Detección y caracterización de Salmonella spp. en la cadena productiva porcina

44 

Loading.... (view fulltext now)

Loading....

Loading....

Loading....

Loading....

Texto completo

(1)

Facultad de Ciencias Veterinarias

-UNCPBA-

Detección y caracterización de

Salmonella

spp.

en la cadena productiva porcina

Calvete, Cecilia; Colello, Rocío; Analía Inés Etcheverría

Diciembre, 2015

(2)

Detección y caracterización de

Salmonella

spp. en la cadena

productiva porcina

Tesis de Licenciatura en Tecnología de los Alimentos con Mención en Productos de Origen Animal presentada como parte de los requisitos para optar al título de grado de Licenciado de la alumna: Calvete Piolo, Cecilia.

Director: Lic. en tecnología de los Alimentos, Colello Rocio

Codirector: Med. Veterinaria, Etcheverría, Analía Inés

(3)

DEDICATORIA Y AGRADECIMIENTOS

Agradezco en primer lugar, y principalmente a mi tutora Rocío una gran profesional pero sobretodo una persona hermosa que confió en mí, me ayudó en cada momento donde lo necesité, esta tesis es de ella también. A Analia, mi codirectora por su tiempo, dedicación y sobretodo buena onda.

También agradezco a todo el personal del laboratorio de Inmunoquímica y Biotecnología por permitirme el uso de sus instalaciones y brindarme su ayuda. Por otro lado, agradezco a mi familia que me ayudaron a que hoy sea la persona que soy, y aunque esta tesis me haya costado mucho tiempo me acompañaron siempre, pero especialmente a mi ejemplo a seguir, mi mamá. También agradezco a Matías mi compañero de vida, que estuvo presente durante toda la carrera, me apoyó incondicionalmente y me dió aliento para terminar esta tesis.

A mis amigos de la toda la vida, pero especialmente a mis amigas que me acompañaron durante la vida universitaria: Paz, Lula, Luli F, Luli C, Luz, Belu y Dai y a mis amigos Tenchi y Manza. A cada una de estas personas les debo parte de esta tesis, gracias por acompañarme, en las buenas y en las malas. Y finalmente, un agradecimiento particular a mi perra Frida, que aun no entendiendo me acompañó en cada segundo que escribí esta tesis.

(4)

RESUMEN

Las enfermedades transmitidas por alimentos constituyen, según la Organización Mundial de la Salud (OMS), uno de los problemas de salud más extendidos en el mundo. El género Salmonella es causante de una de las enfermedades bacterianas más reconocidas a nivel mundial por sus numerosos casos de diarrea en humanos, la salmonelosis. Esta enfermedad es considerada una de las zoonosis de mayor prevalencia entre las transmitidas al hombre por alimentos contaminados. Uno de los principales reservorios de Salmonella es el cerdo y la prevalencia en esta especie ha aumentado en los últimos años, relacionado al incremento de la producción porcina a nivel mundial. Durante las operaciones de faena llegan inevitablemente a las superficies de las canales, cepas bacterianas procedentes de la flora intestinal animal debido a un mal manejo de los operarios. Una vigilancia severa en la higiene de los procedimientos de faena, en la posterior transformación y en la comercialización de los productos cárnicos es evidentemente la solución para evitar la posible contaminación. Las fallas sanitarias en la cadena alimentaria contribuyen a la diseminación de Salmonella spp., y es por eso que será necesario el control en cada una de las etapas para poder determinar si la bacteria está presente, ya que sus principales reservorios son los animales de sangre caliente, por lo tanto la principal vía de transmisión del patógeno son los alimentos contaminados y productos derivados de dichos animales. Por esta razón, nos planteamos aislar y caracterizar cepas de Salmonella spp. provenientes de las distintas etapas de producción porcina. Para ello, se tomaron 200 muestras en distintas etapas de la cadena alimentaria porcina en una empresa ubicada en la Provincia de Buenos Aires. Se obtuvo una prevalencia total del 7% y la etapa de boca de expendio fue la de mayor prevalencia.

(5)

ABREVIATURAS

°C gradocentígrado

µl microlitro

ADN ácido desoxirribonucleico

EFSA European Food Safety Authority

ETA Enfermedad transmitida por alimentos

h hora

IPS Isladepatogenecidad

LB Caldo Luria Bertani

LIA agar hierro lisina

m minuto

ml mililitro

mM micromolar

mm milímetro

PCR Reacción en cadena de la polimerasa

pH potencial hidrogeno

Rpm revoluciones por minuto

Spp especies

TSA tripteína agar soja

TSI triple azúcar hierro

(6)

Índice

INTRODUCCIÓN 1

-Salmonella 2

Características generales 2

Taxonomía 2

-Factores de virulencia 3

-Fisiopatogenia 5

Mecanismo de adherencia 5

Mecanismo de invasión 5

-Aspectos clínicos 5

-Reservorios y vías de transmisión 7

Salmonella en la cadena productiva porcina 7

Alimentos implicados 9

-Epidemiología 9

Situación en Argentina 10

-Diagnóstico 11

Técnicas de biología molecular: 12

-Prevención 13

OBJETIVO 15

MATERIALES Y MÉTODOS 16

-Diseño y muestreo 16

-Criadero 16

-Frigorífico 17

Llegada de canales y Desposte: 18

Boca de expendio: 18

Aislamiento de Salmonella spp. 18

Preenriquecimiento en medio líquido no selectivo 18

Enriquecimiento en medios líquidos 18

Siembra en medio sólido 18

Confirmación 19

Pruebas bioquímicas 19

(7)

-Ensayos de PCR y extracción de ADN 19

-Cepas de referencia de Salmonella 19

-Condiciones del ensayo 19

Condiciones de termociclado para invA 20

Primers” empleados y tamaño de fragmentos amplificados 20

RESULTADOS 21

Prevalencia total de Salmonella spp. 21

Aislamiento 21

Criadero 22

Frigorífico 22

Llegada de canales y desposte 22

Boca de expendio 22

DISCUSIÓN 23

CONCLUSIÓN 28

(8)

1

INTRODUCCIÓN

Según la Organización Mundial de la Salud (OMS), la inocuidad es la garantía de que un alimento no causará daño al consumidor cuando el mismo sea preparado o ingerido de acuerdo con el uso a que se destine. Como consecuencia de una mala medida que involucre la inocuidad, pueden surgir las Enfermedades Transmitidas por los Alimentos (ETA) (Grupo DELCEN, 2009).

Las ETA están definidas como el conjunto de síntomas y signos causados por el consumo de alimentos, que posean agentes patógenos o sustancias tóxicas y afecten la salud de una persona o grupo de personas, de manera aguda o crónica. De acuerdo a la OMS, las ETA son consideradas uno de los problemas más importantes en lo que a salud respecta en países en desarrollo como así también en países desarrollados, siendo la contaminación biológica la de mayor relevancia (Leotta et al., 2010).

Se las puede clasificar de la siguiente manera:

- Intoxicación causada por alimentos

- Infección transmitida por alimentos

- Toxiinfección transmitida por alimentos (ANMAT, 2011).

(9)

2

-Salmonella

Características generales

El género Salmonella pertenece a la familia Enterobacteriaceae. Son bacilos gran negativos de 0.7-1.5 x 2-5 µm, anaerobios facultativos, no formadores de esporas, generalmente móviles por flagelos periticos (Figura 1). Las colonias generalmente tienen de 2-4 mm de diámetro (Bergey, 2010).

Las especies de Salmonella son quimioorganótrofas, con la capacidad de metabolizar nutrientes por las vías fermentativas y respiratorias. Crecen de manera óptima a 37°C. Utilizan la glucosa con producción de gas, son indol negativo. El citrato es utilizado como única fuente de carbono y a su vez son lisina y ornitina descarboxilasa positivos y ureasa negativos. Los compuestos fenilalanina y triptófano no son oxidativamente desaminados. Pueden crecer en medios peptonados o extracto de carne y en particular en medios selectivos como el agar Mc Conkey. Reducen los nitratos a nitritos y su contenido guanina-citocina es de un 39-59% (Bergey´s, 2005).

