• No se han encontrado resultados

Functional impact of calcineurin Aβ1 overexpression in the diseased heart achieved using adeno-associated virus based vectors

N/A
N/A
Protected

Academic year: 2023

Share "Functional impact of calcineurin Aβ1 overexpression in the diseased heart achieved using adeno-associated virus based vectors"

Copied!
87
0
0

Texto completo

(1)

UNIVERSIDAD AUTÓNOMA DE MADRID

PROGRAMA DE DOCTORADO EN BIOCIENCIAS MOLECULARES

TESIS DOCTORAL

Functional impact of calcineurin Aβ1 overexpression in the diseased heart achieved using adeno-associated

virus based vectors.

Enda Clinton

(2)

DEPARTAMENTO DE BIOQUÍMICA FACULTAD DE MEDICINA

UNIVERSIDAD AUTÓNOMA DE MADRID

Functional impact of calcineurin Aβ1 overexpression in the diseased heart achieved using adeno-associated

virus based vectors.

Memoria presentada por

ENDA CLINTON

Licenciado en Biotecnología, para optar al grado de Doctor por la Universidad Autónoma de Madrid

Director de tesis:

Dr. Enrique Lara Pezzi

Tutor de tesis:

Dr. Carmen Delgado Canencia

(3)

This thesis is dedicated to my family, those that have gone before and those

yet to come.

(4)

Education is not the filling of a pail, but the lighting of a fire.

- William Butler Yeats

(5)

ACKNOWLEDGMENTS

Life offers a limited number of opportunities to thank those without whom we would not be who or where we are today. I would like to use the following lines to take that opportunity. I would be remiss if I did not thank Dr. Enrique Lara Pezzi first. He gave me the opportunity to work in his group upon the completion of my university studies.

This has given me a chance to work with and learn from some of the greatest scientists I have ever had the privilege of knowing. His supervision has allowed me to explore the therapeutic potential of calcineurin Aβ1 in the treatment of heart disease and allowed me to collaborate with groups across the globe. His guidance has helped me understand what it means to be a scientist while his generosity with his time and patience in supporting me has opened my eyes to what it means to be an educator.

A group by definition must consist of more than one person and as such I have to thank the other members of the team that made this work possible. Maria made all of my work possible as without her help to complete the echocardiology throughout the study and her training in the analysis of the data I could not have even begun this work. She always willing to help me whenever the need arose. Jesus’ and Marina’s guidance and training in all aspects of life in the CNIC laboratory allowed me to learn and perform my experiments. Language was never a barrier as her patience and training overcame my terrible Spanish. Laura, Javier, Carlos, Ester and Paula were always open with their knowledge and experience that helped me with different ideas for experiments and other details. Alberto and Girolamo, I owe you both immeasurably for providing me with your unique insights on the world without which I could not have completed this work.

I also want to acknowledge the contribution of all the technical units in CNIC that have contributed to this work, especially the staff in the animal unit without who I could not have coordinated my animal studies. I would also like to thank Fran and Juan A.

Bernal Rodriquez for sharing their expertise in the field of viral vectors and their help in the development of the project. I owe a profound thank you to Inga and Lilith for all of their help from the beginning to the end of my stay in Madrid. They helped me with all of the issues around my employment and short stays. I had the good fortune to spend time in Genethon under the supervision of Federico Mingozzi under who I got the opportunity to advance my understanding of novel large-scale adeno associated

(6)

viral vector manufacturing processes. While my time in Mount Sinai gave me the chance to work under Roger Hajjar with Erik Kohlbrenner enhance my understand of various cell lines used to manufacture adeno associated viral vectors and supporting protocols. My peers in CardioNext provided support and a chorus of different ideas during our time in CNIC. On a more personal level I need to thank Sandra, Alberto and Dorota for their friendships that made every day brighter in CNIC.

I would like finish my acknowledgements by mentioning the people who have made it possible for me to get here. To my parents, Ann and Gerard, I can never repay your sacrifices that made it possible for me to complete this work. I will forever be in your debt. To my Grandparents, John, Mary and Patricia, when my parent’s sacrifices meant your own personal sacrifices were required you never hesitated to help. You demanded that I worked towards a university degree and beyond. Thank you all. To Ciaran and Shauna, I can only hope that you know how much you both helped inspire me, even from thousands of miles away. Lastly, I have to thank my wife, Irina, without your support I would not have had the courage to even begin this work. You make me demand more of myself. For that and every other little thing, this is for you.

For all of the above and so much more. Thank you all.

(7)

RESUMEN

(8)

RESUMEN

En el corazón adulto, la calcineurina activa el factor de transcripción NFAT, induciendo hipertrofia ventricular y finalmente la insuficiencia cardíaca. El splicing alternativo del ARN de calcineurina produce la isoforma CnAβ1, que tiene un dominio C-terminal único que activa AKT en lugar de NFAT. La sobreexpresión de CnAβ1 en el corazón una semana después del infarto mejora la función cardíaca y reduce el tamaño del infarto en ratones. El objetivo de esta tesis era investigar el potencial terapéutico de CnAβ1 administrada como terapia génica, y desarrollar un vector viral virus adeno-asociado tipo 9 (AAV9) en el que la expresión de CnAβ1 estaba controlada por el promotor de cTnT. Los ratones que recibieron una inyección sistémica de AAV9-CnAβ1 mostraron sobrexpresión cardioespecífica de CnAβ1 hasta un máximo de 21 días después de la inyección. En un modelo de ratón con estenosis aórtica en el que la hipertrofia patológica era inducida por sobrecarga de presión, el tratamiento con AAV9-CnAβ1 redujo la expresión de marcadores de insuficiencia cardíaca y fibrosis, redujo la hipertrofia cardíaca y el remodelado adverso, y mejoró la función cardiaca. Los resultados de la administración de AAV9-CnAβ1 en un modelo de infarto de miocardio con reperfusión mostraron una expresión reducida de marcadores de insuficiencia cardíaca, una reducción del remodelado adverso y una función mejorada. Estos resultados muestran el potencial de la administración de AAV9-CnAβ1 para sobre expresar CnAβ1 en dos modelos de enfermedad y para inducir una respuesta terapéutica en los animales.

(9)

SUMMARY

In the adult heart, calcineurin activates the transcription factor NFAT, which leads to cardiac hypertrophy and eventually to heart failure. Alternative splicing of the calcineurin mRNA produces the CnAβ1 isoform, which has a unique C-terminal domain that activates AKT instead of NFAT. In mice, CnAβ1 overexpression in the heart as late as 1-week post- infarction results in improved cardiac function and reduced infarct size. To investigate its potential as a gene therapy, we developed an adeno-associated virus 9 (AAV9) vector in which CnAβ1 expression was controlled by the cardiac-specific cTnT promoter. Mice that received a systemic injection of AAV9-CnAβ1 showed cardiac specific expression of CnAβ1 up to 21 days post injection. In a mouse model of aortic stenosis in which pathological hypertrophy is induced by pressure overload, treatment with AAV9-CnAβ1 reduced cardiac hypertrophy, improved function and reduced adverse remodelling.

