• No se han encontrado resultados

GENETIC REPORT

N/A
N/A
Protected

Academic year: 2021

Share "GENETIC REPORT"

Copied!
17
0
0

Texto completo

(1)

GENETIC REPORT

DOCUMENTO DE ESTUDIO UNIDAD 4: “ LA REVOLUCIÓN GENÉTICA ”

CIENCIAS DEL MUNDO CONTEMPORÁNEO. 1º BACHILLERATO.

I.E.S. PEDRO JIMÉNEZ MONTOYA. BAZA (GRANADA)

CURSO 2013 / 2014

(2)

TABLE OF CONTENTS

1.- Genetics:

A) Draw the structure of the DNA and detail its components

B) How is a protein sintetize from a fragment of DNA? Explain all the steps

C) What type of mutations can we find according to where they are produced (gene or chromosome)

1

D) What are the implications of the work done by Gregor Mendel?

2.- Human Genome Project: Time, money and countries involved

3.- Genetic engineering: recombinant DNA technology and PCR

4.- Create a list of the product created from biotechnology techniques:



Bacteria



Animal and plants



Human beings



Ecosystems

5.- Research: Tell the teacher which subject you are willing to work about.

2

1

y

2

Sólo para alumnos del bachillerato biológico / Only needed for biology students

(3)

1.

1.

1.

1. A) Draw the structure of the DNA and detail its components A) Draw the structure of the DNA and detail its components A) Draw the structure of the DNA and detail its components A) Draw the structure of the DNA and detail its components

El ADN (ácido desoxirribonucleico) es la molécula que porta la información genética de los seres vivos. Pertenece a un grupo de biomoléculas llamadas ácidos nucleicos. Su estructura consiste en dos cadenas de ADN en forma de doble hélice.

DNA (Deoxyribonucleic acid) is the molecule that carries the genetic information in living beings.

It belongs to a group of biomolecules called nucleic acids. Its structure consists in two chains of DNA nucleotides in double helix form.

Los ácidos nucleicos permiten almacenar, reproducir y expresar la información genética que se manifiesta en forma de características biológicas del ser vivo.

Nucleic acids allow to store, reproduce and express genetic information which is expressed in the form of traits or characteristics of the living being.

Los ácidos nucleicos son polímeros formados por unidades llamadas monómeros que, en este caso, son los nucleótidos. Nucleic acids are polymers made up by different units called monomers; in this case they are the nucleotides.

Cada nucleótido tiene 3 componentes químicos distintos: Each nucleotide has 3 different chemical components:

1.- Un grupo fosfato

2.- Un azúcar (hidrato de carbono, concretamente, una pentosa de 5 carbonos) - En el AR R R RN esa pentosa se llama rrrribosa. Sus bases nitrogenadas son A, G, C y U.

- En el AD D D DN esa pentosa se llama d d desoxirribosa. Sus bases son A, G, C y T. d

Púricas (Adenina: A y Guanina: G)

3.- Una base nitrogenada

Pirimidínicas (Citosina: C y Timina: T) / Uracilo: U (ARN)

(4)

Each nucleotide is made up of a phosphate group

phosphate group phosphate group

phosphate group, a sugar sugar sugar sugar (deoxyribose) and a nitrogenous nitrogenous nitrogenous nitrogenous base

base base

base (Adenine, Thymine, Cytosine and Guanine).

Adenine and Guanine are Puric bases, while Thymine, Citosyne and Uracile (only in ARN) are Pirimidinic bases.

La estructura de la hélice está compuesta sólo por el azúcar (ribosa) y por el grupo fosfato, quedando fuera la base nitrogenada. Estas bases se unen así: A – T y G - C

Las bases nitrogenadas son las que habilitan la unión entre las dos cadenas, ya que establecen su unión mediante puentes de hidrógeno (3 en el caso de la unión T-A y dos en el caso de G-C), lo que hace que ambas cadenas queden pegadas.