Figura 1: Esta ilustración representa una imagen tridimensional de Salmonella Typhi (CDC, 2014)

Taxonomía

(10)

3 subesp. enterica, Salmonella enterica subesp. salamae, Salmonella enterica subesp. arizonae, Salmonella enterica subesp. diarizonae, Salmonella enterica subesp. houtenae y Salmonella enterica subesp. indica. Las serovariedades pertenecientes a las subespecies restantes y a Salmonella bongori, son de baja incidencia en enfermedades en humanos y animales, se designan con el nombre de la subespecie, seguido de la formula antigénica. Como las serovariedades no tienen nivel taxonómico de especies, sus nombres no siguen las reglas del “International Code of Nomenclature of Bacteria” de

manera que, sus nombres se deben escribir con letra romana (no itálica) y con mayúscula. Por ejemplo el nombre completo de Salmonella Typhimurium es Salmonella entérica subespecie entérica serovariedad Typhimurium, al ser tan largo se lo suele acortar a Salmonella Typhimurium (Caffer et al., 2008).

La serotipificación es un método utilizado para diferenciar cepas de Salmonella más allá del nivel de subespecie. Los serotipos de Salmonella son designados sobre la base de dos estructuras de la superficie celular, los antígenos O y H (CDC, 2011).

Con importancia clínico epidemiológica, las más de 2500 serovariedades de Salmonella pueden agruparse en tres divisiones ecológicas:

Salmonella spp. adaptadas a vivir en el ser humano como S. Typhi, S. paratyphi A, B y C.

Salmonella spp. adaptadas a hospedadores no humanos, que circunstancialmente pueden producir infección en el hombre como S. dublin y S. choleraeusuis.

Salmonella spp. sin adaptación especifica de hospederos que incluye 1800 serovariedades (Melara Cruz y Salazar Artigas, 2012).

-Factores de virulencia

La estrategia patogénica de Salmonella incluye la invasión de la barrera intestinal y la interacción con células del sistema inmune donde actúa como parásito intracelular (Sánchez Jiménez y Cardona Castro, 2003)

Se pueden distinguir dos grupos de factores de virulencia:

(11)

4 flagelos que dirigen a la bacteria hacia el epitelio y contribuyen a la inflamación; la cápsula, relacionada con la capacidad invasiva y las fimbrias.

- Genes de virulencia localizados en el cromosoma o en plásmidos que codifican factores y modifican la fisiología celular del hospedador o protegen a la bacteria de los sistemas antimicrobianos del mismo. Estos genes pueden estar libres formando pequeñas agrupaciones (islotes) y/o en agrupaciones mayores (islas de patogenecidad) (Martínez Álvarez, 2007).

Las Islas de patogenecidad (IPS) son largas agrupaciones de genes que contribuyen a un determinado fenotipo de virulencia, que generalmente se manifiesta en momentos claves del proceso infectivo. Existen diferentes tipos de IPS, tales como IPS1, IPS2, IPS3, IPS4 y IPS5 (Gutierrez Castillo et al., 2008).

IPS 1 es una de las más caracterizadas, se trata de una inserción de 40 kb en el cromosoma bacteriano que presenta un contenido bajo de G-C. A su vez, contiene al menos 29 genes que codifican los componentes estructurales de un sistema de secreción tipo III (invA, invH y pqrH), proteínas que forman un poro (translocón) (sipB, sipC), algunas proteínas efectoras (spt, genes sip) y proteínas reguladoras (hila). Los sistemas de secreción tipo III son un grupo de estructuras especializadas de las bacterias Gram negativas, cuya finalidad es la de introducir al citosol de las células eucariotas proteínas efectoras que desequilibran la función celular. Salmonella es la única especie que tiene dos sistemas de secreción tipo III codificados por dos islas de patogenecidad distintas, IPS1 (implicado en la penetración inicial) y IPS2 (implicado en los siguientes estadios de la infección) (Parra et al., 2002).

(12)

5

-Fisiopatogenia

Mecanismo de adherencia

La supervivencia de un microorganismo en un huésped determinado está directamente relacionada con su habilidad para adherirse, las adhesinas de la bacteria poseen una estructura que les permite reconocer moléculas presentes en las células del hospedero, que se denominan receptores.

En general las bacterias Gram negativas poseen adhesinas características: fimbria, fibrilla, flagelo. La presencia de cápsula y flagelo en Salmonella depende exclusivamente de la especie, sólo S. enterica serovar Typhi, S. enterica serovar Paratyphi C y S. enterica serovar Dublin presentan cápsula y todas las salmonelas se consideran móviles a excepción de S. enterica serovar Gallinarum. Luego de la entrada al huésped, la bacteria puede adherirse a la superficie de la célula hospedadora o a la matriz extracelular. La interacción de un patógeno con una célula hospedera usualmente provoca la activación de caminos de señalización en la célula hospedera, ya sea de manera directa por componentes bacterianos o por estimulación de factores activadores del hospedero, como las citocinas inflamatorias (Figueroa Ochoa y Verdugo Rodríguez, 2005).

Mecanismo de invasión

Las interacciones entre especies de Salmonella y células hospedadoras son íntimas y complejas. Esta bacteria es hábil en utilizar las funciones celulares preexistentes del hospedero y usar estas funciones como beneficio propio. Esto se ha visto cuando Salmonella utiliza las señales de transducción del hospedero, lo cual afecta el rearreglo del citoesqueleto y las proteínas superiores de membrana produciendo un fruncido en la membrana y la invasión bacteriana (Sánchez Jiménez y Cardona Castro, 2003).

-Aspectos clínicos

(13)

6 osmolaridad y responde a estos cambios modulando la expresión de sus genes (Figueroa y Rodríguez, 2005).

Salmonella tiene la capacidad de invadir para luego atravesar las distintas barreras o líneas de defensa naturales para finalmente localizarse en el íleon terminal y colon proximal. La primera barrera es la acidez gástrica, aunque este microorganismo tiene la capacidad de adaptarse a esta y lograr sobrevivir a pH 4. Luego de pasar el estómago Salmonella llega al intestino delgado donde interactúa con las células de la pared intestinal. Si las defensas del huésped no logran controlar la infección, Salmonella se disemina a los ganglios linfáticos mesentéricos y luego al hígado y al bazo (Saravia Gomez, 2012).

Los síntomas comienzan a manifestarse entre las 6 y 72 horas después de la infección, generalmente duran de 4 a 6 días y eventualmente causan dolor de cabeza, fiebre, dolor abdominal. Pueden aparecer síntomas dentro de las 3-4 semanas después de los síntomas agudos (Cabrera et al., 2013).

Los enfermos pueden presentar un periodo de convalecencia entre 1 -8 semanas. Las formas clínicas más importantes pueden agruparse en:

- Infecciones asintomáticas agudas - Gastroenteritis aguda

- Bacteriemia con o sin supuración local - Fiebre tifoidea

- Estado de portador crónico asintomático (FAO y WHO, 2002).

Todas las personas son susceptibles a adquirir esta enfermedad aunque hay un grupo más sensible que son los niños, ancianos y los pacientes inmunocomprometidos (Cabrera et al., 2013).

(14)

7

-Reservorios y vías de transmisión

La dosis infectiva mínima de Salmonella spp. es mayor a 100 UFC/g de alimento, por lo tanto para alcanzarla en la mayoría de los casos es necesario un periodo de multiplicación en el alimento antes del consumo (Aliverti, 2012).

La principal vía de transmisión suele ser la fecal-oral, por alimentos y agua contaminada con heces humanas o animales y persona a persona. Normalmente se presenta como casos esporádicos o brotes con número variable de afectados (Organización Panamericana de la Salud, 2008).

Los principales reservorios de Salmonella patógenos para el hombre son los cerdos, bovinos, aves silvestres y de corral, roedores, iguanas, tortugas, perros y gatos (Uribe y Suarez, 2006). Aunque los otros son considerados un riesgo, tales como roedores e insectos. Varios estudios han demostrado que las muestras de heces de roedores pueden tener hasta 105 UFC/g de Salmonella (Dickson et al., 2002).

Salmonella en la cadena productiva porcina

La salmonelosis es una de las enfermedades más frecuentes en el cerdo, estos animales se infectan a través de la ingestión de alimentos o agua contaminados con esta bacteria, o bien por el contacto con animales infectados. En las granjas de terminación de cerdos que se encuentran infectadas, la probabilidad que los cerdos libres de Salmonella se infecten es de aproximadamente 85%. Entre el 5-30% de los animales todavía puede excretar la bacteria al final esa etapa y este porcentaje puede duplicarse durante el transporte y estabulación. Los cerdos que están infectados y van al matadero, contienen en su tracto digestivo y en los ganglios linfáticos Salmonella spp. (Berends et al., 1996).