Decreased expression of heart failure markers and fibrosis was also observed. We also tested the potential of AAV9-CnAβ1 administration in an ischemic reperfusion model of myocardial infarction. Systemic administration of AAV9-CnAβ1 resulted in decreased expression of heart failure markers, reduced adverse remodelling and improved function.

These results highlight the potential of AAV9-CnAβ1 administration to overexpress CnAβ1 in various disease models and to achieve a therapeutic response in wild type animals.

(10)

INDEX

(11)

INDEX

ACKNOWLEDGMENTS ... 9

RESUMEN ... 14

SUMMARY ... 16

INDEX... 20

ABBREVIATIONS AND ACRONYMS ... 23

INTRODUCTION ... 25

Cardiovascular disease epidemiology ... 27

Healthy heart function ... 28

Myocardial infarction ... 29

Cardiac hypertrophy ... 32

The role of calcineurin in cardiac hypertrophy ... 33

Calcineurin Aβ1 ... 36

Calcineurin Aβ1 overexpression in the diseased heart ... 38

Adeno associated virus as a vector to overexpress Calcineurin Aβ1 in the heart ... 40

OBJECTIVES ... 44

MATERIALS AND METHODS ... 48

Animal care and ethics ... 50

rAAV construct... 50

rAAV production ... 52

Administration of AAV vectors ... 53

Myocardial infarction Surgery ... 53

Trans Aortic Constriction Surgery ... 54

(12)

In Vivo Imaging... 55

Tissue harvesting ... 55

RNA isolation ... 55

cDNA synthesis ... 56

Quantitative Real Time PCR ... 56

Histological analysis ... 56

Statistical analysis... 57

RESULTS ... 60

AAV9-CnAβ1 overexpresses CnAβ1 in cardiac tissue of adult mice after systemic administration. ... 62

AAV9-CnAβ1 improves cardiac contractility and decreases pathological remodelling following myocardial infarction ... 66

AAV9-CnAβ1 reduces pathological remodelling and loss of cardiac function in a pressure overload model of aortic stenosis ... 73

DISCUSSION ... 80

AAV9-CnAβ1 overexpresses CnAβ1 in cardiac tissue of mice ... 82

AAV9-CnAβ1 improves cardiac function, decreases pathological remodelling and the expression of heart failure markers post myocardial infarction. ... 84

AAV9-CnAβ1 reduces pathological remodelling and improves the retention of cardiac function after the induction of aortic constriction ... 87

Therapeutic Potential of AAV9-CnAβ1 ... 90

BIBLIOGRAPHY ... 98

(13)

ABBREVIATIONS AND ACRONYMS

o AAV: Adeno associated virus o ANS: Adrenergic nervous system o AS: Atherosclerosis

o ATP: Adenosine triphosphate o BNP: Brain natriuretic peptide o CM: Cardiomyocyte

o CMV: Cytomegalovirus o Cn: Calcineurin

o CnA: Calcineurin A o CnAβ1: Calcineurin Aβ1 o cTnT: Cardiac troponin t o CVD: Cardiovascular disease

o DALY: Disability-adjusted life years o DNA: deoxyribonucleic acid

o ECM: Extracellular matrix o EF: Ejection fraction

o eGFP: enhanced Green fluorescent protein o GPCR: G-proteins coupled receptor o GSH: Glutathione

o HW/BW: Heart weight / body weight o I/R: Ischemic reperfusion

o IP: Intraperitoneal

o IP3: Inositol trisphosphate

o IRES: Internal ribosome entry site o ITR: Inverted terminal repeat o IVIS: In vivo imaging system

o LAD artery: Left anterior descending artery o LDL: Low density lipoproteins

o LV: Left ventricle

o LVEDV: Left ventricular end-diastolic volume o LVESV: Left ventricular end-systolic volume

o LVPWd: Left ventricular posterior wall thickness in diastole

(14)

o MI: Myocardial infarction o MLC: Myosin light chain

o NCD: Non-communicable diseases o ORF: Open reading frame

o QoL: Quality of life

o RAAS: Renin-angiotensin-aldosterone system o rAAV: Recombinant adeno associated virus o RNA: Ribonucleic acid

o RV: Right ventricle

o SR: Sarcoplasmic reticulum o SV40: Simian virus 40

o TAC: Trans aortic constriction

o TRPC: Transient receptor potential channels o Vp: Viral capsid proteins

o WHO: World Health Organisation

o wtAAV: Wild type adeno associated virus

(15)

I N T R O D UCTION

1

(16)

INTRODUCTION

Cardiovascular disease epidemiology

Cardiovascular disease (CVD) remains the leading cause of deaths related to non- communicable diseases (NCD) globally, with 17.9 million deaths per year attributed to CVD (World Health Organization, 2018). The 2013-2020 Global Action Plan for the Prevention and Control of Noncommunicable Diseases report published by the World Health Organisation (WHO) targets a 25% reduction in mortality caused by NCDs by 2025 including CVD (World Health Organization, 2013).

Efforts to reduce premature deaths related to CVD require progress in the reduction of the population’s exposure to risk factors associated with CVD which include tobacco use, poor diet and sedentary lifestyle combined with improved detection and therapeutic interventions (Prevention of Cardiovascular Disease Guidelines for assessment and management of cardiovascular risk WHO Library Cataloguing-in-Publication Data, 2007). The success of decreasing the populations exposure to risk factors combined with improving detection methods and treatments have seen deaths related to CVD in Europe decrease. Despite this, CVD is still responsible for 3.9 million deaths per year in Europe alone (Wilkins et al., 2017).

Morbidity related to CVD impacts patient’s length and quality of life. CVD patients lose over 64 million disability-adjusted life years (DALYs) over the course of the illness, which accounts for 23% of all DALYs lost in Europe and a decrease in quality of life (QoL), quantified by a number of QoL measurement indexes (Martinelli et al., 2008; Ko et al., 2015; Benjamin et al., 2017; Wilkins et al., 2017).

Developing countries also present a challenge to WHO targets, during economic transitions populations are increasingly exposed to risk factors related to CVD (Boutayeb, 2006). This poses a significant issue when economic development is not matched with investment in medical infrastructure to cope with the increased burden of disease. The economic cost of CVD in Europe alone has been estimated at over €210 billion per year for the treatment and care of patients (Wilkins et al., 2017).