Each DNA molecule is formed by two strings, which binds each other thanks to the

hydrogen bonds established between their nitrogenous bases and thus create the

double helix shape. The string itself is just made up of the phosphate group and the

sugar. The union of those bases is: thymine with adenine and cytosine with guanine.

(5)

1.

1.

1.

1.B) How is a protein sy B) How is a protein sy B) How is a protein sy B) How is a protein synt nt nthes nt hes hes hesize ize ized ize d d d from a fragment of DNA? from a fragment of DNA? from a fragment of DNA? Ex from a fragment of DNA? Ex Explain all the steps Ex plain all the steps plain all the steps plain all the steps

Este proceso se conoce como el dogma central de la biología molecular. That process is known as the Central Dogma of molecular biology

¿Pri

¿Pri

¿Pri

¿Primero, qué es una proteína? mero, qué es una proteína? mero, qué es una proteína? mero, qué es una proteína? / First of all, what is a protein? / First of all, what is a protein? / First of all, what is a protein? / First of all, what is a protein?

Las proteínas son biomoléculas de gran tamaño formadas por la unión de moléculas más sencillas llamadas aminoácidos. Estas proteínas son las responsables de las funciones celulares y de los rasgos propios de cada individuo (fenotipo). Existen veinte tipos de aminoácidos diferentes que se unen formando cadenas, con diferentes

números de aminoácidos, y que dan lugar a diferentes tipos de proteínas. Este proceso ocurre en los ribosomas. Una vez que la secuencia linear de aminoácidos está formada, se pliega sobre sí misma y la proteína obtiene su configuración tridimensional

característica. Cada proteína tiene su propia función y se diferencian por el orden en el que se disponen los aminoácidos en su cadena. La siguiente figura muestra como ejemplo el aminoácido Prolina.

Proteins are big sized molecules made up of amino acids. These proteins are responsible of the cell’s function and give the unique feature to each living being (phenotype). There are twenty different amino acids that are joined together creating a linear sequence of amino acids. That process occurs in the ribosome. Once the protein has all his amino acids, it gets folds and bends until it gets its 3D configuration. Each protein has its own function and they are different due to the amino acid’s order.

(6)

¿Cuál es el punto de partida? /

¿Cuál es el punto de partida? /

¿Cuál es el punto de partida? /

¿Cuál es el punto de partida? / What What What What is is is is the start

the start the start

the starting point? ing point? ing point? ing point?

Todo empieza en el ADN, que tiene la información necesaria para producir la proteína. Este ADN se localiza en el núcleo de la célula, organizado dentro de los cromosomas (los humanos tenemos 23 pares de cromosomas). Cada célula contiene la misma información genética que el resto y el ADN se duplica antes de que cada célula se divida (proceso llamado replicación replicación replicación replicación)

It all starts with the DNA because it has the information needed to build the protein. DNA molecule is located in the

cell’s nucleus, organized into chromosomes (humans have 23 pairs of chromosomes).

Every cell must contain the same genetic information and the DNA is duplicated before each cell divides (this process is called “replication”).

Cuando se necesita sintetizar proteínas, el gen correspondiente es transcrito a formato ARN (proceso conocido como transcripción transcripción transcripción transcripción). En primer lugar, el ARN es procesado de forma que se eliminan las partes no codificantes o intrones y luego es transportado fuera del núcleo. Una vez en el citoplasma, las proteínas son construidas según la secuencia del ARN (traducción traducción traducción traducción).

When proteins are needed, the corresponding genes are transcribed into RNA

(transcription). The RNA is first processed so that non-coding parts (introns) are

removed (processing) and is then transported out of the nucleus (transport). Outside

the nucleus, the proteins are built based upon the code in the RNA (translation).