Durante la carga, transporte y descarga los cerdos están expuestos a diversos factores de estrés (ruido, olores desconocidos, vibraciones, cambios de temperatura y privación de alimentos), que alteran el sistema inmune, por lo que los cerdos infectados podrían liberar más Salmonella que en condiciones normales y los animales sanos se encontrarían más susceptibles a contraer la enfermedad (Dickson et al., 2002).

(15)

8 en los corrales de descanso puede producirse estrés. Estudios revelan que la carga microbiana disminuye notablemente entre animales que han descansado entre 12 y 15 horas comparado con los animales que se los envía a la faena 3 horas después de su llegada al matadero. Desde el punto de vista microbiológico es importante la limpieza y desinfección de los corrales de descanso, ya que disminuye la contaminación entre animales (Sánchez Rodríguez et al., 2009).

Otra etapa importante en la faena de cerdos, es el escaldado, que consiste en contactar la piel con agua a alta temperatura (60-65°C por 5-8 minutos) consiguiendo debilitar la piel y los pelos además de limpiar de manera superficial la canal. A pesar que es una etapa que tiene como finalidad disminuir la contaminación microbiológica, cuando el recambio del agua es insuficiente suelen quedar restos de materia fecal y sangre (Borch et al., 1996).

Por último, una de las etapas más críticas e importantes en esta cadena de producción es el eviscerado, que consiste en la separación de la canal de todas las vísceras, excepto los riñones. Es importante que la evisceración se realice como máximo dentro de los 45 minutos después del noqueo y para impedir que las bacterias patógenas se propaguen a la canal desde los intestinos y para ello, suele circundarse el recto de manera manual o mecánica (Borch et al., 1996).

Se han realizado estudios que muestran que la mejora de la higiene durante la faena tiene un efecto positivo sobre la reducción de Salmonella. La mejora podría consistir en escaldar los cuchillos, aumentar la frecuencia de lavado de manos, realizar la inspección visual de la carne así como la desinfección adecuadamente y mejorar la precisión de la división de la canal (Alban y Sta¨rk, 2005).

(16)

9 La boca de expendio es el lugar donde el consumidor final compra el producto y allí los niveles de contaminación dependerán en gran medida de la calidad de las materias primas y subproductos recibidos. El personal tiene la responsabilidad de asegurar la calidad final, previniendo la contaminación de la carne hasta llegar al consumidor (Dehalle et al., 2009)

Es importante que las condiciones higiénico-sanitarias sean adecuadas para impedir la posible entrada del patógeno a la cadena, dado que las bacterias pueden pasar de un alimento a otro por contacto directo con utensilios, o bien a través de las superficies en contacto con los mismos. Las máquinas, equipos y utensilios deben seguir un programa de limpieza y desinfección para evitar la contaminación cruzada (Leotta et al., 2014).

Alimentos implicados

Cualquier alimento con la posibilidad de contaminarse con materia fecal humana o animal puede ser una potencial fuente de infección de salmonelosis. Por otro lado, errores cometidos durante el manejo en la cadena alimentaria transforman e incrementan el riesgo potencial de multiplicación bacteriana.

Los huevos y la carne de pollo constituyen el origen principal de los casos de salmonelosis en el hombre. Sin embargo, existe una marcada tendencia en los últimos años en relación al aumento de casos de salmonelosis humana como consecuencia del consumo de carne de cerdo como fuente de infección (García Feliz, 2011).

-Epidemiología

Existe una gran cantidad de animales vivos que contienen Salmonella en el tracto intestinal, es por eso que los subproductos del matadero pueden estar altamente contaminados y debido a que la bacteria posee una gran capacidad de sobrevivir durante mucho tiempo, este tipo de alimentos suele ser una de las principales fuentes de contaminación (Parra et al., 2002).

La Autoridad Europea de Seguridad Alimentaria (EFSA), publicó en 2009 una encuesta sobre prevalencia de Salmonella en granja de cerdos en la Unión Europea durante el 2008. Salmonella se detecta en un 31,8% en las explotaciones de los diferentes Estados miembros (EFSA, 2009).

(17)

10 incubación y los síntomas. Entre 1995 y 1998, en Sudamérica, Salmonella fue la responsable del 36.8% de los brotes asociados a enfermedades de origen alimentario (FAO y WHO, 2002). En la unión Europea, el cerdo es la mayor fuente de salmonelosis humana, en el año 2006 sus miembros reportaron 34,6 casos de esta enfermedad por cada 100.000 habitantes. Entre los años 2000 y 2009, el Laboratorio Nacional de Referencia alemán de Salmonella recibió un promedio de 100 cepas de S. Derby, de estos el 34% fueron aislados en el cerdo de pie y el 17% de carne de cerdo (Delhalle et al., 2009; Hauser et al., 2011). En un trabajo realizado en Colombia se demostró que un 37% de las canales porcinas eran positivas a Salmonella spp. con una prevalencia del 27.2% (en 156 canales) (Moreno Andrade, 2012). En un estudio realizado en Rumania se aislaron 149 cepas de Salmonella, lo que representaba un 22.9% de las muestras analizadas, 48 de ellas procedían de muestras de carne de cerdo (32.21%) (Mihaiu et al., 2014). Por otro lado en China, se estima que aproximadamente el 20.9% de los casos de ETA fueron causados por Salmonella, dentro de las cuales la carne de cerdo y vacuna han sido las fuentes más importantes (Yang et al., 2010). Según estudios realizados en los Estados Unidos, entre el 6-9% de los casos de salmonelosis corresponden a la carne de cerdo como fuente de infección (García Feliz, 2011). La carne de cerdo ha sido la principal fuente de Salmonelosis humana, registrándose en un 15% de los casos de Dinamarca y Holanda, y más del 25% de los de Estados Unidos (Bean y Griffin, 1990). En Bélgica, la salmonelosis también es la primer causa de ETA, siendo Salmonella Typhimurium el serotipo más aislado. Un estudio belga realizado entre los años 2003 y 2005 indica que los valores de prevalencia de Salmonella en muestras de corte de carne de cerdo fueron de 17.3% y de carne picada del 11.1% (Ghafir y Daube, 2008).

En Holanda entre los años 1988 y 1998, los serotipos de Salmonella asociados al cerdo representaron un 15% de los casos de Salmonelosis humana (Berends et al., 1998).

Situación en Argentina

(18)

11 Epidemiológica (Si. Na. V. E.). El sistema incluye la notificación de casos aislados y desde 1999, también la de los brotes (Di Pietro et al., 2004).

Entre los años 1993 y 2003 ocurrieron 152 brotes de ETA que afectaron a 3309 personas, de las cuales 4 fallecieron, el 33% de los brotes causados por Salmonella spp. se produjeron por el consumo de agua contaminada y el 27% fue debido al consumo de carnes (Aliverti, 2012).

Según el Boletín Epidemiológico Periódico del 2006, las 5 serovariedades más prevalentes durante el periodo 2004-2005 fueron Salmonella Enteritidis (36%), Salmonella Typhimurium (20.5%), Salmonella Infantis (8.7%), Salmonella Vewport (5.3%) y Salmonella Agona (4.9%) (Anselmo y Barrios, 2012).

Los brotes de origen alimentario suelen darse por el consumo de aves de corral, carne de cerdo, productos poco cocidos y la preparación de pasteles, mousse, mayonesa y otros alimentos que utilicen huevos crudos no pasteurizados (Satorres et al., 1998).

-Diagnóstico

Salmonella es la principal causa de brotes de origen alimentario a nivel mundial, por lo tanto, para la seguridad alimentaria, la disponibilidad de información fiable rápida e internacionalmente aceptada para detectar la presencia o ausencia de agentes patógenos trasmitidos por los alimentos es cada vez más trascendental. (Malorny et al., 2003).

Existe un gran número de métodos de diagnóstico diferentes que pueden realizarse para la determinación de Salmonella spp, sin embargo en la mayor parte de estudios realizados, el cultivo microbiológico es la prueba más comúnmente empleada para el aislamiento de la bacteria a partir de tejidos, excrementos, alimentos y agua.