Emerging therapies with the potential to improve patient outcomes and decrease the dependence on underfunded healthcare infrastructure will play a vital role in the capacity to

(17)

provide care to sufferers of CVD. In this study we will examine the potential of using an adeno associated viral (AAV) vector to overexpress calcineurin A beta1 (CnAβ1) in cardiomyocytes (CM) in order to achieve a therapeutic effect in ischemic and non-ischemic models of heart disease.

Healthy heart function

The heart is the organ responsible for the circulation of blood through the vasculature of the body in order to maintain homeostasis in its tissues and organs. The capacity of the heart to generate a biomechanical force that is constant and repetitive, is central to its biological function and plays a role in the regulation of its function. The heart generates the required pressure to drive blood throughout the body by the synchronised contraction of its tissue, known as the myocardium (Voorhees and Han, 2015). The myocardium consists of a variety of cell types including endothelial cells, fibroblasts and vascular smooth muscle cells (Bernardo et al., 2010). CMs make up approximately 25-30% of the myocardium cell population while they contribute up to 70-80% of the mass of the myocardium (Bernardo et al., 2010; Pinto et al., 2016).

The contraction of the myocardium is regulated by Calcium (Ca2+) cycling in CMs. L-type calcium channels allow extracellular Ca2+ to enter the cell. The elevated intracellular Ca2+

levels cause increased Ca2+ binding to ryanodine receptors on the surface of the CM’s sarcoplasmic reticulum (SR). This stimulates the SR to release Ca2+ into the cytosol of the CM. Elevated Ca2+ increases Ca2+ binding to Troponin C, which allows for protein-protein interaction between myosin cross bridges and actin, generating a contractile force (Solaro, 2010). A decrease in the levels of cytosolic Ca2+ as a result of calcium pumps on the SR membrane, SERCA2a, and cell membrane, Sodium/Calcium (Na+/Ca2+) exchanger, causes relaxation. This allows for the heart to beat and maintain the homeostatic distribution of blood throughout the body.

A number of pathologies exist which can result in a decrease in cardiac functionality, the causes for which can be both biological and environmental. Adult mammalian CMs are incapable of meaningful cell division and in response disease states that reduce cardiac function they become hypertrophic in an effort to compensate (Hesse, Welz and Fleischmann, 2018). Myofibroblast proliferation and increased fibrosis are also characteristic of diseases that affect the myocardium. Myocardial infarction and aortic stenosis are just two examples of such conditions.

(18)

Myocardial infarction

Coronary atherosclerosis in combination with inflammation of the vascular wall can lead to the development of a thrombus that results in an occlusion of the vasculature of the heart, leading to a myocardial infarction (MI) (Thygesen et al., 2007). Atherosclerosis begins with the oxidation of low-density lipoproteins (LDL) in the intima of medium to large arteries.

The presence of oxidised LDL causes an inflammatory response resulting in the localisation of immune cells. The progression of this pathology is characterised by the movement of smooth muscle cells to the sub intimal space and lipid deposition under a fibrous cap composed of elastin, collagen and endothelial (Fig 1 B) (Saleh and Ambrose, 2018).

Figure 1. The progression of atherosclerosis - (A) Health artery free of atherosclerotic plaque that allows for normal blood flow. (B) Smooth muscle cell migration and lipid deposition under a fibrous cap causes previously heathy vasculature to become narrower, increasing the pressure on the walls of the artery.

(C) Proteases secreted by macrophages decrease the mechanical strength of the fibrous cap that ruptures under excess stress from arterial blood pressure. When the platelets in circulation come into contact with the plaques core, a coagulation cascade occurs and a thrombus forms causing an occlusion of the vasculature.

The formation of a thrombus can be caused by plague erosion, the protrusion of a calcified nodule from the fibrous cap, or more frequently, the rupture of an atherosclerotic plaque (Farb et al., 1996; Jia et al., 2013; Small and Chow, 2017). Localised inflammation mediated by pro inflammatory cytokines enhance cell death within the plaque while macrophages secrete proteases that degrade the matrix of the fibrous cap (Insull, 2009; Hansson, Libby and Tabas, 2015). These processes contribute to a decrease in the mechanical strength of the plaque that will rupture when excessive mechanical force is exerted upon it by blood moving

C

A B

(19)

through affected vasculature. When a rupture occurs platelets in circulation are exposed to the inner core of the plaque that causes their activation and subsequent coagulation that causes a thrombus to form (Fig 1 C) (Hansson, Libby and Tabas, 2015). The newly formed thrombus may cause an occlusion at the site of rupture, or distally, if it is dislodged from the site of the rupture resulting an occlusions (Saleh and Ambrose, 2018; Vendittelli et al., 2019).

The occlusion results in the development of a hypoxic environment in the tissue irrigated by the affected vasculature, leading to CM death. Although reperfusion of the blocked artery reduces the number of dead cardiomyocytes, it results in oxidative stress that causes CM death and subsequent replacement with scar tissue (Sutton and Sharpe, 2000). Despite the negative effects of reperfusion, it does contribute to the salvage of the myocardium that would otherwise suffer more significant CM cell death and therefore remains an important step in the preservation of cardiac function.

Post MI, the heart experiences continued cardiac stress causing the expansion and the thinning of the scar (Weisman et al., 1988). The heart’s myofibroblast population help ensure the deposition of the scar through secretion of pro-collagens (van den Borne et al., 2010). As the initial inflammation resolves, leucocytes disappear from the infarct region and angiogenesis begins, becoming more visible approximately two weeks post injury. This provides myofibroblasts with nourishment (Sun and Weber, 2000; Prabhu and Frangogiannis, 2016).

A robust extra cellular matrix is essential in the prevention of pathological remodelling post MI, however interstitial fibrosis occurs in areas remote to the infarct that contribute to a passive stiffness (van den Borne et al., 2010). Simultaneously the surviving CMs undergo hypertrophy to compensate, increase cardiac function and normalise the haemodynamic pressures in the ventricular walls of the heart (Heineke and Molkentin, 2006). CM hypertrophy, a persistent myofibroblast population in the myocardium and the continued

(20)

secretion of their fibrotic products eventually lead to pathological remodelling, increased myocardium stiffness and an increased propensity for arrhythmias (Weber et al., 2013).

Figure 2. Myocardial infarction – A coagulation cascade can lead to the formation of a thrombus in diseased vasculature. When this thrombus occludes the vasculature that’s supplies blood to the myocardium it results in the development of a hypoxic environment in the myocardium, a condition known as a myocardial infarction (MI). Cardiomyocyte (CM) death in the at-risk myocardium will occur as a result of this event and if no reperfusion of the vasculature is carried out a massive loss of the CM population will occur. This can lead to the development of arrythmias and progression to heart failure.