(7)

Tomemos esta secuencia de ADN como ejemplo:

GCAUGCUGCGAAACUUUGGCUGA

Podemos separar la secuencia en codones (tripleta de aminoácidos que codifica para un aminoácido) de tres formas diferentes:

1. GCA UGC UGC GAA ACU UUG GCU GA 2. G CAU GCU GCG AAA CUU UGG CUG A 3. GC A A AUG A UG UG UG CUG CGA AAC UUU GGC UGA

¿Cómo podemos saber qué pauta de lectura es la correcta de las tres?

Todas las regiones que codifican para proteínas empiezan con la misma secuencia:

AUG, codón que codifica para el aminoácido Metionina (Met). Por lo tanto, la pauta de lectura correcta deberá contener el codón AUG. (en el ejemplo, la buena es la tercera)

Del mismo modo que hay una señal para el inicio, hay otra para la finalización de la lectura, y esta se produce con los codones: UAA, UAG y UGA. Estos se conocen como codones STOP y determinan la finalización de la síntesis de la proteína.

We understand the protein-coding sequence of a gene as a sentence made up entirely of 3-letter words. In the sequence, each 3-letter word is a codon, specifying a single amino acid in a protein. Have a look at this sentence:

Thesunwashotbuttheoldmandidnotgethishat.

Thesunwashotbuttheoldmandidnotgethishat. Thesunwashotbuttheoldmandidnotgethishat.

Thesunwashotbuttheoldmandidnotgethishat.

If you were to split this sentence into individual 3-letter words, you would probably read it like this:

The sun was hot but the old man did not get his hat.

The sun was hot but the old man did not get his hat.

The sun was hot but the old man did not get his hat.

The sun was hot but the old man did not get his hat.

This sentence represents a gene. Each letter corresponds to a nucleotide base, and each word represents a codon. What if you shifted the "reading frame?" You would end up with:

T hes unw ash otb utt heo ldm and idn otg eth ish at.

T hes unw ash otb utt heo ldm and idn otg eth ish at. T hes unw ash otb utt heo ldm and idn otg eth ish at.

T hes unw ash otb utt heo ldm and idn otg eth ish at. Or

Th esu nwa sho tbu tth eol dma ndi dno tge thi sha t.

Th esu nwa sho tbu tth eol dma ndi dno tge thi sha t. Th esu nwa sho tbu tth eol dma ndi dno tge thi sha t.

Th esu nwa sho tbu tth eol dma ndi dno tge thi sha t.

As you can see, only one of these reading frames translates into an

understandable sentence. In the same way, only one reading frame within a gene codes for the correct protein.

Think about it…

(8)

Take this DNA sequence as an example:

GCAUGCUGCGAAACUUUGGCUGA

You can separate the sequence into 3-letter codons (each codon corresponds to a specific amino acid), in 3 different ways:

4. GCA UGC UGC GAA ACU UUG GCU GA 5. G CAU GCU GCG AAA CUU UGG CUG A 6. GC AUG AUG AUG CUG CGA AAC UUU GGC UGA AUG

How can you tell which reading frames is the correct one?

All protein-coding regions begin with the sequence "AUG," which encodes the amino acid methionine (Met). Therefore, the correct reading frame will contain the codon

"AUG."

The same way we can also predict the end of a protein by finding one of these three codons: UAA, UAG and UGA they are known as STOP codons because they are the end of the amino acid chain.

How How How

How can can can we can we we predict the amino acid sequence of we predict the amino acid sequence of predict the amino acid sequence of predict the amino acid sequence of a a a a protein protein protein???? protein

Simple question, use the Universal Genetic Code. It is the instruction manual that all cells use to read the DNA sequence of a gene and build a corresponding protein.

Proteins are made of amino acids that are fixed together in a chain. Each 3-letter DNA sequence, or codon, encodes a specific

amino acid.

The code has several key features:

 All protein-coding regions begin with the "start" codon, AUG.

 There are three "stop" codons that mark the end of the protein- coding region.

 Multiple codons can code for the same amino acid.