El procedimiento de diagnóstico de Salmonella consiste en aislar la bacteria de las muestras, un proceso que consume trabajo y tiempo por ello, el empleo de técnicas de Biología Molecular que demanden menos tiempo, como la PCR es de suma importancia (Chiu y Ou, 1996; Pachon Cubillos, 2009).

o Medio de preenriquecimiento: el número de Salmonella es normalmente

(19)

12 facilitar el aislamiento. Esto permite que un escaso número de Salmonella se multiplique sin que mueran por efectos tóxicos de los medios de enriquecimiento o se recuperen de daños subletales debidos a la congelación y calentamiento.

o Medios de enriquecimiento: son medios líquidos o semisólidos que

contienen sustancias que permiten el crecimiento selectivo e inhiben el crecimiento de otros microorganismos. Ejemplos de medio selectivos de enriquecimiento son el Tetrationato, Caldo Muller- Kauffman, caldos con Selenito, Rappapor- Vassiliadis.

o Medios selectivos en placa: son medios selectivos solidificados con agar

que permiten un crecimiento diferencial en varios aspectos. Inhiben el crecimiento de bacterias distintas a Salmonella y suministran información sobre algunas de sus principales características bioquímicas diferenciales (incapacidad de fermentar la lactosa y la producción de sulfuro de hidrógeno). Ejemplos de medios selectivos sólidos son el agar verde brillante, el agar xilosalisina-desoxicolato, agar desoxicolato/citrato, agar Rambach, el agar sulfito de bismuto y el Hektoen Enteric Agar(World Organisation for Animal Health, 2008).

o Pruebas bioquímicas: los microorganismos para crecer requieren de

polimerización de proteínas, ácidos nucleicos, polisacáridos y lípidos, estos son elementos que deben encontrarse en el medio o deben ser sintetizados por la misma célula. Como primer screening en la identificación final de Salmonella las muestras se someten a pruebas de reacción bioquímica con el fin de confirmar la presencia de Salmonella. Las principales pruebas bioquímicas que se realizan son: TSI (triple azúcar hierro) y LIA (agar lisina hierro) (Pachon Cubillos, 2009).

Técnicas de biología molecular

:

(20)

13 técnica simula lo que pasaría en la célula cuando se sintetiza el ADN, es por eso que suele mezclarse en el tubo la enzima, el ADN blanco del organismo que se quiere sintetizar, los oligonucleótidos (primers o cebadores), dinucleótidos y a su vez mantener las condiciones necesarias para la taq polimerasa (pH, MgCl2, KCl) (Espinosa Asuar, 2007).

Cada ciclo de la PCR se lleva a cabo en tres etapas principales: desnaturalización, alineamiento o hibridación y extensión.

 Desnaturalización: en esta etapa las cadenas de ADN son calentadas y

separadas a una temperatura de 95°C durante 20-30 segundos. Los puentes se rompen dejando al ADN en forma de cadena simple permitiendo así exponer las diferentes bases nitrogenadas para la hibridación con los primers.

 Alineamiento: en esta etapa los primers se alinean al extremo 3´del ADN

previamente separado e hibridan con su secuencia complementaria. Para que se forme el complejo templado-primers es importante que la temperatura de hibridación sea la óptima, esta generalmente oscila entre 50-60°C. En esta etapa, ambas cadenas originales del ADN sirven simultáneamente como moldes para sintetizar sus respectivas cadenas complementarias nuevas.

 Extensión: en esta etapa la taq polimerasa actúa sobre el complejo templado-primers y empieza su función catalítica a una velocidad muy rápida, agrega dNTP´s complementarios para crear las cadenas completas de ADN. Esta etapa debe realizarse a una temperatura alta, que es coincidente con la de máxima actividad de la polimerasa (72°) para evitar alineamientos inespecíficos de los primers (Rodríguez Sánchez y Barrera Saldaña, 2004; Tamay de Dios et al., 2013).

-Prevención

(21)

14 humanas deben involucrar todas las etapas de producción de los alimentos “desde la granja a la mesa”. (Aliverti, 2012).

Todos los procedimientos involucrados en la faena deben estar dirigidos a la eliminación de las bacterias. Por otro lado, los mataderos pueden disminuir la prevalencia de patógenos mediantes la realización de operaciones que reduzcan la contaminación. En otras palabras, los establecimientos pueden reducir el nivel de contaminación mediante, por ejemplo, la adecuada separación de canales, limpieza de rutina, desinfección de equipos y herramientas de mano (Food Safety and Inspection Service, 2014).

Las medidas preventivas para controlar la transmisión de la infección en el hogar tienen tres aspectos importantes: manipulación higiénica de los alimentos, cocción a una temperatura suficiente y refrigeración de los alimentos preparados tras su elaboración rápidamente. En cuanto a la manipulación higiénica de los alimentos deberá lavarse las manos con frecuencia y en particular luego de tocar alimentos crudos, se deberá también limpiar y desinfectar las superficies y utensilios luego de haberlos utilizado en la manipulación de alimentos crudos. Por otro lado los alimentos deberán ser cocidos a una temperatura suficiente para que en su interior alcancen los 70°C, siendo ésta la temperatura necesaria para destruir la Salmonella y otros posibles microorganismos (Ministerio de Salud, 2012).

(22)

15

OBJETIVO

(23)

16

MATERIALES Y MÉTODOS

-Diseño y muestreo

Se tomaron muestras en empresa ubicada en la provincia de Buenos Aires que posee el siguiente diagrama:

Una de las empresas cuenta con el frigorífico que incluye el desposte y en la otra empresa la sala de desposte esta físicamente separada del frigorífico, en donde las canales son transportadas en un camión refrigerado propio de la empresa.

-

Criadero

:

Hisopado rectal: Las muestras se tomaron por hisopado rectal para cada una de las categorías.

Criadero

Madres gestación 10

Madres lactancia 10

Lechones lactancia 10

Destete y recría 10

Desarrollo y terminación

20 CRIADERO

FRIGORÍFICO

LLEGADA DE CANALES Y DESPOSTE

(24)

17

Total 60

Se tomaron 21 muestras de medio ambiente de la granja que incluía materia fecal del piso, alimento y agua de todas las categorías

Cálculo estadístico del tamaño muestreal

Se consideró el escenario más desfavorable, suponiendo proporción de positivos utilizando la expresión:

Dónde:

N; tamaño de muestra

Z(1-alfa): valor de la distribución normal para in nivel de confianza del 95%

P: proporción supuesta (proporción encontrada en el muestro exploratorio)

D: certeza o precisión (1,2,5%)

Ajuste por tamaño muestreal por categoría

-Frigorífico

Se tomaron muestras mediante hisopados de canales e instalaciones (corral de espera de animales y superficies de contacto de los animales faenados) según Circular 3579 de SENASA y el Reglamento (CE) Nº 2073/2005 de la Comisión de 15 de noviembre de 2005 relativo a los criterios microbiológicos aplicables a los productos alimenticios (Diario Oficial de la Unión Europea L 338/1).

N

n

n

n

'

1

'

(25)

18

-

Llegada de canales y Desposte:

Se tomaron muestras mediante hisopados de canales, cortes de carnes e instalaciones (bandejas, cuchillos, mesadas y maquinarias para desposte y elaboración) según Circular 3579 de SENASA y el Reglamento (CE) Nº 2073/2005 de la Comisión de 15 de noviembre de 2005 relativo a los criterios microbiológicos aplicables a los productos alimenticios (Diario Oficial de la Unión Europea L 338/1).

Boca de expendio:

Se tomaron muestras mediante hisopos de instalaciones, utensilios, cortes de carne fresca, carne picada y productos finales (fiambres, embutidos secos y frescos, entre otros) según Circular 3579 de SENASA y Reglamento (CE) Nº 2073/2005 de la Comisión de 15 de noviembre de 2005 relativo a los criterios microbiológicos aplicables a los productos alimenticios (Diario Oficial de la Unión Europea L 338/1.

Aislamiento de Salmonella spp.

Para el aislamiento de Salmonella se utilizó la Norma ISO 6579:2002 con modificaciones que consta de cuatro etapas sucesivas: I- preeriqueciemiento en medio líquido no selectivo, II- enriquecimiento en un medio líquido selectivo, III- siembra en medios sólidos e identificación y IV- confirmación

Preenriquecimiento en medio líquido no selectivo

Los hisopos y/o los 25 g de cada muestra se colocaron en 225 ml de caldo LB y se incubaron a 37°C durante 18 h.

Enriquecimiento en medios líquidos

A partir del caldo LB se inoculó 0,1 ml en 10 ml de caldo RV (Rappaport-Vassiliadis) y 1 ml en caldo TT (Tetrationato). Se incubó el RV a 42ºC durante 24 h, y el caldo TT a 37ºC durante 24 h.