(21)

Cardiac hypertrophy

CMs are a terminally differentiated cell type. This lack of proliferative capacity means that hypertrophy offers the only means by which the heart can address a sustained increased demand in workload by increasing the size and contractility of CMs. This increased workload can be the result of be the result of pathological and physiological stimuli including post-natal growth, pregnancy and exercise which results in the occurrence of physiological hypertrophy which is reversable (Shimizu and Minamino, 2016). Pathological hypertrophy can be the result of a number of conditions including MI and pressure overload as a result of hypertension and aortic stenosis.

Figure 3. Progression of pathological hypertrophy – The healthy adult heart maintains the distribution of blood throughout the body by pressure generated when the myocardium of the left ventricle (LV) contracts. The heart begins to thicken in response to pathological stimuli in order to address elevated output demands from the heart. In an attempt to address the increased cardiac output, the myocardium thickens, in a process known as compensatory hypertrophy. The volume of the LV’s chamber is reduced however contractile function is maintained. The chronic effects pathological hypertrophy is a dilatation of the LV and pathological remodelling as a result of CM loss and fibrosis which results in a loss of contractile function.

(22)

The progression of pathological hypertrophy is characterised by left ventricular dilatation, systolic dysfunction and heart failure (Fig 3) (Jessup and Brozena, 2003). Before its progression to a pathological state, the development of hypertrophy begins with the peripheral baroreceptors reacting to a decrease in cardiac output by stimulating a number of neurohormonal systems to restore normal cardiac function (Hartupee and Mann, 2017). In these early attempts to compensate for the heart’s deceased functionality, adrenergic nervous system (ANS) and renin-angiotensin-aldosterone system (RAAS) activation occurs (Mudd and Kass, 2008).

Altered Ca2+ handling changes the haemodynamic of the heart to address acute deficiencies in cardiac output. Continuous activation results in sustained stress on the myocardium. The heart’s response to the chronic stress is an attempt to normalize the pressure by increasing the mass and size of the myocardium know as compensatory hypertrophy (Fig 3) (Grossman, Jones and McLaurin, 1975; Jessup and Brozena, 2003). As cardiac function stays depressed further tissue remodelling occurs resulting in continuous remodelling which progresses to a pathological state known as maladaptive or eccentric hypertrophy (Jessup and Brozena, 2003). Maladaptive cardiac hypertrophy affects angiogenesis, extracellular matrix deposition and the intracellular processes of CMs including altered Ca2+ handling, metabolism and the expression of foetal gene programs (Mudd and Kass, 2008).

Maladaptive hypertrophy results in the heart taking a globular shape with a thinning of the left ventricular walls, decreased function and mitral valve distortion and regurgitation (Jessup and Brozena, 2003).

The role of calcineurin in cardiac hypertrophy

Elevated cytosolic Ca2+ is the result of CM attempt’s to coordinate a response to an increased demand on cardiac output through cardiomyocyte stretch, increased cardiac load and in response to humoral factors (Molkentin et al., 1998). The hypertrophic response in CMs occurs through a number of pathways (Fig 4).

RAAS activation results in increased sodium (Na+) and water retention through multiple mechanisms and increased peripheral arterial vasoconstriction (He and Anderson, 2013).

Levels of peptide hormones such as angiotensin II and endothelin I are increased during RAAS activation and are responsible for some of the systemic physiological effects of activation (Agapitov and Haynes, 2002; Iravanian and Dudley, 2008). Angiotensin II and endothelin I act on CMs through the binding angiotensin II receptor and endothelin I

(23)

receptor respectively. This receptor-ligand binding in both cases leads to the activation of G-proteins coupled receptor (GPCR) activity which causes the activation of phospholipase C (PLC), an enzyme that allows for the synthesis of diacylglycerol (DAG) and subsequently inositol trisphosphate (IP3) (Zhang et al., 2013). IP3 increases cytosolic Ca2+ concentration by increasing Ca2+ release from the SR (Fig 4 A) (Nakamura and Sadoshima, 2018).

Figure 4. Hypertrophic signalling pathways in Cardiomyocytes – (A) Angiotensin II and endothelin I act upon their respective receptors through G proteinq this activate PLC, which allows for the catalytic synthesis of IP3. (B) Catecholamines bind to adrenergic receptors (AR) in the cell membrane whose G protein’s activate adenylyl cyclase which increases cAMP levels in the cell. cAMP binds to PKA releasing it catalytic domain which phosphorylates proteins responsible for regulating Ca2+ levels in the cell causing intracellular levels of the ion to increase. (C) Mechanical stimuli increase passive Ca2+ influx through the transient receptor protein channels increasing cytosolic Ca2+ concentrations. Elevated Ca2+ result in the activation of a calcium/calmodulin activated protein serine/threonine phosphatase known as calcineurin.

Calcineurin dephosphorylates the nuclear factor of activated T-cells (NFAT) transcription factor which interacts with the zinc finger transcription factor GATA4 resulting in the upregulation of a foetal gene program in cardiomyocytes which causes hypertrophy.

(24)

ANS activation results in the release of epinephrine and norepinephrine that bind β adrenergic receptors (β1AR and β2AR) in the cell membrane of CM’s. β1AR and β2AR binding increases cardiac contractility and relaxation through altered regulation of Ca2+

handling in CMs (Lymperopoulos, Rengo and Koch, 2013). The GPCRs activity of β1AR and β2AR activate the second messenger adenylyl cyclase (AC) through their enzymatic activity. An increase in activated AC increases intracellular levels of cyclic adenosine monophosphate (cAMP) which bind to protein kinase A (PKA) causing it to release its catalytic subunits (cPKA). cPKA phosphorylates a number of proteins involved in CM contraction and proteins responsible for Ca2+ handling which leads to elevated cytosolic Ca2+ levels (Fig 4 B).

Transient receptor potential channels (TRPC) are non-voltage gated cation channels that play a role in the response of CMs to mechanical stimuli (Nakayama et al., 2006; Nikolova- Krstevski et al., 2017). TRPCs present in the cell membrane of CMs contribute to an influx of Ca2+ to the cytosol (Fig 4 C) (Wu et al., 2010).

