I., Mouras, A., Holuigue, L., Araya, A. and Jordana, X. (2004) Nuclear SDH2-1 and SDH2-2 genes, encoding the iron– sulfur subunit of mitochondrial complex II in Arabidopsis, have distinct cellspecific expression patterns and promoter activities. Plant Physiol. 136: 4072–4087. Ehrenshaft, M. and Brambl, R. (1990) Respiration and mitochondrial biogenesis in germinating embryos of maize. Plant Physiol. 93: 295–304. Eubel, H., Jänsch, L. and Braun, H.P. (2003) New insights into the respiratory chain of plant mitochondria. Supercomplexes and a unique composition of complex II. Plant Physiol. 133: 274–286. Falk, K.L., Behal, R.H., Xiang, C. and Oliver, D.J. (1998) Metabolic bypass of the tricarboxylic acid cycle during lipid mobilization in germinating oilseeds. Plant Physiol. 117: 473–481. Figueroa, P., Gómez, I., Holuigue, L., Araya, A. and Jordana, X. (1999) Transfer of rps14 from the mitochondrion to the nucleus in maize implied integration within a gene encoding the iron–sulphur subunit of succinate dehydrogenase and expression by alternative splicing. Plant J. 18: 601–609. Figueroa, P., León, G., Elorza, A., Holuigue, L., Araya, A. and Jordana, X. (2002) The four subunits of mitochondrial respiratory complex II are encoded by multiple nuclear genes and targeted to mitochondria in Arabidopsis thaliana. Plant Mol. Biol. 50: 725–734. Figueroa, P., León, G., Elorza, A., Holuigue, L. and Jordana, X. (2001) Three different genes encode the iron–sulfur subunit of succinate dehydrogenase in Arabidopsis thaliana. Plant Mol. Biol. 46: 241–250. Gibeaut, D.M., Hulett, J., Cramer, G.R. and Seemann, J.R. (1997) Maximal biomass of Arabidopsis thaliana using a simple, low-maintenance hydroponic method and favorable environmental conditions. Plant Physiol. 115: 317– 319. Jefferson, R.A. (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5: 387–405. Kubo, N., Harada, K., Hirai, A. and Kadowaki, K. (1999) A single nuclear transcript encoding RPS14 and SDHB of rice is processed by alternative splicing: common use of the same mitochondrial targeting signal for different proteins. Proc. Natl Acad. Sci. USA 96: 9207–9211. Lemire, B.D. and Oyedotun, K.S. (2002) The Saccharomyces cerevisiae mitochondrial succinate:ubiquinone oxidoreductase. Biochim. Biophys. Acta 1553: 102–116. Logan, D.C., Millar, A.H., Sweetlove, L.J., Hill, S.A. and Leaver, C.J. (2001) Mitochondrial biogenesis during germination in maize embryos. Plant Physiol. 125: 662–672. Leung, J. and Giraudat, J. (1998) Abscisic acid signal transduction. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49: 199–222.. 21. Meyers, B.C., Vu, T.H., Tej, S.S., Ghazal, H., Matvienko, M, Agrawal, V., Ning, J. and Haudenschild, C.D. (2004) Analysis of the transcriptional complexity of Arabidopsis thaliana by massively parallel signature sequencing. Nat. Biotechnol. 22: 1006–1011. Millar, A.H., Eubel, H., Jänsch, L., Kruft, V., Heazlewood, J.L. and Braun, H.P. (2004) Mitochondrial cytochrome c oxidase and succinate dehydrogenase complexes contain plant specific subunits. Plant Mol. Biol. 56: 77–90. Nakabayashi, K., Okamoto, M., Koshiba, T., Kamiya, Y. and Nambara, E. (2005) Genome-wide profiling of stored mRNA in Arabidopsis thaliana seed germination: epigenetic and genetic regulation of transcription in seed. Plant J. 41: 697–709. Nambara, E. and Marion-Poll, A. (2003) ABA action and interaction in seeds. Trends Plant Sci. 8: 213–217. Oliver, D.J., Behal, R.H., Xiang, C. and Falk, K.L. (1998) Changes in fumarase and NAD+-dependent isocitrate dehydrogenase during Arabidopsis seed germination. In Plant Mitochondria: From Gene to Function. Edited by Møller, I.M., Gardeström, P., Glimelius, K. and Glaser, E. pp. 395–399. Backhuys Publishers, Leiden, The Netherlands. Parcy, F., Valon, C., Raynal, M., Gaubier-Comella, P., Delseny, M. and Giraudat, J. (1994) Regulation of gene expression programs during Arabidopsis seed development: roles of the ABI3 locus and of endogenous abscisic acid. Plant Cell 6: 1567–1582. Rajjou, L., Gallardo, K., Debeaujon, I., Vandekerckhove, J., Job, C. and Job, D. (2004) The effect of α-amanitin on the Arabidopsis seed proteome highlights the distinct roles of stored and neosynthesized mRNAs during germination. Plant Physiol. 134: 1598–1613. Roos, M.H. and Tielens, A.G.M. (1994) Differential expression of two succinate dehydrogenase subunit-B genes and a transition in energy metabolism during the development of the parasitic nematode Haemonchus contortus. Mol. Biochem. Parasitol. 66: 273–281. Rylott, E.L., Hooks, M.A. and Graham, I.A. (2001) Co-ordinate regulation of genes involved in storage lipid mobilization in Arabidopsis thaliana. Biochem. Soc. Trans 29: 283–287. Scheffler, I.E. (1998) Molecular genetics of succinate:quinone oxidoreductase in eukaryotes. Progr. Nucl. Acid Res. Mol. Biol. 60: 267–315. Vicient, C.M. and Delseny, M. (1999) Isolation of total RNA from Arabidopsis thaliana seeds. Anal. Biochem. 268: 412–413. Yankovskaya, V., Horsefield, R., Törnroth, S., Luna-Chavez, C., Miyoshi, H., Léger, C., Byrne, B., Cecchini, G. and Iwata, S. (2003) Architecture of succinate dehydrogenase and reactive oxygen species generation. Science 299: 700–704. Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem, W. (2004) GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox. Plant Physiol. 136: 2621–2632.. (Received August 18, 2005; Accepted October 16, 2005). Downloaded from https://academic.oup.com/pcp/article-abstract/47/1/14/1867462 by Pontificia Universidad Catolica de Chile user on 11 December 2017.