(9)

1.C) What type of mutations can we find according to where they are produced (gene 1.C) What type of mutations can we find according to where they are produced (gene 1.C) What type of mutations can we find according to where they are produced (gene 1.C) What type of mutations can we find according to where they are produced (gene or chromosome)

or chromosome) or chromosome) or chromosome)

Una mutación es un proceso que produce un cambio permanente en la secuencia de ADN. Cambiando la secuencia de ADN también se puede cambiar la secuencia de aminoácidos de la proteína que se codifica. Distinguimos entre mutaciones génicas (afectan a un solo gen) o cromosómicas (afectan al cromosoma)

Mutation is a process that makes a permanent change in a DNA sequence. Changing a gene's DNA sequence can change the amino acid sequence of the protein it codes for.

We distinguish between genic mutations and chromosomal mutations.

1.c.1 1.c.1 1.c.1

1.c.1- - - - Tipos de mutaciones Génicas Tipos de mutaciones Génicas Tipos de mutaciones Génicas Tipos de mutaciones Génicas

Encontramos las sustituciones, las inserciones y las delecciones.

Sustituciones Sustituciones Sustituciones

Sustituciones: Consiste en el cambio de base de una secuencia nucleotídica.

Diferenciamos entre:

Neutra o silenciosa: puede ser porque el cambio de base no implica cambio en el aminoácido (hay aminoácidos que están codificados por codones diferentes) o

simplemente el cambio de aminoácido que provoca la mutación no implica un cambio estructural en la proteína, por lo que no le afecta a su funcionamiento normal.

De sentido erróneo: Son las sustituciones que generan el cambio de un aminoácido y que en general alteran la funcionalidad de la proteína codificada originalmente.

Sin sentido: crean un codón de stop o codón sin sentido (UAA, UAG y UGA), ocasionando una proteína más corta de lo normal

Point Mutations Point Mutations Point Mutations

Point Mutations: They are single base changes in a gene's DNA sequence. They can be further categorized:

Silent mutations do not cause amino acid changes.

Missense mutations cause a single amino acid change within the protein.

Nonsense mutations create a premature "stop" codon, causing the protein to be

shortened.

(10)

Inserciones y delecciones Inserciones y delecciones Inserciones y delecciones Inserciones y delecciones

Consisten en añadir (inserción) o eliminar (delección) de una o más bases nucleotídicas en el fragmento de AND. A menos que la mutación afecte a

tres bases seguidas, estas conllevan el cambio de la pauta de lectura de un gen, cambiando consecuentemente el agrupamiento de las bases dentro del codón. Estas mutaciones suelen afectar de forma importante a la secuencia de aminoácidos de la proteína sintetizada.

Insertion and Deletion Mutations Insertion and Deletion Mutations Insertion and Deletion Mutations Insertion and Deletion Mutations

Insertion mutations and deletion mutations add or remove one or more DNA bases. Insertions and deletions (unless they happen in multiples of 3) can shift the reading frame of a gene, changing the grouping of bases into codons.

Also called frameshift mutations, these changes can greatly affect a protein's amino acid sequence.

1.c.2 1.c.2 1.c.2

1.c.2- - - - Mutaciones cromosómicas Mutaciones cromosómicas Mutaciones cromosómicas Mutaciones cromosómicas

Una mutación cromosómica es un cambio impredecible en un cromosoma. Su causa puede ser de origen natural (resultado de un problema ocurrido durante la meiosis) o bien provocado por un agente mutagénico (sustancias químicas, radiación, etc.).

A chromosome mutation is an unpredictable change in a chromosome. They are the result of any problems that occur during meiosis (cell division process of gametes) or by mutagens (chemicals, radiation, etc.).