In each of the hypertrophic signalling pathways described, the elevation of intracellular Ca2+ activates an enzyme responsible for signal transduction in CMs, calcineurin (Fig 4) (Wilkins and Molkentin, 2002). Calcineurin is a calcium/calmodulin activated protein serine/threonine phosphatase. It is a heterodimer composed of a catalytic subunit (CnA) and a regulatory subunit (CnB) (Li, Rao and Hogan, 2011). Three different genes code for CnA (Fig 1 A and B), both CnAα and CnAβ are ubiquitously expressed in all tissues while CnAγ is expressed in the testis and brain (Crabtree, 1999; Rybakova, Patel and Ervasti, 2000). The CnA subunit contains three domains that regulate its activity, the CnB binding domain, a calmodulin-binding domain, a carboxy-terminal autoinhibitory domain as well as a domain that is responsible for its phosphatase activity (Medyouf and Ghysdael, 2008).

Calcineurin activity is dependent on elevated intracellular Ca2+ levels activating calmodulin, which binds to the calmodulin binding site present on the CnA subunit (Rusnak and Mertz, 2000). Calmodulin binding results in conformational changes in calcineurin that cause the autoinhibitory domain to be displaced. These conformation changes result in the exposure of calcineurin’s catalytic site which is responsible for the dephosphorylation of calcineurin’s target substrates (Klee, Ren and Wang, 1998). One of the main targets of calcineurin’s catalytic activity is the nuclear factor of activated T-cells (NFAT) family of transcription factors and specifically NFAT3c in the heart. When dephosphorylated,

(25)

NFAT3c trans locates to the nucleus, where it interacts with the zinc finger transcription factor GATA4. This leads to the upregulation of a foetal genes program including beta myosin heavy chain (β-MHC), brain natriuretic peptide (BNP), atrial natriuretic peptide (ANP) and α-skeletal actin (ACTA1) gene expression while the related adult isoforms are downregulated (Molkentin et al., 1998; Langenickel et al., 2000). Genes responsible for maintaining contractile function, including SERCA2a and phospholamban (PLN) are downregulated in pathological hypertrophy compounding contractile issues the heart is experiencing in disease states (Kranias and Hajjar, 2012).

Calcineurin Aβ1

Alternative splicing is a process that causes an alteration to the inclusion or exclusion patterns of introns and exons in the final mRNA transcript (Djebali et al., 2012). Alternative splicing causes variations in the amino acid sequence of the protein products translated from a single gene. This allows for the translation of protein products that have variations in conformation and functionality to those produced by constitutive splicing (Sharp, 2005).

CnAβ1 is an isoform of Cn that contains the catalytic domain, the CnB-interacting domain and the calmodulin binding region of other Cn isoforms but does not retain the autoinhibitory domain observed in the other Cn variants. This is the result of an alternative splicing event that involves the retention , in part, of intron 12-13 on the PPP3CB gene which occurs during its translation including an alternative polyadenylation site (Fig 1A) (Guerini and Klee, 1989; Lara-Pezzi et al., 2007).

The splicing event responsible for the translation of the CnAβ1 isoform is regulated by Muscle blind like (MBNL) RNA binding proteins (Gómez-Salinero et al., 2016). MBNL RNA binding proteins are a family of trans-regulatory elements that play a major role in preventing the reprogramming of cells to an embryonic state among other functions (Han et al., 2013). Two MBNL 1 binding sites exist on intron 12-13 of the PPP3CB gene coding for CnA which when transcribed results in the inclusion of a sequence from intron 12-13, including an alternative poly adenylation site which results in the translation of CnAβ1 (Fig 1B) (Gómez-Salinero et al., 2016).

(26)

CnAβ1’s C terminus provides it with a unique functionality that is distinct from other calcineurin isoforms. CnAβ1’s C terminus contains two α helixes, the second of which is responsible for the localisation of CnAβ1 to intracellular membranes, mainly the Golgi, through its interaction with Cog8 (Gómez-Salinero et al., 2016). The function of CnAβ1 was initially described in skeletal muscle were it was shown to act through the protein kinase B (AKT) pathway to inhibit the FoxO family of transcription factors by phosphorylation (Lara-Pezzi et al., 2007).

Figure 5. Calcineurin CnAα, CnAγ, CnAβ1 and CnAβ2 isoforms – (A) Calcineurin is a calcium- dependent phosphatase responsible for the dephosphorylation of NFAT and other transcription factors. CnAβ1 results from the inclusion of intron 12-13 in the PP3CB gene, which is translated into a unique C terminus at the expense of the autoinhibitory domain of traditional calcineurin isoforms. This unique C-terminus results in CnAβ1 having a distinct mechanism of action that involves the activation of the Akt signalling pathway.

More recent studies by our group demonstrate CnAβ1 is responsible for the localisation and activation of the mechanistic target of rapamycin complex 2 (mTORC2) at membranes

(27)

within the cell where CnAβ1 is present, this occurs independent of PI3K activation (Felkin et al., 2011; Gómez-Salinero et al., 2016). Activated mTORC2 is responsible for the phosphorylation of AKT (Zhao et al., 2016). In murine embryonic stem cells (mESC), CnAβ1 is required for activation of the AKT/GSK3b/b-catenin signalling pathway essential for the differentiation of mESCs to a mesodermal linage (Gómez-Salinero et al., 2016).

Calcineurin Aβ1 overexpression in the diseased heart

In the heart AKT promotes survival in CMs and also mimics the beneficial effects of preconditioning in I/R (Budas et al., 2006). Mice that overexpress CnAβ1 post I/R also demonstrated an improved angiogenic response in the infarct region that is the result of increased VEGF expression in CMs through AKT activation, an increased number of fibroblasts occupying the scar and ECM production, all of which contributed to prevent infarct expansion and preserve function (López-Olañeta et al., 2014). Felkin et al.

demonstrated that constitutive cardiac-specific overexpression of CnAβ1 had anti- inflammatory and antifibrotic effects that are mediated through growth differentiation factor 15 (GDF15), which is produced by CMs during heart failure and MI (Kempf et al., 2006;

Xu et al., 2006; Felkin et al., 2011).

CnAβ1’s overexpression in the hypertrophic heart has been shown to be the result of the induction of Activating transcription factor 4 (ATF4) which is responsible for increased amino acid biosynthesis and glutathione (GSH) production (Fig 6) (Padrón-Barthe et al., 2018). Induction of ATF4 by CnAβ1 is mediated through mTORC2 activation independent of endoplasmic stress and amino acid starvation (Felkin et al., 2011). CnAβ1 overexpression activates serine (Ser) and one-carbon (1C) metabolism through mTOR/ATF4 signalling (Padrón-Barthe et al., 2018). This alters CM metabolism post TAC to allow for the increased production of NADH and NADPH, preserved ATP production and the generation of metabolites essential for redox buffering including GSH (Yang and Vousden, 2016; Padrón- Barthe et al., 2018). Decreased GSH levels are associated with increased oxidative stress, cardiac remodelling and dysfunction post TAC (Watanabe et al., 2013). These results highlight the potential of CnAβ1 overexpression in the treatment of myocardial infarction and maladaptive cardiac hypertrophy.

