Production of Bioplastics Using Genetically Modified
Escherichia coli
Ana María López Tamayo
Abstract: Ralstonia eutropha H16 has been used for several years to produce polyhydroxybutyrate, a natural, biodegradable polymer which is produced by this organism under special conditions. However, there are several factors that prevent R.eutropha from a large-scale production of this polymer: its slow growth, its difficulty to lyse when obtaining the polymer, its mechanism to degrade their own polymer produced and the cost of substrates used for the production of PHB. Therefore, a genetically modified organism that can produce the polymer more efficiently would help reducing the cost of the production of PHB using organisms. In the present study, the genes coding for β-ketothiase, Acetoacetyl CoA Reductase and PHB polymerase (PHB operon) from R.eutropha H16 was cloned into the vector pETBlue-1 and expressed in a strain of E.coli., The clone containing the operon was selected using LB medium with ampicillin, lactose and IPTG. The ability of the new clone to produce PHB was tested.
[Key words: Polyhydroxybutyrate (PHB), Ralstonia eutropha, Escherichia coli] INTRODUCTION
Poly-hydroxybutyrates (PHB) are a class of polyhydroxyalkanoates which are biodegradable polymers that can be produced artificially or naturally by certain strains of bacteria. These bioplastics have attracted attention since they possess material properties similar to the common petrochemical-based synthetic thermoplastics and elastomers currently in use [1], but has the advantage that can be completely degraded to carbon dioxide and water by microorganisms in the environment. This feature, decreases the amount of plastics remaining in the landfills in addition to reducing the consumption of fossil fuels since PHAs is not produced from this resource.
Polyhydroxybutyrates are synthesized and stored as intracellular granules by a wide range of prokaryotic genera, which can produce this polymer as a result from a sufficient availability of an external carbon source and a restricted supply of the grown-essential substrate such as nitrogen, phosphate, dissolved oxygen or certain micro-components [2]. One of the
most known natural producers of PHB is Ralstonia
eutropha H16, a gram-negative bacteria that can yield
high concentrations of this polymer by synthetizing and accumulating it as a source of carbon and energy during shortage of nutrients such as nitrogen and phosphorus [3]. Despite its capability to produce PHB,
R.eutropha has certain limitations such as slow growth, difficulties associated with cell lysis during PHB obtaining process and has metabolic processes that involves PHB degradation in its genetic code that prevents its recovery from the cells [4]. Because of these limitations, efforts has been made to improve the PHB production using recombinant organisms capable of producing these polymers at a high rate, utilizing cheap carbon sources [5].
The metabolic pathway used by R.eutropha to produce
polyhydroxybutyrate (Figure 1.) has been studied and used to produce this polymer artificially using genetically modified organisms; It involves three enzymes and their sequential reactions. The first enzyme of the pathway is acetyl-CoA
C-acetyltransferase, encoded by phaA, which catalyzes
the condensation of two acetyl-CoA molecules to form acetoacetyl-CoA [6]. At that point,
acetoacetyl-CoA is reduced to
(R)-3-Hydroxybutyryl-CoA by NADPH-dependent Acetoacetyl-CoA
reductase (encoded by the phaB gene). Finally, PHA
synthase (encoded by phaC) catalyzes the
polymerization of (R)-3-Hydroxybutyryl-CoA
monomers to PHB [6]. This three genes are all contained in the phbCAB operon.
Taking into account that the high cost of industrial production and that the recovery of bioplastics is presently not able to compete with traditional ways of synthetic plastic production, in the present study, the
genes coding for β-ketothiase, Acetoacetyl CoA
Reductase and PHB polymerase (PHB operon) from
R.eutropha H16 was cloned into the vector pETBlue-1
and expressed in a strain of E.coli α5.The main
reasons for using this bacteria is because, in addition to have a relatively small genome size compared with other organisms, it has a rapid growth rate and its
safety for use. Besides this, E.coli is the most highly
studied microorganism and has an advanced knowledge of its protein expression mechanisms, a fact that makes it simpler to use for experiments where expression of foreign proteins and selection of recombinants is essential. [7]
Likewise, another reason for using E.coli for this study
is because most gene cloning techniques were developed using this bacterium and are still more
successful or effective in E.coli than in other
microorganisms. Therefore, the ability of the new
clone using E.coli to produce PHB was tested.
The resulting transformant E.coli could be used to
produce PHB at high concentrations and can lead to other studies to optimize its production from cheap sources such as wastewater fatty acids.