Encontramos dos tipos de mutaciones cromosómicas. There are two types of chromosomal mutations:

Mutaciones cromosómicas Mutaciones cromosómicas Mutaciones cromosómicas

Mutaciones cromosómicas numéricas: numéricas: numéricas: numéricas:

Aneuploidía: el individuo tiene un número anormal de cromosomas, debido a

problemas durante la meiosis. Por ejemplo, trisomía en el 21 (S. Down)

(11)

Poliploidía: Resulta en un cambio en el número de pares cromosómicos, pudiendo ser haploidía (se pierde uno: 2n - 1), triploidía (2n + 1), tetraploidía (2n +2)

Mutaciones cromosómicas estructurales Mutaciones cromosómicas estructurales Mutaciones cromosómicas estructurales Mutaciones cromosómicas estructurales

Son alteraciones en la estructura del cromosoma, por lo que afecta a la producción de las proteínas, ya que los genes cambian o pierden su lugar normal en el cromosoma.



Duplicación: Se duplica un fragmento de un cromosoma



Delección: Se produce la pérdida de un fragmento de un cromosoma



Inversión: Se produce un cambio en la secuencia lineal de los genes de un cromosoma



Translocación: Hay un intercambio o transferencia de fragmentos cromosómicos entre cromosomas no homólogos (es decir, que no son del mismo par de cromosomas).

1.D) What are the implications of the work done by Gregor Mendel?

1.D) What are the implications of the work done by Gregor Mendel?

1.D) What are the implications of the work done by Gregor Mendel?

1.D) What are the implications of the work done by Gregor Mendel?

Gregor Mendel fue un monje cuyo trabajo fue la base para todos los descubrimientos en el mecanismo de la herencia de caracteres. Experimentó con la planta del guisante, cruzándola, cruzando diferentes semillas y anotando las características de la siguiente generación de plantas. Una vez hubo cruzado también a los individuos de la

descendencia (Generación F2), realizó algunas conclusiones y enunció sus tres leyes:

1- Uniformidad de la primera generación 2- Principio de segregación de alelos

3- Ley de la transmisión independiente de caracteres

Gregor Mendel was a monk whose work was the basis of all the discoveries on the mechanisms of trait inheritance. He experimented with the pea plant, by crossing different pea plant seeds and recording what characteristics the next generation had.

After crossing the offspring too, he made some conclusions and enunciated his three laws:

1- Act of Uniformity of hybrids of the first generation 2- Law of segregation of alleles

3- Law of the independence of non-antagonistic characters".

(12)

1 1

1 1- - - - Uniformidad de la primera generación Uniformidad de la primera generación Uniformidad de la primera generación Uniformidad de la primera generación

Cuando se cruzan dos variedades homocigóticas para un carácter, todos los descendientes de la primera generación filial son híbridos e iguales entre sí.

When crossing two pure lines for a trait, every descendent of the first generation are hybrid individuals and alike.

2 2 2

2- - - Principio de segregación de alelos - Principio de segregación de alelos Principio de segregación de alelos Principio de segregación de alelos

Según La ley de la segregación, Mendel establece que hay caracteres (también llamados factores hereditarios) dominantes y recesivos que son pasados de forma aleatoria a la siguiente generación.

According to the Law of Segregation, he established that there are dominant and

recessive traits passed on randomly from parents to offspring.

(13)

3 3

3 3- - - - Ley de la transmisión independiente de caracteres Ley de la transmisión independiente de caracteres Ley de la transmisión independiente de caracteres Ley de la transmisión independiente de caracteres

Con la ley de la transmisión independiente concluyó que dos caracteres pueden ser pasados de forma independiente unos de otros a la descendencia. With the Law of Independent Assortment, Mendel established that two traits were passed on independently of other traits from parent to offspring.

Ejemplo: Cruzó dos líneas puras para dos caracteres, plantas con semillas amarillas y lisas (caracteres dominantes) con plantas con semillas verdes y rugosas (caracteres recesivos). En la primera generación obtuvo descendientes con los caracteres

dominantes: solo consiguió individuos amarillos y lisos. Pero al cruzar entre sí estos descendientes pudo comprobar que los caracteres recesivos de la otra línea pura aparecían en la segunda generación filial o F2 en la proporción 9:3:3:1.