Previous studies used transgenic animals to achieve a therapeutic level of CnAβ1 expression (Felkin et al., 2011; López-Olañeta et al., 2014; Padrón-Barthe et al., 2018). The ability to

(28)

transiently overexpress CnAβ1 during heart disease is essential to its potential application as a therapy in a clinical setting.

Figure 6. Calcineurin Aβ1’s signalling pathway – CnAβ1 phosphorylates the mTORC2 complex on the membrane of the Golgi within the cell. mTORC2 phosphorylates AKT which induces the transcription factor ATF4. Induction of ATF4 is responsible for an increase in amino acid biosynthesis and glutathione

production, essential for minimising the effect of maladaptive hypertrophy on CMs including a reduction in pathological remodelling and maintaining homeostatic cardiac function in the diseased heart.

(29)

Adeno associated virus as a vector to overexpress proteins in the heart

Nucleic acid based therapies are an emerging tool that can be used in various applications to alter gene expression in patients with the objective of improving clinical outcomes. These approaches include the use non-viral nucleic acid therapies as well as recombinant viral vectors modified to induce or inhibit the expression of a target gene. Recombinant adeno associated virus (rAAV) vectors are an example of viral gene therapies which have been used to achieve altered target gene expression in a clinical setting for over two decades (Flotte et al., 1996; Lu, 2004). A major reason for its continued use is its limited pathogenicity with no confirmed pathologies (Smith, 2008).

Adeno associated virus (AAV) was first identified as a contaminant of adenovirus preparations (Hoggan, Blacklow and Rowe, 1966). AAV is a member of the parvovirus family and is made up of a protein capsid, composed of three viral capsid proteins (Vp), Vp 1, Vp 2 and Vp 3, and a small piece of single stranded DNA of approximately 4.7 Kbp (Naso et al., 2017). The genome size of wild type AAV (wtAAV) is also indicative of the optimum genome size of any rAAV vectors expression cassette. 80% of rAAV constructs with a genome size of over 5 kbps are shown to have deletions of their sequence when recovered from transduced cell lines while only 7% of rAAV genomes between 3-4 kbps demonstrate deletions (Dong, Nakai and Xiao, 2010). Packaging efficiencies of rAAV genomes into the viral capsids are also compromised when rAAV genomes are oversized making production and transduction less efficient (Dong, Fan and Frizzell, 1996).

The single stranded DNA genome in AAVs is flanked by inverted terminal repeats (ITRs) that are self-complementary palindromic sequences at both the 5’ and 3’ end of the viral genome (Ashktorabt et al., 1989). The genome between the ITRs contains 3 open reading frames (ORFs) with the Cap ORF coding for the various VPs present in the capsid (Sonntag, Schmidt and Kleinschmidt, 2010). The rep ORF codes for four non-structural proteins, Rep 40,52,68 and 78, that are responsible for various elements of the wild type virus’s life cycle including viral replication, transcription, integration into the host genome and assembly (Kotterman and Schaffer, 2014). An alternative ORF on the cap gene is responsible for the expression of the assembly-activating protein (AAP) which is vital for the assembly of the viral particle from the constituent VPs (Sonntag, Schmidt and Kleinschmidt, 2010).

The sequence of VPs in the capsid gives each AAV a specific capsid topography which determines the serotype of the AAV in question and the relative tissue tropisms associated

(30)

with that AAV serotype (Wu, Asokan and Samulski, 2006). Numerous studies have indicated that Serotype 9 or AAV9 has the highest heart specific tropism when compared to other commonly used AAV serotypes, and it also demonstrates increased genome copy number and higher expression of reporter genes in various animal models (Pacak et al., 2006; Bish et al., 2008; Zincarelli et al., 2008). AAV9 has also demonstrated effective cardiac transduction and safety as a vector for human gene therapy (Katz et al., 2014). This provides context for the decision to use AAV9 as the vector to overexpress CnAβ1 in this study.

AAV9 uses glycans on the cell surface with terminal β-galactose residues as a binding site on the target cell surface (Shen et al., 2011). AAV9 binding to β-galactose residues occurs through hydrophobic interactions between the aromatic rings in two specific tryptophan and tyrosine residues on the AAV9 capsid combined with hydrogen bonding between the hydroxyl group of the sugar residue and a number of asparagine residues (Fig 7 B) (Bell et al., 2012).

After receptor binding, the AAV9 vector undergoes endocytosis (Dudek et al., 2018).

Endocytosis of the AAV/receptor complex is clathrin mediated; however, Weber et al.

demonstrated evidence of non-clathrin dependant endocytosis occurrences as well (Fig 7 C) (Nonnenmacher and Weber, 2011; Uhrig-Schmidt et al., 2012). The VP1 capsid protein of AAV contains a parvoviral phospholipase A2 motif whose catalytic activity is exploited to allow the AAV to leave the endosome and enter the cytosol (Fig 7 D) (Girod. A. et al. 2002).

Current understanding of AAV nuclear localisation is limited to a number of serotypes in particular AAV2. Post endosome release, most AAV particles build up in the perinuclear space and undergo proteasome degradation (Li et al., 2013). There is evidence to suggest that VP1 contains a motif that acts as a nuclear localisation sequences (Grieger, Snowdy and Samulski, 2006). AAV9 particles that do not accumulate in the perinuclear space, they use their NLS to bind the chaperone protein, β-importin, that transports them to the nucleus through the nuclear pore complex (Fig 7 D & E) (Nicolson and Samulski, 2014).

Upon nuclear localisation, a small number of wild type AAV genome copies undergo integration at chromosome 19, a site conserved across species (Kotin et al., 1990). AAV uses the cellular mechanisms and machinery used to repair double stranded breaks in the host genome to achieve integration while it waits for co infection with a helper virus to allow for effective replication (McCarty et al., 2004).

(31)

However the majority of rAAV and wild type AAV genomes remain episomal (Naso et al., 2017). Non-integrated viral genomes are converted from ssDNA into double stranded DNA by utilising the self-priming ITRs which allow for replication of the viral genome (Berns and Linden, 1995). Over time, linear rAAV genomes are converted to circularised structures and eventually form end to end concatemers in situations where a high number of viral genomes are present (Duan et al., 1998; McCarty et al., 2004).