MATERIALS AND METHODS
Bacterial strains, plasmids, and culture conditions
The bacterial strains and plasmids used in this study
are listed in Table 1. Strains of R.eutropha H16 were
grown in Luria-Bertani medium (LB) at 35°C under
aerobic conditions for 48 hours. E.coli BL21competent
cells were grown at 35°C on the same medium as
R.eutropha. These were used for the insertion of the recombinant plasmid (pETBlue-1) which was supplied by Novagene was isolated from E.coli α5 using
Wizard Plus SV minipreps DNA Purification System
from Progene®
Table1. Bacterial Strains and Plasmids used in this study
Strain or
Plasmid Description
Source of Reference
E.coli BL21 Invitrogen
E.coli +
pETBlue-1
E.coli +
Pet21a
R.eutropha
H16 Wild Type This study
Plasmid
pETBlue-1 High-copy cloning vector, Ampr Novagen
Isolation of PHB operon and PCR
Total genomic DNA was extracted from R.eutropha
using Ultraclean Microbial DNA isolation kit. Concentrations of DNA were assessed at 260 nm using Thermo NanoDrop 2000C spectrophotometer. The PHB operon reverse and forward primers (5’CGGGGAATTCTGACGGCAGAGAGACAATC AAATCATG3’and5’ACCCGGGAGGCACTAAGAA
AAGCGA3’respectively) were synthetized by
Integrated DNA Technologies (IDT) ® and used to amplify the operon of 4095 bp. The amplification
reactions were carried out in 50µL final reaction
volume containing 5µL of TaKaRa Buffer, 4 µL of
dNTP mix, 0.15µL of each primer, 0.25µL of TaKaRa
taq-polymerase and 40.45µL sterile destilled water.
Amplification conditions were based on TaKaRa Taq
DNA Polymerase Hot Start Version protocol (Table 2). The PCR products were detected by electrophoresis and compared with the GeneRuler™ 1Kb DNA Ladder. The PCR product was purified using Wizard SV gel and PCR clean-Up system provided by Progene ®.
Table 2. PCR Amplification Program
Step Temperature (°C) (min:sec) Time Number of Cycles
1 Denaturation Initial 94 0:30 1
2
Denaturation 98 0:10
30
Annealing 55 0:30
Extension 72 2:30
3 Final Extension 72 10:00 1
4 -4 ∞ 1
Isolation of pETBlue-1
E.coli containing the plasmid was grown on LB medium for 48 h at 35°C in a shaker at the end of this period, LB liquid medium was inoculated with the strain and grown overnight. The plasmid pETBlue-1
contained in E.coli α5 was isolated and purified using
the Wizard plus SV Minipreps DNA purification system. A quantification of the extraction was made using Thermo Nano Drop 2000c at 260 nm.
Digestion of PHB operon and pETBlue-1 plasmid
For digestion two restriction enzymes were used: EcoRI and SmaI which have two different restriction sites resulting in blunt and sticky ends respectively.
For PHB operon digestion 10 µL of PCR product was
immersed in a solution containing 17µL of
nuclease-free water, 2µL of 10x FastDigest Green Buffer and
1µL of each enzyme. The solution was incubated
at37°C in a heat block for 20 minutes and after that, the enzymes were inactivated heating the solution for 5 minutes at 80°C. The digestion of plasmid was
carried out using 2 µL of the vector, 1517µL of
nuclease-free water, 2µL of 10x FastDigest Green
Buffer and 1µL of each enzyme. The incubation
process was the same used for the PCR digestion. The plasmid product was analyzed by electrophoresis and the linear product was cut from the gel. Digestion products were purified using Wizard SV gel and PCR clean-Up system.
Construction of plasmids and Transformation
The plasmids were constructed using the Ligation Protocol with T4 Ligase provided by BioLabs®. 50 ng of DNA vector and 37.5 ng of insert were mixed with
2µL of DNA Ligase buffer, 1µL of T4 DNA Ligase
and 17µL of nuclease free water. The components
were all mixed by vortex and incubated overnight at
16°C. The resultant plasmids (5µL) were transformed
in 50 µL of chemically competent cells of E.coli
BL21(DE3) provided by Invitrogen™. The recombinants were evaluated on a medium including Ampicilin and IPTG.
RESULTS AND DISCUSSION
Isolation of PHB operon and PCR
The concentrations obtained in the extraction of
R.eutropha DNA reached 234.7 ng/µL using Thermo NanoDrop 2000C spectrophotometer. As expected, the fragment produced by PCR reached a length of 4000
bp, which is evidenced at Figure 2, were the DNA
ladder labeled with this same length coincides with the product obtained. The low quality of the electrophoresis is low could be due three main reasons: the buffer used was in poor condition, the electrophoretic transfer cell was miscalibrated or because the concentration used preparing the gel for this fragment size is the wrong one. More trials are being done to resolve this issue. If it were possible, a sequencing of PCR product would be ideal to verify
that the fragment obtained matches with the phbCAB
operon sequence.