El trabajo de Mendel implicó (no en su día, sino años más tarde) una nueva dimensión en la teoría de la herencia de caracteres. El supuso, según las conclusiones de su estudio, que los caracteres de la madre o del padre no surgen espontáneamente en la descendencia, sino que son pasados de padres a hijos aunque los padres no los presenten. Esto le llevó a la conclusión de que estos caracteres podían ser expresados o no, pero que ya estaban “dentro” de cada individuo. Hoy día, sabemos que esto es así ya que cada gen tiene dos “versiones” de sí mismo (los alelos, uno del padre y otro de la madre) y que estos pueden ser dominantes o recesivos. La herencia de estos caracteres dominantes o recesivos obedece simples leyes estadísticas.

Mendel´s work had a relevant impact some years later about the inheritance theory of

traits. After examining the results of his crossing experiment, he deduced that many

maternal and paternal traits do not "merge" in the offspring, but are instead passed

intact; that some of these characteristics are dominant while other characteristics are

recessive; and that the inheritance of such traits obeys simple statistical laws

(14)

2.

2.

2.

2.- - - - Human Genome Project: Human Genome Project: Human Genome Project: Human Genome Project:

The goal of the Human Genome Project is to create maps showing where genes are located on human genes.

a. Period of time: 3 stages (13 years)



1990 - 95



1993 - 98



1998 - 2003

b. Budget: HGP ended up with a final cost of $2.7 billion, $300 million under the initial budget $3 billion)

c. How many countries were involved?: there were 18 countries working in the HGP.

USA was the coordinator. The rest of the countries who took place were: Australia, Brazil, Canada, China, Denmark, France, Germany, Israel, Italy, Japan, Korea, Mexico, The Netherlands, Russia, Sweden and United Kingdom.

3. 3.

3. 3.- - - - Genetic engineering: recombinant DNA technology and PCR Genetic engineering: recombinant DNA technology and PCR Genetic engineering: recombinant DNA technology and PCR Genetic engineering: recombinant DNA technology and PCR

Recombinant DNA technology:

It’s a technique that allows to isolate a gene from an organism, and to manipulate it, and to put it in a different organism. The target of this process is that the new organism is able of producing the searched protein.

1. Firstof all, the desired gene must be located in its DNA molecule.

2. Then the genetic material of both cells is isolated.

3. DNA of the human cell is cut with restriction enzymes (also known as molecular scissors). They are capable of finding the right place where the wanted gene is held.

4. This fragment is then joined to a vector that carries that gene to the other organism.

It’s joined by ligase enzymes (molecular glue) allowing the gene to be inserted inside the new host cell.

5. The division of host cells is induced, and that way the cloning of this gene is

produced.

(15)

(En español está en el blog)

PCR Polymerase Chain Reaction:

Esta técnica sirve para amplificar un fragmento de ADN. Consta de tres pasos:



Desnaturalización: calentamiento de la mezcla para separar la doble cadena del ADN.



Hibridación: Se reduce la temperatura para que se unan las bases de ambos recipientes en el sitio donde se encuentra una secuencia.



Elongación: Aumenta la temperatura y se replica las hebras de ADN esto hace que el ADN se extienda.

Es una técnica de biología molecular desarrollada en 1986 por Kary Mullis, cuyo objetivo es obtener un gran número de copias de un fragmento de ADN particular, partiendo de un mínimo; en teoría basta partir de una única copia de ese fragmento original, o molde. Esta tecnología es muy importante necesario para muchas técnicas de identificación de ADN (criminalística, huella genética, test de paternidad,

enfermedades genéticas, clonación de genes, etc.)

It is a biological molecular technique developed by Kary Mullis in 1986, which objective is to obtain a huge number of copies of a particular DNA. This technique is used to amplify a piece of DNA and make easier to identify viruses or bacterium, which is very important in DNA identification techniques (criminology, genetic footprint, fatherhood tests, genetic diseases, genes clonation, etc.)