Figure 7. Recombinant adeno associated virus vector cellular entry and expression– (A)

Systemic administration of an rAAV vector some of which are bond by neutralising antibodies in circulation if present. (B) rAAV binds to glycans on the cell surface with terminal β-galactose residues as a binding site on the target cell surface. (C)Endocytosis of the AAV/receptor complex occurs. (D-E) Parvoviral

phospholipase A2 activity of the capsid proteins allow rAAV to leave the endosome and enter the cytosol were the chaperone protein β-importin transports them to the nucleus through the nuclear pore complex where the rAAV genome undergoes transcription.

(32)

OBJECTIVES

2

(33)

46

OBJECTIVES

1. To examine the ability of AAV9-CnAβ1 to overexpress CnAβ1 in a tissue specific manner after systemic administration.

2. To examine the effect of CnAβ1 overexpression achieved using AAV9-CnAβ1 administration on cardiac function and pathological remodelling in a murine model of ischemic reperfusion injury.

3. To examine the effect of CnAβ1 overexpression achieved using AAV9-CnAβ1 administration on cardiac function and pathological remodelling in a murine model of aortic stenosis.

(34)

48

MATERIALS AND METHODS

3

(35)

50

MATERIALS AND METHODS

Animal care and ethics

We used adult, male C57BL/6 mice in our studies. All experiments using mice were approved by the local ethics committee at the Centro Nacional de Investigaciones Cardiovasculares and by the Comunidad de Madrid. The investigation conforms to the principles of Laboratory Animal Care, which are formulated by the National Society for Medical Research and the Guide for the Care and Use of Laboratory Animals (US National Institutes of Health Publication 85-23, 1996).

rAAV construct

The improved outcomes observed in transgenic animals overexpressing the CnAβ1 in a number of surgical models of heart disease have implicated CnAβ1 as a potential therapeutic target. In this study a gene coding for CnAβ1 was used in a vector construct that when translated leads to the overexpression of CnAβ1 (Fig 8 A). The benefits of overexpressed CnAβ1 in aortic stenosis and MI is dependent on its expression in CMs (Felkin et al., 2011; López-Olañeta et al., 2014; Padrón-Barthe et al., 2018). The cardiac specific tropism of AAV9 and the expression cassettes capacity of 4.7 kbs provided a platform to explore the potential of CnAβ1 overexpression to treat various CVD diseases when.

Any potential AAV therapy utilising transient CnAβ1 overexpression in these conditions required the presence of a cardiac specific promoter in order to drive expression in CMs specifically. A truncated chicken cardiac troponin T promoter (cTnT) was chosen for the vector genome in this study due to extensive evidence of its capacity to drive the expression of a transgene with an increased cardiac specificity when used in combination with an AAV9 serotype (Fig 8) (Konkalmatt et al., 2013). An internal ribosome entry site (IRES) allowed for the polycistronic transcription of multiple genes and as such are used to co express reporter genes in the presence of the primary transgene being investigated (Martínez-Salas, 1999). The co expression of genes regulated by an IRES remains effective as an element of a functional rAAV construct (Fan et al., 1998). In this study the IRES was used to drive the expression of the reporter gene luciferase (Fig 8). Luciferase is an enzyme that oxidises it substrate, D- Luciferin, and produces a luminescent product that can be used to visualise the expression of

(36)

51

the vector genome. In this study this activity was used to monitor the distribution and expression of the construct in different tissues. A simian virus polyadenylation signal was used as a terminator sequences in the vector construct as it allowed for an increase in the stability of the mRNA transcript increasing protein synthesis (Salem et al., 2015). ITRs were present on the vector genome as they allowed for the packaging of a rAAV vector genomes in various capsid serotypes and their presence was required during the manufacturing process (Chiorini, Afione and Kotin, 1999). ITRs also play a role in vector genome persistence and preventing epigenetic downregulation of the construct (Berns and Muzyczka, 2017).

A gene coding for green fluorescent protein (eGFP) was used in the place of CnAβ1 as a secondary reporter gene present on a vector genome otherwise identical to that of AAV9- CnAβ1, this was used as a control vector in throughout this study. This vector was classified throughout this study as AAV9-GFP (Fig 8 B).

Figure 8. AAV9-CnAβ1 construct schematic - (A) Schematic of the AAV9-cTnT-CnAβ1-IRES-Luc construct produced using a dual plasmid system in HEK293T cells. The plasmid contains the relevant inverted terminal repeats (ITRs) of AAV2, a chicken cardiac Troponin T promoter (cTNT), the transgene calcineurin Aβ1(CnAβ1), an internal ribosome entry site (IRES) which drives expression of Luciferase, which is used as a reporter gene, and a Simian Virus 40 poly A tail (SV40pA). (B) Control virus construct used, which comprises an AAV9 vector including the 5’ITRs, eGFP, IRES, Luciferase, SV40 pA and 3’ITR.

(37)

52

rAAV production

Wild type AAV require the presence of a helper virus in order to effectively replicate in host cells. rAAVs typically lack the genetic components required to function even in the presence of a helper virus as the lack the rep and cap genes essential for AAV replication. The rep gene that encodes for proteins used in viral replication and the cap gene, which encodes for the capsid proteins of AAV are both present on the Rep/Cap packaging plasmid. The adenovirus helper plasmid contains genes that would typically be present in the cell through co infection, these include E2a, E4, and VA genes (Xiao, Li and Samulski, 1998). HEK293T cell lines provide the addition genetic information essential for rAAV replication as the cell line contains both E1a and E1b genes required for rAAV production (Xiao, Li and Samulski, 1998).

HEK293T cells were grow to 80% confluence in Dulbecco’s modified Eagle’s media (DMEM- 10) at 37 o C at 5% CO2. Rep/Cap packaging plasmid, adenovirus helper plasmid and transgene plasmid DNA, at a concentration ratio of 1:1:1, was added to room temperature Reduced- Serum Medium Opti-MEM. Separately, Polyethyleneimine hydrochloride (PEI Max) [1 mg/ml] was added to Opti-MEM at room temperature. The Opti-MEM/pDNA mixture was added to the Opti-MEM/PEI-Max mixture at a ratio of 2 µg of PEI Max to 1 µg of DNA and incubated for 15 minutes at room temperature. This mixture was then applied to HEK293T cells for 24 hours in the incubator. The cell media was replaced after 24 hours and the cells were allowed to incubate for another 48 hours (Chen, Keiser and Davidson, 2018). The cells were harvested us and the cell suspension and media were pooled into conical tubes and spun at 300 x g for 10 min at 4 o C. Cells were resuspended in buffer and underwent three cycles of freezing on dry ice and thawing in a 37 o C water bath in order to allow cell lysis to occur.