Siembra en medio sólido

(26)

19

Confirmación

Se tomaron de cada placa 3 o 4 colonias presuntivas a Salmonella, confirmándose estas mediante pruebas bioquímicas básicas y ensayos de PCR.

Pruebas bioquímicas

- Agar TSI (Agar hierro tres azúcares): Se estrió la superficie en pico de flauta y punzado el fondo, se incubó a 37ºC durante 24 h. Las colonias presuntivas a Salmonella son alcalino/ácido con o sin formación de gas (K/A).

- Agar LIA (Agar lisina hierro): Se estrió la superficie en pico de flauta y punzado el fondo, se incubó a 37ºC durante 24 h. Las colonias presuntivas a Salmonella son alcalino/alcalino (K/K).

Amplificación por PCR

-Ensayos de PCR y extracción de ADN

Las colonias presuntivas a Salmonella seleccionadas por resultados de las pruebas bioquímicas se sembraron en agar TSA y se incubaron a 24h a 37ºC. Se tomaron 3 colonias y se colocaron en 500 µl de agua bidestilada. Llevándose a ebullición durante 20 minutos para extracción de ADN. Posteriormente se caracterizaron mediante la técnica PCR detectándose el gen invA.

-Cepas de referencia de Salmonella

Para la detección de factores de virulencia de Salmonella (invA) se utilizó la siguiente cepa de referencia:

- Salmonella dublin (invA+) Provenientes del laboratorio de Microbiología experimental de la del Laboratorio de Inmunoquímica y Biotecnología de la Fac. Cs. Vet. UNCPBA.

-Condiciones del ensayo

El cóctel de reacción de PCR se realizó en una solución de KCl 50mM, Tris-HCl 10 mM pH 9, Tritón X-100 al 0,1%, MgCl2 2mM, 0,01% de gelatina, 0,2

(27)

20 La presencia del gen invA se determinó según metodología descripta por Rahn et al. 1992.

Condiciones de termociclado para invA

Temperatura y tiempo inicial: 94ºC 10min.

94ºC 1 min.

ciclos 2 a 30 60ºC 1 min.

72ºC 2 min.

Temperatura y tiempo final: 72ºC 10min.

Primers” empleados y tamaño de fragmentos amplificados

Gen “primer”(5’–3’) Tamaño del amplímero Bibliografía

invA S141: TCATCGCACCGTCAAAGGAACC 284 pb Rahn et al., 1992

S139: GTGAAATTATCGCCACGTTCGGGCAA

La reacción de PCR se efectuó en dos cicladores térmicos programables: T-17 Ivema y Multigene Optimax. Los productos de la reacción se analizaron por electroforesis en un gel de agarosa al 2% en presencia de bromuro de etidio.

(28)

21

RESULTADOS

Prevalencia total de Salmonella spp.

De 200 muestras, 14 (7%) fueron positivos. El número y porcentaje de prevalencia de toda la cadena productiva porcina se describe en la tabla 1.

n total=200

Origen Muestras

procesadas

Muestras

positivas

Prevalencia

(%)

Criadero 81 3 3,37

Frigorífico 28 0 0

Llegada de canales y

desposte 61 6 9,83

Boca de expendio 30 5 16,66

Total 200 14 7%

Tabla 1: Distribución de Salmonella según origen.

Las prevalencias totales obtenidas en cada lugar de muestreo fueron variables (Gráfico 1) aumentando notoriamente en la llegada de canales y Desposte.

3,37% 0,00% 9,83% 16,66% 0,00% 2,00% 4,00% 6,00% 8,00% 10,00% 12,00% 14,00% 16,00% 18,00%

Criadero Frigorifico Llegada de canales y desposte

Boca de expendio

Grafico 1. Prevalencia Salmonella spp.

Aislamiento

De las 14 muestras positivas a Salmonella, se lograron aislar 24 cepas las cuales presentaron un perfil bioquímico característico (TSI: K/A y LIA: K/K) y se

caracterizaron por PCR detectándose el gen invA en todos los aislamientos

.

A

(29)

22

Criadero

Se obtuvieron tres muestras positivas.

Estas mismas provienen de diferentes etapas del criadero:  Madre en gestación (hisopado rectal).

 Destete y recría (materia fecal).  Alimento de madre en gestación.

Frigorífico

No se obtuvo ningún resultado positivo en esta etapa.

Llegada de canales y desposte

Se obtuvieron seis muestras positivas y doce aislamientos. Estas mismas tienen diferentes orígenes:

 Instalaciones, en el interior de la sierra cortadora de carne: dos muestras y cuatro aislamientos.

 Cuartos: tres muestras positivas y de las cuales se aislaron cinco cepas:

o Trasero externo.

o Trasero interno.

o Delantero externo.

o En el cuarto delantero interno y cabeza no se obtuvieron

resultados positivos.

 Carne: una muestra positiva y tres aislamientos.

Boca de expendio

Se obtuvieron cinco muestras positivas y nueve aislamientos. Estas mismas resultan de diferentes orígenes:

 Chorizo: dos muestras y cuatro aislamientos.  Carne picada: una muestra positiva

(30)

23

DISCUSIÓN

La problemática de la cual surge el desarrollo de este trabajo, tiene su inicio en el Laboratorio de Inmunoquímica y Biotecnología (Departamento de Sanidad Animal y Medicina preventiva de la Universidad Nacional del Centro de la Provincia de Buenos Aires).

Para realizar este trabajo se empleó un método microbiológico. Los métodos tradicionales de detección de Salmonella spp. en alimentos son lentos y laboriosos, están basados en el uso de medios de cultivo selectivos y la posterior caracterización de colonias sospechosas por pruebas bioquímicas y serológicas. Requieren en primer lugar que la bacteria forme una colonia en un medio de cultivo. Estos métodos no implican una inversión económica y un gasto en material excesivo. Sin embargo, se necesita un periodo de incubación prolongado, ya que el microorganismo buscado puede ser minoritario respecto a la flora total y puede estar subletalmente lesionado. El éxito en el aislamiento de Salmonella a partir de alimentos puede estar relacionado a varios factores, tales como el alimento, el número de organismos presentes y el manejo de muestras después de la recolección (Rodríguez et al., 2009).

En este estudio se utilizó para el aislamiento de Salmonella spp. la Norma 6579:2002 con modificaciones. En la bibliografía existen numerosos estudios que comparan distintos medios de selección y aislamiento de Salmonella spp. La mayoría de las serovariedades aisladas en el hombre y animales pertenecen a Salmonella entérica subesp. entérica, poseen características bioquímicas semejantes, lo cual contribuye a su identificación. Sin embargo el serotipo denominado S. typhi, presenta características bioquímicas únicas que lo diferencian de otros serotipos, destacándose un metabolismo muy lento en comparación con los demás y una baja producción de H2S. El surgimiento de

(31)

24 alimentarias (Malorny et al., 2003). La detección de Salmonella spp. a lo largo de la cadena productiva porcina fue estudiada por métodos convencionales de aislamiento hasta un “screening” inicial, cuando las colonias presuntivas a

Salmonella por los medios TSI y LIA fueran positivas, se realizó PCR mediante la detección del gen invA. Este gen es un buen “target” para la detección de este patógeno ya que es común en todas las variedades invasoras y se ha establecido como un estándar internacional adecuado para PCR (Rhan et al., 1992). Los métodos rápidos destinados a la detección, el recuento, la caracterización y la subtipificación de Salmonella permiten obtener resultados de manera sencilla, fiable y en menor tiempo que con los métodos tradicionales. Los factores que justifican la utilización de métodos rápidos e impulsan su desarrollo son numerosos, entre ellos se pueden mencionar las presiones regulatorias, las modernas prácticas de producción y la complejidad analítica (Leotta, 2009).

Se tomaron 200 muestras en una granja productora de cerdos correspondientes a cuatro etapas diferentes: criadero, frigorífico, llegada de canales y desposte y por último boca de expendio. Del total de las muestras analizadas 14 resultaron positivas, con una prevalencia total del 7%.

(32)

25 En el frigorífico, no se obtuvieron muestras positivas. Es evidente que el frigorífico donde se realizó el estudio, implementaba de manera correcta las medidas higiénico-sanitarias reglamentadas. En Holanda un estudio realizado por Swanenburg et al., (2001) en plantas frigoríficas, informo una prevalencia de Salmonella spp. del 10 % en las carcasas. Por otro lado, Duggan et al., (2010) y Mannion et al., (2012) hallaron una prevalencia de Salmonella en carcasas porcinas del 10.63% y 5.9% respectivamente, respectivamente, en frigoríficos de Irlanda (Arcos et al., 2013).