Figure 2. PCR product electrophoresis
Isolation of pETBlue-1 and Digestion of PHB operon and pETBlue-1 plasmid
The concentration obtained from the extraction of the
pET-Blue1 from E.coli cells reached 54.5 ng/µL. No
other method was used to test if the plasmid was successfully obtained. However, a transformation of the vector using chemically competent cells, and its subsequent cultivation in LB medium containing
Ampicilin had allowed verifying if the process was successful. Despite this, the digestion process using SmaI and EcoRI was conducted. The plasmid by itself without using digestion enzymes is shown at lane 5 at the Figure 3, which allows checking if the digestion process is being successful. The results of the restriction of the plasmid using EcoRI and SmaI separately are sown at lane 2 and 3 at the electrophoresis gel. As can be seen, the SmaI endonuclease is not being completely efficient cutting the plasmid as it does not cut some of these vectors which is showed on the smaller fragment which represents a circular, un-cutted plasmid. In contrast, EcoRI is shown to be efficient cutting the plasmid as it presents on its lane just one fragment representing the plasmid opened as a result of the digestion. Taking into account that the fragment resulting from the double digestion differs in approximately 10 bp from the digestion with only one enzyme, it is expected to visualize fragments of the same length for all the digestions. As expected, the double digested fragment, shown in the lane 3, has the same length as the other digestions.
Figure 3. Endonucleases Digestion Products on Electrophoresis
After the purification protocol the concentration of the
plasmids reached 13.2 ng/µL. On the other hand, the
phbCAB operon digestion was made simultaneously,
obtaining a concentration of 22.1 ng/µL. An
electrophoresis was conducted to verify that there was DNA on the sample; however, sequencing should have
been done to verify that the fragment obtained was the same as the expected in terms of nucleotide sequence.
Construction of plasmids and Transformation
Plasmid construction was tested by transformation into
E.coli. When plating the competent cells already transformed using the recombinant vector constructed
in LB medium containing Ampicilin , no growth was
evidenced as it is shown in Figure 4. These results
evidence that there are no plasmids present in E.coli
that confers it the ability to grow in presence of antibiotics.
Figure 4. Plates containing E.coli cells transformed
REFERENCES
[1] G. Du, J. Chen, J. Yu y S. Lun, «Continuous production of poly-3-hydroxybutyrate by Ralstonia eutropha in a two-stage culture system,» Journal of Biotechnology, vol. 88, pp. 59-65, 2001. [2] M. Koller y M. A. Salerno Anna, «Polyhidroxyalkanoates:
Biodegradable Polymers and Plastics From Renewable Resources,»
Materials and Technology, vol. 46, nº 6, pp. 23-30, 2010.
[3] P. Patnaik, «Dispersion optimization to enhace PHB production in fed-batch cultures of Ralstonia eutropha,» Bioresoure Technology,
nº 97, pp. 1994-2001, 2005.
[4] M. Thirumala y S. Reddy, «Production of PHA by Recombinant Organisms,» International Journal of Life Sciences Biotechnology and Pharma Research, vol. 1, nº 2, pp. 40-62, 2012.
[5] J. Luengo, B. García, A. Sandoval y G. Naharro, «Bioplastics from microorganisms,» Current Opinion in Microbiology, vol. 6, nº 3, pp. 252-260, 2003.
[6] K. Kocharin, Y. Chen, V. Siewers y J. Nielsen, «Engineering of acetyl-CoA metabolism for the improved production of polyhydroxybutyrate in Saccharomyces cerevisiae,» AMB express: SpringerOpen Journal, vol. 2, nº 52, p. available online, 2012.
[7] R. F. Weaver y P. Hedrick, Gentics, New York: McGraw-Hill Higher Education, 1997.
[8] C. Insomphun, J. Mifune y I. Orita, «Modification of b-oxidation pathway in Ralstonia eutropha for production of poly(3-hydroxybutyrate-co-3-hydroxyhexanoate) from soybean oil,»
Journal of Bioscience and Bioengineering, vol. 117, nº 2, pp. 184-190, 2014.
[9] P. Singh y N. Parmar, «Isolation and characterization of two novel polyhydroxybutyrate (PHB)-producing bacteria,» African Journal of Biotechnology, vol. 10, nº 24, pp. 4907-4919, 2011.
[10] M. Shiraki, T. Endo y T. Saito, «Fermentative Production of (R)-(-)-3- Hydroxybutyrate Using 3-Hydroxybutyrate Dehydrogenase Null Mutant of Ralstonia eutropha and Recombinant Escherichia coli,» Journal of Bioscience and Bioengineering, vol. 102, nº 6, pp. 529-534, 2006.