4.- Create a list of the product created from biotechnology techniques:



Bacteria



Animal and plants



Human beings



Ecosystems 4.1.- Bacteria

Biotechnology industry uses bacterial cells for the production of biological substances

that are useful to human existence, including biofuels, foods, medicines, vaccines,

antibiotics, hormones, enzymes, proteins, and nucleic acids. Other applications have

been industrial, pharmaceutical and food microbiology.

(16)

Biotechnology has produced human hormones such as insulin, enzymes such as streptokinase, and human proteins such as interferon.

4.2.- Animals and plants

Plant Plant Plant

Plant products of biotechnology approved for food use have been modified to contain traits such as:

• Genetically modified crops

• Insect resistance

• Disease resistance

• Herbicide tolerance

• Altered nutritional profile

• Enhanced storage life

Some of the plants used in biotechnology are maize, papaya, cotton, rice, alfalfa, tomatoes and potatoes.

Genes can be introduced into plants by a bacterium Agrobacterium tumefaciens . Using A. tumefaciens , plants have been genetically engineered so that they are resistant to certain pests, herbicides, and diseases.

Some other applications of biotechnology in plants are developments in fields like agriculture, horticulture, food and food-processing, paper, pulp and timber,

pharmaceuticals, medical, phytoremediation, marine applications, non-food uses of plants and industrial crops.

Animal Animal Animal

Animal biotechnology is the use of science and engineering to modify living organisms. The goal is to make products, to improve animals and to develop microorganisms for specific agricultural uses.

Examples of animal biotechnology include creating transgenic animals (animals with one or more genes introduced by human intervention).

Some specific genes can be inserted into some animals to produce different substances of interest, like insulin, grow hormones, enzymes or antibodies.

Another major application of animal biotechnology is the use of animal organs in

humans. Pigs currently are used to supply heart valves for insertion into humans.

(17)

4.3.- Human beings

Escherichia coli bacteria, given a copy of the gene for human insulin, can make insulin.

Gene therapy – altering DNA within cells in an organism to treat or cure a disease – is one of the most promising areas of biotechnology research. New genetic therapies are being developed to treat diseases such as cystic fibrosis, AIDS and cancer.

DNA testing is also used on human fossils to determine how closely related fossil samples are from different geographic locations and geologic areas

4.4.- Environment

Bioremediation, Waste treatment and Pollution prevention are widely used as biotechnology tools.

Environmental engineers use bioremediation in two basic ways. They introduce

nutrients to stimulate the activity of bacteria already present in the soil at a waste site, or add new bacteria to the soil. The bacteria digest the waste at the site and turn it into harmless products. After the bacteria consume the waste materials, they die, and the toxic substance is released from the environment.

Another example is a genetically modified bacteria that degrade petroleum products, using them in cleanup of oil spills or polluted soils.

5.- Research: Not applicable

Referencias

Documento similar

In the preparation of this report, the Venice Commission has relied on the comments of its rapporteurs; its recently adopted Report on Respect for Democracy, Human Rights and the Rule

Once all the potentials are transformed into BTs and pruned, the evaluation algorithms are quite similar to the algorithms that use tables: computation is done using operations for

It is likely that genetic factors also play an important role in TGCT formation, as the estimated heritability, 48.9%, is the third highest among all cancers, and the

We aim to describe the phenotypes of four children with mutations in the SLC19A3 gene, comparing their clinical, biochemical, radiological and genetic data with all of the

The broad “WHO-ICF” perspective on HrWB provided at Figure 1 has a significant implication also for HRQoL. The develop- ment of ICF and its conceptual approach has challenged to

Given the potential to use framing and voices in advertising to promote the use of environmentally responsible products, it is essential to understand the underlying

From the answers to another question included in the questionnaire, we know that 54.6% of respondents think it is positive that the reviews they read are posted

Finally, among the five interacting proteins that are common to the three entities, the presence of HDAC1 and HDAC2 is remarkable since it validates the use of