Por otro lado, en la etapa de llegada de canales y desposte con un total de 61 muestras analizadas la prevalencia fue de un 9.83%, tres veces mayor a la obtenida en el trabajo de tesis de Hernández García (2013), en la que la prevalencia fue 3.75%. En un estudio realizado por Prendergast et al., (2008) las muestras fueron tomadas sobre el trasero interno en diferentes cerdos y la prevalencia de dicho estudio fue 3.3%. Es importante destacar que en un alto porcentaje de casos la contaminación ocurre en la línea de faenado donde el procesamiento de las canales constituye un factor de riesgo para que Salmonella ingrese en la cadena alimentaria (Hernández García, 2013). Además, en nuestro estudio en una de las empresas las canales son transportadas hasta la sala de desposte en un camión refrigerado, esto podría determinar el incremento de contaminación debido a la manipulación.

(33)

26 En el criadero se obtuvieron aislamientos de Salmonella de un hisopado rectal de madre en gestación, materia fecal de cerdos en destete y de alimento de madre en gestación. Berends et al. (1996) estimó que alrededor del 15-30% de todas las infecciones en el periodo de terminación se atribuyeron a alimentos contaminados y que los cerdos portadores eran la fuente más importante de la contaminación de la canal. Sin embargo esta asociación entre la alimentación y la contaminación de la carne de cerdo no es del todo clara. Por otra parte estudios señalan que portadores enfermos o asintomáticos pueden desempeñar un papel fundamental en la propagación de las infecciones de cerdos, y eventos estresantes, como el transporte o la privación de alimentos puede predisponer a los animales a una mayor excreción fecal, sobre todo en el destete, teniendo un mayor riesgo de infección (Anderson et al.,1999).

A su vez, en la etapa de llegada de canales y desposte se obtuvieron aislamientos en sierra cortadora de carne, en cuartos y en la carne propiamente dicha. La importancia en este estudio de la presencia de Salmonella spp en canales radica en que mucho de los animales infectados con esta bacteria no evidencian signos clínicos que permitan identificarlos antes de la entrada al matadero o no son detectados en la inspección post-mortem y es posible que la contaminación con esta bacteria ocurra durante el sacrificio por contacto con el ambiente contaminado (equipo, utensilios, etc.) y también por manipulación de los operarios (Giovannacci et al., 2001; Mainar et al., 2008; Mannion et al., 2008).

Cabe señalar que dos de las seis muestras positivas en esta etapa corresponde a una sierra cortadora de carne, donde se tomó un hisopado del interior de la misma. Los resultados revelan una necesidad de implementar medidas de higiene para disminuir la presencia de Salmonella y el posible riesgo de infección humana. Un plan de buenas prácticas de manufacturas que incluya medidas de manipulación antes y durante la faena y el control de los puntos críticos, se debería implementar para disminuir la posible contaminación de Salmonella al humano.

(34)
(35)

28

CONCLUSIÓN

Con los resultados obtenidos en el presente trabajo, es posible concluir que los cerdos son reservorios de Salmonella spp.; y que durante la manipulación desde el criadero hasta la boca de expendio, pasando por la etapa de faena y desposte la contaminación aumenta.

(36)

29

BIBLIOGRAFÍA

 Alban, L.; Sta¨rk, K. 2005. Where should the effort be put to reduce the Salmonella prevalence in the slaughtered swine carcass effectively?. Preventive Veterinary Medicine. 68, 63–79.

 Aliverti, V. (2012). Desarrollo y validación intra-laboratorio de una metodología para la detección Salmonella spp. en carne bovina molida. Desarrollo de estrategias de prevención y control. Disponible en el URL: http://sedici.unlp.edu.ar/bitstream/handle/10915/18192/Documento_com

pleto.pdf?sequence=1 (Fecha de consulta: 13/06/2014).

 Anderson, R.; Stanker, L.; Young, C.; Buckley, S.; Genovese, K.; Harvey, R.; DeLoach, J.; Keith, N.; Nisbet, D. (1999). Effect of competitive exclusión treatment on colonization of early-neaned pigs by Salmonella serovar Choleraesuis.

 ANMAT. (2011). Enfermedades transmitidas por los alimentos. Disponible en el URL: http://www.anmat.gov.ar/alimentos/eta.pdf (Fecha de consulta: 10/02/2014).

 ANMAT. (2011). Análisis microbiológicos de los alimentos. Disponible en

el URL:

http://www.anmat.gov.ar/renaloa/docs/Analisis_microbiologico_de_los_al

imentos_Vol_I.pdf (Fecha de consulta: 14/02/2014).

 Anselmo, J.; Barrios, H. (2012). Nuevos perfiles genéticos de Salmonella Enteritidis identificados en Lujan, Argentina. Información tecnológica. 23, 87-94.

 Arcos Avila, E.; Mora Cardona, L.; Fandiño de Rubio, L.; Rondon Barragan, I. (2013). Presencia de Salmonella spp. en carne porcina en plantas de beneficio y expendios del Tolima. Orinoquia. 17, 59-68.

 Argüello Rodriguez, H.; Carvajal, A.; Rubio Nistal, P. Impotancia del matadero en el control de salmonelosis. (2012). Disponible en el URL: https://www.3tres3.com/print/30981 (Fecha de consulta: 24/07/2015)  Asuar, L. (2007). Guía prática sobre la técnica de PCR. In L. Eguiarte,

(37)

30  Bean, N.; Griffin, P. (1990) Foodborne disease outbreaks in United States. 1973-87: pathogens, vehicles ands trends. Journal of Food Protection. 53, 804-817.

 Berends, B.; Urlings, H.; Snijders, J.; Van Knapen, F. (1996).

Indentification and quantification of risk factors in animal management and transport regarding Salmonella spp. in pigs. International Journal of Food Microbiology. 30, 37-53.

 Berends, B.; Van Knapen, F.; Mossel, D.; Burt, S.; Snijders, J. (1998) Impact on human Health of Salmonella spp. on pork in The Netherlands and the anticipated effects of some currently proposed control strategies. International Journal of Food Microbiology. 44, 219-229.

 Bergey's Manual of Systematic Bacteriology. Second Edition 2010. Popoff and Le Minor.Volume II, Editorial Board, p. 786.

 Borch, E.; Nesbakken, T.; Christensen, H. 1996. Hazard identification in swine slaugther with respect to foodborne bacteria. International Journal of Food Microbiology. 30, 9-25.

 Cabrera, C.; Leon, G.; Tejeda, F.; Ramirez, B.; Flores, M. 2013. Estudio preliminar para investigar Salmonella sp. y E. Coli O157:H7 en carne molida de res de venta en supermercados en la ciudad de Puebla, Mexico. CienciaUAT. 26, 64-69.

 Caffer, M.; Terragno, R.; Binsztein, N. (2008). Manual de procedimientos. Diagnóstico y caracterización de Salmonella spp. Disponible en el URL: http://bvs.panalimentos.org/local/File/manual_salmonella_2008.pdf

(Fecha de consulta: 18/09/2014).

 Centers for Disease Control and prevention, CDC. (2011). National Enteric Disease Surveillance: Salmonella Surveillance Overview.

Disponible en el URL:

http://www.cdc.gov/nationalsurveillance/PDFs/NationalSalmSurveillOverv

iew_508.pdf (Fecha de consulta: 12/08/2014).

 Centers for Disease Control and prevention, CDC. (2014). Salmonella

data now at your fingertips. Disponible en el URL: http://www.cdc.gov/media/releases/2014/p0326-salmonella-data.html

(38)

31  Chiu, C. y Ou, J. (1996) Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culture-multiplex PCR combination assay. Journal of Microbiology. 34, 2619-2622.

 Cisan. (2012). Brotes de enfermedades transmitidas por alimentos en

2011. Disponible en el URL:

http://www.cisan.org.ar/articulo_ampliado.php?id=173&hash=ba844db1c

adff8ae52fa6d1c07de5019 (Fecha de consulta 10/02/2014).

 Delhalle, L.; Saegerman, C.; Farnir, F.; Korsak, N.; Maes, D.; Messens, W.; De Sadeleer, L.; De Zutter, L.;Daube, G. (2009). Salmonella surveillance and control at post-harvest in the Belgian pork meat chain. Food Microbiology. 26, 265-271.