(9)

Nuevo documento

2006, EI Salvador, en la investigación: "Estudio Expost Facto sobre la Motivación y Satisfacción Laboral", concluye que de los grupos estudiados el más motivado de todos es el personal

En función de esta premisa básica sobre el rol de la cooperación internacional en el sector agropecuario y rural, este trabajo tiene como objetivo analizar el estado de situación de los

• Resumen El objetivo de este artículo es analizar la política de cooperación internacional argentina en materia de ciencia y tecnología CyT a partir del contraste entre la política

Por esto, la investigación se centró en las acciones de CD llevadas a cabo por el PE de la provincia de Entre Ríos a partir de la existencia de convenios internacionales y cartas de

Los objetivos de la representación ante UNESCO incluyen promover los intereses del Gobierno de Quebec en materia de educación, la cultura, el desarrollo cientíico y la sociedad de la

Los habitantes de la comunidad la Silveria en los últimos años han venido buscando políticas de desarrollo sostenible y vista la necesidad de desarrollar actividades de turismo

4.2 OBJETIVOS GERAIS DO CURSO Proporcionar ao Cadete Aviador conhecimentos e experiências de aprendizagem que o habilite a: a desempenhar as atividades de caráter militar e de

Generalidades del tour: el tiempo de duración del tour será de 8horas aproximadamente, los principales atractivos a visitar serán: El centro histórico de la ciudad de Riobamba, Guano,

diagnóstico del sitio; Elaborar el análisis de audiencia; y Diseñar el Plan de Manejo para el Centro de Interpretación Ricpamba; utilizando información primaria y secundaria