 Di Pietro, S.; Haritchabalet, K.; Cantoni, G.; Iglesias, L.; Mancini, S.;

Temperoni, A.; Labanchi, J. ; Barbarossa, N.; Garcia, M.; Cofre, M.; Rosales, S.; Herrero, E.; Bigatti, R.; Orellana, O.; Larrieu, E. (2004). Vigilancia epidemiológica de enfermedades transmitidas por alimentos en la Provincia de Río Negro, Argentina, 1993-2001. Medicina (Buenos Aires). 64, 120-124.

 Dickson, J.; Hurd, H.; Rostagno, M. (2002). Salmonella in the pork production chain. Disponible en el URL: http://www.pork.org/filelibrary/Factsheets/PorkSafety/Pork%20Production %20Chain.pdf. (Fecha de consulta: 04/06/2014).

 Ejeta, G.; Molla, B.; Alemayehu, D.; Muckle, A. (2004). Salmonella

serotypes isolated from minced meat beef, mutton and pork in Addis Ababa, Ethiopia. Revue Med Vet. 155, 547-551.

 Europa Food Safety Authority(EFSA).(2009). Analysis of the vaselina survey on the prevalence of Salmonella in holdings with breeding pigs in the EU, 2008. Part A: Salmonella prevalence estimates. EFSA Journal.

7, 1-93.

 FAO y WHO. (2002). Risk Assessments of Salmonella in Eggs and Broiler Chickens – 2. Disponible en el URL:

http://www.fao.org/docrep/005/y4392e/y4392e00.htm (Fecha de

(39)

32  Figueroa Ochoa, M.; Rodriguez, A. (2004). Mecanismos moleculares de patogenicidad de Salmonella spp. Revista Latinoamerciana de microbiología. 47, 25-42.

 Food Safety and inspection Service. (2014). Compliance Guideline for Controlling Salmonella in Market Hogs. Disponible en el URL: http://www.regulations.gov/#!documentDetail;D=FSIS-2014-0002-000 (Fecha de consulta: 17/06/2014).

 Garcia Feliz, C. (2011). Salmonelosis porcina en España: prevalencia,

factores de riesgo y resistencia. Disponible en el URL: https://buleria.unileon.es/bitstream/handle/10612/1508/Salmonelosis_Ga rc%C3%ADa.pdf?sequence=1 (Fecha de consulta: 13/04/2014).

 Ghafir, Y.; Daube, G. (2008). Comparison of swabbing and destructive methods for microbiological pig carcass sampling. Letters in Applied Microbiology. 47, 322-326.

 Giovannacci, I.; Queguiner, S.; Ragimbeau, C.; Salvat, G.; Vendeuvre, J.; Carlier, V.(2001). Tracing of Salmonella spp. in two pork slaugther and cutting plants using serotyping and macrorestriction genotyping. J Applied Microbiol. 90, 131-147

 Grupo Delcen. (2009).¿Qué es la inocuidad?. Disponible en el URL:

http://www.inocuidad-alimentaria.com/news/seguridad_alimentaria/nota807.htm (Fecha de

consulta: 09/02/2014).

 Gutierrez Castillo, A.; Paasch Martinez, L.; Calderon Apodaca, N. (2008) Salmonelosis y campilobacteriosis, las zoonosis emergentes de mayor expansión en el mundo. Veterinaria Mexico. 39, 81-90.

 Hauser, E.; Hebner, F.; Tietze, E.; Helmuth, R.; Junker, Ernst.; Prager, R.; Schroeter, A.; Rabsch, W.; Fruth, A.; Malorny, B. (2011). Diversity of Salmonella entérica serovar Derby isolated from pig, pork and humans in Germany. International Journal of Food Microbiology. 151, 141-149.  Hernández García, M. (2013). Estudio de evaluación y mejora de la

(40)

33 http://helvia.uco.es/xmlui/bitstream/handle/10396/11461/2013000000858 .pdf?sequence=3 (Fecha de consulta: 06/06/2014)

 Leotta, G.(2009). Métodos rápidos: una herramienta útil y práctica para

el análisis microbiológico de los alimentos. Revista Argentina de Microbiología. 41, 63-64.

 Leotta, G.; Aliverti, V.; Brocardo, S.; Copes, J. (2010). Manual de procedimientos. Deteccion , aislamiento y caracterización de Salmonella spp. a partir de alimentos. Disponible en el URL: http://www.conicet.gov.ar/new_scp/detalle.php?detalles=yes&id=37396&

keywords=&lib_id=1997162&libros=yes (Fecha de consulta: 10/09/2015).

 Leotta, G.;Linares, L.; Ortega, E.; Adriani, C. (2014). Carnicerias

Saludables. Disponible en el URL:

http://www.ipcva.com.ar/files/ct14v2.pdf (Fecha de consulta:

12/09/2015).

 Mainar, J; Atashparvar, N.; Chirino, M.; Rahn, K. (2008). Survey on Salmonella prevalence in slaughter pigs from Saskatchewan. Can J Vet Res. 49: 793-796.

 Malorny, B.; Hoofar, J.; Bunge, C.; Helmuth, R. (2003).Multicenter validation of the Analytical Accuracy of Salmonella PCR: towards in an International Standard. Appl Environ Microbiol. 69: p. 290-6.

 Malorny, B.; Hoorfar, J.; Hugas, M.; Heuvelink, A.; Fach, P.; Ellerbroek,

L.; Bunge, C.; Dorn, C.; Helmuth, R. (2003). Interlaboratory diagnostic accurancy of Salmonella specific PCR-based method. International Journal of Food Microbiology. 89, 241-249.

 Mannion, C.; Egan, J.; Lynch, P.; Fanning, S.; Leonard, N.(2008). An investigation into the efficacy of washing trucks following transportation of Pigs A Salmonella perspective. Foodborne Pathogens Disease. 5,

261-271.

 Martinez Alvarez, N. (2007). Virulencia, Resistencia y elementos geneticos moviles en serotipos no prevalentes de Salmonella enterica.

Disponible en el URL:

http://www.tdx.cat/bitstream/handle/10803/11093/UOV0023NMA.pdf?seq

(41)

34  Melara Cruz, S.L.; Salazar Artiga, B.G. (2012). Determinación de la multiresistencia a los antimicrobianos de Salmonella spp. aislada a partir de muestras de chorizos comercializados en mercados de Santa Tecla.

Disponible en el URL:

http://ri.ues.edu.sv/2279/1/AISLAMIENTO_DE_SALMONELLA_AC..pdf

(Fecha de consulta: 17/02/2014).

 Mihaiu, L.; Lapusan, A.; Tanasuica, R.; Sobolu, R.; Mihaiu, R.; Oniga, O.; Mihaiu, M. (2014). First study of Salmonella in meat in Romania. J Infect Dev Ctries. 8, 50-58.

 Ministerio de Salud de la Argentina. (2012). Salmonella. Disponible en URL:

http://www.msal.gov.ar/index.php/component/content/article/48/241-salmonella (Fecha de consulta: 03/02/2015).

 Ministerio de Salud de la Nación. (2010). Boletines Epidemiológicos del

Ministerio de Salud de la Nación. Disponible en el URL: http://www.msal.gov.ar/htm/site/pdf (Fecha de consulta: 17/02/2014).

 Molla, B.; Alemayehu, D.; Salah, W. (2003). Sources and distribution of Salmonella serotypes isolated from food animals slaughtrhouse personnel and retail meat products in Ethiopia: 1997-2002. Ethiop J. Hlth Dev. 17, 63-70.

 Moreno Andrade, L. (2012). Recomendaciones para la prevalencia y control de Salmonella spp en canales porcinas, de la granja al beneficio: una revisión sistemática. Disponible en el URL: http://intellectum.unisabana.edu.co:8080/jspui/bitstream/10818/3634/1/L

AURA%20MARCELA%20MORENO%20ANDRADE_157731.pdf (Fecha

de consulta: 14/08/2014).

 Muirhead, M.; Alexander, J.; Carr, J. (2014). Managing Pig Health: A Reference for the Farm - 2nd Edition. Disponible en el URL:

http://www.elsitioporcino.com/publications/7/manejo-sanitario-y- tratamiento-de-las-enfermedades-del-cerdo/319/identificacian-de-los-problemas-en-la-cerda-gestante. (Fecha de consulta: 24/07/2015).

 Newell, D.; Koopmans, M.; Verhoef, L.; Duizer, E.; Aidara Kane, A.;

(42)

35 der Giessen, J.; Kruse, H. (2010). Foodborne diseases- The challenges of 20 years ago still persist while new ones continue to emerge. International Journal of Food Microbiology. 139, 3-15.

 Nyeleti, C.; Molla, B.; Hildebrandt, G.; Kleer, J. (2000). The prevalence and distribution of salmonellae in slaughter cattle slaughterhouse personnel and minced beef in Addis Ababa(Ethiopia). Bull. Anim Health Prod Afr. 48. 19-24.

 Ochoa Figueroa, I.; Verdugo Rodriguez, A. (2005). Mecanismos moleculares de patogenicidad de Salmonella sp. Revista Latinoamericana de microbiología. 47, 25-42.

 Organización Panamericana de la Salud. Salmonelosis. (2008).

Disponible en el URL:

http://publicaciones.ops.org.ar/publicaciones/publicaciones%20virtuales/l

ibroETAs/modulo2/modulo2a.html (Fecha de consulta: 05/05/2014).

 Pachon Cubillos, D. A. (2009). Aislamiento, Identificacion, y Serotipificacion de Enterobacterias del Genero Salmonella en Crocodylus intermedius y Testudinos cautivos en la Estacion de Biologia Tropical Roberto Franco en Villavicencio- Meta. Disponible en el URL: http://www.javeriana.edu.co/biblos/tesis/ciencias/tesis198.pdf (Fecha de

consulta: 22/06/2014).

 Parra, M.; Durango, J.; Máttar, S. (2002). Microbiología, patogénesis, epidemiologia, clínica y diagnóstico de las infecciones producidas por Salmonella. Revista MVZ Cordoba. 7, 187-200.

 Prendergast, D.; Dugan, S.; Gonzales, U.; Fanning, S.; Butler,F.;

Cormican, M.; Duffy, G. (2009). Prevalence, numbers and characteristics of Salmonella spp. on Irish retail pork. Internationa Journal of Food Microbiology. 131, 233-239.

 Prendergast, D.; Duggan, S.; Fanning, S.; Cormican, M.; Gonzales, U.; Butler, F.; Duffy, G. (2008). Prevalence and number of Salmonella spp. and Enterobacteriaceae on pork cuts in abbatoirs in the Republic of Ireland. Journal of Applied Microbiology. 105, 1209-1219.

 Duggan, S.; Mannion, C.; Prendergast, D.; Leonard, N.; Fanning, S.;

(43)

36 Salmonella status of pigs and pork from lairage through the slaughter process in the Republic of Ireland. J Food Prot. 12, 2148-2169

 Rahn, K.; Grandis, S.; Clarke, R.; McEwen, S.; Galán, J.; Ginocchio, C.; Curtiss, R.; Gyles, C. (1992). Amplification of on invA gene secuence of Salmonella typhimurium by polimerase chain reaction as a specific method of detection of Salmonella. Molecular and Cellular Probes. 6, 271-279.

 Rodriguez Sanchez, I; Barrera Saldaña, H. (2004). La reacción en cadena de la polimerasa a dos décadas de su invención. Ciencia UANL.

7, 323-325.

 Rodriguez, I.; Herrero, A.; Martinez, N.; Martín, M.; Rodicio, M.; Mendoza, M. (2009). Deteccion and characterizacion of Salmonella enterica serovar Virchow. En: “Modern Multidisciplinary Applied Microbiology: Exploiting Microbes and their Interactions”.Méndez Vilas.

Ed. Wiley- VCH, Alemania. p. 687-91.

 Sanchez Jiménez, M.; Cardona Castro, N. (2003). Mecanismos de interaccion de Salmonella con la mucosa intestinal. Infectio. 7, 22-29.  Sanchez Rodriguez, J.; Serrano, J.; Marfil, R.; Jodral, M. (2009).

(44)

37  Saravia Gómez, J. Salmonelosis. (2012). Disponible en el URL: http://www.aibarra.org/Apuntes/criticos/Guias/Infecciosos/Salmonellosis.

pdf (Fecha de consulta: 17/05/2014).

 Satorres, S.; Pederiva, N.;Centorbi, O. (1998). Isolation of Salmonella sp

from eggs. Biocell. 22, 2.

 Swanenburg, M.; Urlings, H.; Keuzenkamp, D.; Snijders, J. (2001). Salmonella in the lairage of pig slaughterhouses. J Food Prot. 1, 12-16.

 Tamay de Dios, L.; Ibarra, C.; Velasquillo, C. (2013). Fundamentos de la

reaccion en cadena de la polimerasa (PCR) y de la PCR en tiempo real. Investigacion en discapacidad. 2, 70-78.

 Timtoney,J.(1970).Salmonellae in irish pigs at slatighfer. Irish Vet.. 24, 141-145.

 Uribe, C.; Suarez, M. (2006). Salmonelosis no tifoidea y su transmisión a

través de los alimentos de origen aviar. Colombia Médica. 37, 151-158.

 World Organisation for Animal Health. (2008). Manual de la OIE sobre animales terrestres: Salmonelosis. Disponible en el URL: http://web.oie.int/esp/normes/mmanual/pdf_es_2008/2.09.09.%20Salmo

nelosis.pdf (Fecha de consulta: 23/06/2014).

 Yang, B.; Qu, D.; Zhang, X.; Shen, J.; Cui, S.; Shi, Y.; Xi, M.; Sheng, M.;

Figure

Actualización...

Referencias

  1. http://sedici.unlp.edu.ar/bitstream/handle/10915/18192/Documento_completo.pdf?sequence=1
  2. : http://www.anmat.gov.ar/alimentos/eta.pdf
  3. http://www.anmat.gov.ar/renaloa/docs/Analisis_microbiologico_de_los_alimentos_Vol_I.pdf
  4. https://www.3tres3.com/print/30981
  5. http://bvs.panalimentos.org/local/File/manual_salmonella_2008.pdf
  6. http://www.cdc.gov/nationalsurveillance/PDFs/NationalSalmSurveillOverview_508.pdf
  7. http://www.cdc.gov/media/releases/2014/p0326-salmonella-data.html
  8. http://www.cisan.org.ar/articulo_ampliado.php?id=173&hash=ba844db1cadff8ae52fa6d1c07de5019
  9. http://www.pork.org/filelibrary/Factsheets/PorkSafety/Pork%20Production%20Chain.pdf.
  10. http://www.fao.org/docrep/005/y4392e/y4392e00.htm
  11. http://www.regulations.gov/#!documentDetail;D=FSIS-2014-0002-000
  12. https://buleria.unileon.es/bitstream/handle/10612/1508/Salmonelosis_Garc%C3%ADa.pdf?sequence=1
  13. http://www.inocuidad-alimentaria.com/news/seguridad_alimentaria/nota807.htm
  14. http://helvia.uco.es/xmlui/bitstream/handle/10396/11461/2013000000858.pdf?sequence=3 (Fecha
  15. http://www.conicet.gov.ar/new_scp/detalle.php?detalles=yes&id=37396&keywords=&lib_id=1997162&libros=yes
  16. http://www.ipcva.com.ar/files/ct14v2.pdf
  17. http://www.tdx.cat/bitstream/handle/10803/11093/UOV0023NMA.pdf?sequence=1
  18. http://ri.ues.edu.sv/2279/1/AISLAMIENTO_DE_SALMONELLA_AC..pdf
  19. http://www.msal.gov.ar/index.php/component/content/article/48/241-salmonella
  20. http://www.msal.gov.ar/htm/site/pdf
  21. http://intellectum.unisabana.edu.co:8080/jspui/bitstream/10818/3634/1/LAURA%20MARCELA%20MORENO%20ANDRADE_157731.pdf
  22. http://www.elsitioporcino.com/publications/7/manejo-sanitario-y-
  23. tratamiento-de-las-enfermedades-del-cerdo/319/identificacian-de-los-problemas-en-la-cerda-gestante.
  24. http://publicaciones.ops.org.ar/publicaciones/publicaciones%20virtuales/libroETAs/modulo2/modulo2a.html
  25. http://www.javeriana.edu.co/biblos/tesis/ciencias/tesis198.pdf
  26. http://www.aibarra.org/Apuntes/criticos/Guias/Infecciosos/Salmonellosis.pdf
  27. http://web.oie.int/esp/normes/mmanual/pdf_es_2008/2.09.09.%20Salmonelosis.pdf