In order to purify the rAAV particles, iodixanol solutions of 60%, 40%, 25% and 15% were loaded onto a quick seal tube using a 10 ml syringe with a 14-gauge needle. An interface between each concentration was formed. Cell lysate was slowly loaded onto the top layer of 15% iodixanol slowly in order to avoid disturbing the gradient using a 10 ml syringe with a 14- gauge needle. The quick seal tube was closed and centrifuged at 350,000 × g for 1 hr. The ultracentrifugation of the cell lysate through an iodixanol gradient separates the rAAV particles from the lysate based on its density.

An 8-gauge needle was used to remove the rAAV particles that was present in a band slightly below the interface between 40% and 60% iodixanol (Sena-Esteves and Gao, 2020). rAAV vectors were further purified by loading the sample onto a MWCO 10,000 Slide-A-Lyzer

(38)

53

dialysis cassette in a litre of PBS which was changed once after 2 hours at 4 ° C (Choi et al., 2006).

Administration of AAV vectors

After being thawed on ice, each preparation of AAV9-CnAβ1 particles was formulated in a laminar flow hood and prepared to the appropriate concentration using Braun physiological saline solution (0.9% NaCl). Doses were prepared in 50 µl of solution using a 31-gauge needle which was heated to 37 ° C directly before administration.

For tail vein administration of the virus, mice were placed in a restraint that restricted movement and allowed access to the tail. Using a warming pad to increase circulation, the area was sterilised with ethanol, the needle was slowly inserted into the tail at a 15⁰ angle and the solution was injected slowly into the tail vein. For femoral vein injection, animals are anesthetised using 5% isoflurane with 100% oxygen. The area around the femoral vein on the inner thigh had its hair removed and was sterilised with 70% ethanol.

The skin and soft tissue above the femoral vein was opened using sterile surgical tools. Using a q tip, pressure was applied to the femoral vein above the injection site to enlarge it. The needle was slowly entered into the vein at 15⁰ angle and its contents slowly injected as to avoid loss of dose. Pressure was then reapplied until bleeding stopped. The skin was sutured to close the wound. For the entire procedure, animals were maintained on a heating pad at 37⁰C until out of anaesthesia.

Myocardial infarction Surgery

Ischemic reperfusion (I/R) was the model of MI used in this study and is achieved through the temporary ligation of the left anterior descending branch (LAD) of the left coronary artery to induce ischemia followed by reperfusion which induces a reperfusion injury (Michael et al., 1995; Lara-Pezzi et al., 2015). I/R provides a model in which the acute inflammation response related to reperfusion can be observed (Michael et al., 1995).

Pre surgery, adult C57B/L6 mice had the hair removed from their chest and upper abdomen and the skin disinfected with ethanol. The procedures were carried out with mice intubated and placed under mechanical ventilation with 3-3.5% sevoflurane administered with 100% oxygen.

Myocardial infarction was induced by the ligation of the LAD coronary artery for 30 minutes

(39)

54

followed by reperfusion of the artery. Tissue layers were sutured closed after completion of the reperfusion. Mice were administered buprenorphine (0.1 mg / kg s.c.) for 5 days post-surgery.

Trans Aortic Constriction Surgery

In this study, a murine model of aortic stenosis in which pathological hypertrophy is induced by pressure overload was used (deAlmeida, van Oort and Wehrens, 2010). Trans aortic constriction (TAC) is a validated model that initially results in compensatory hypertrophy which progresses to maladaptive hypertrophy, cardiac dilatation and heart failure over a gradual time course which provides a platform to examine the clinical potential of any intervention as it replicates the human pathology (Rockman et al., 1991; Lara-Pezzi et al., 2015).

The induction of pressure overload was performed by constriction of the aorta, trying to reproduce human aortic stenosis (Lara-Pezzi et al, 2015). Mice were anesthetized using 3-3.5%

sevoflurane administered with 100% oxygen, intubated and maintained with mechanical ventilation during the procedure. For the surgery, the animals' hair was shaved, the skin was disinfected with ethanol and an incision was made in the thorax that allowed visualization of the aorta. For aortic constriction, a non-resorbable polyfilament suture was tied around the aorta and a blunt 27-gauge needle was used. The ligation was performed in the aortic arch between the carotid artery and the innominate artery. After ligation, the 27-gauge needle was removed, leaving the aorta constricted to the diameter of the needle. Subsequently, the muscular layers and the skin were sutured to close the animal's thorax. All animals received a dose of buprenorphine (0.1 mg / kg) as analgesia for 3 days following the procedure.

Echocardiographic Analysis

Transthoracic ultrasounds were performed and blindly analysed by a cardiac specialist at 5 and 21 days after surgery in all treatment groups of mice that took part in the trans aortic constriction study, and 5 and 28 days after surgery for those animals that underwent myocardial infarction. The animals were anesthetized with isoflurane between 1-1.5% administered with 100% oxygen, the heart rate was monitored and animals were placed on a surface at 37 ° C to preserve body temperature. During ultrasound, the percentage of anaesthesia was adjusted in order to obtain a heart rate of 500 ± 50 beats per minute (bpm). Images were acquired in Two- dimensional (2D) and M-mode in a long and short view at the level of the papillary muscles using a high-resolution ultrasound with a transducer of 30Mhz (Vevo 2100, VisualSonics Inc.,

(40)

55

Canada) (Lang et al., 2005; López-Olañeta et al., 2014). After the procedure, the animals were placed in an isolated box illuminated with red light until they awakened, to ensure their correct recovery and maintenance of their body temperature.

In Vivo Imaging

Mice were prepared for in vivo imaging by having the hair from their chest and upper abdomen removed. Mice were anaesthetised using 3-3.5% Isoflurane and, using a 25-gauge needle, were administered a single dose of 100 µL (150 mg/kg) of D-Luciferin intraperitoneally. 8 minutes after the administration animals initial image acquisition occurred using an exposure of 30-45”

in a Lumina in vitro imaging system (IVIS) while animals were still under anaesthesia. The animals were then sacrificed and heart, liver, kidney, spleen, lung and skeletal muscle were extracted. 50 µl of Luciferin were added to the tissues and images were acquired over 30-45”

exposure. Bioluminescence was represented as an artificially generated colour where intensity of signal is represented on a scale from violet (minimum) to red (maximum) with signal quantified as photons emitted/second/cm2/steradian (p/sec/cm2/sr).

Tissue harvesting

Mice were sacrificed by gradually filling a chamber with CO2. After sacrifice of the mice while the heart is still beating, a 23-gauge needle was used to perfuse the posterior basal region of the ventricle heart with 0.5 ml of 30mM KCl in PBS until the heart stopped in diastole (Virag and Lust, 2011). Liver, lung, spleen, skeletal muscle and kidney were excised from the animal, samples were collected and snap frozen in liquid nitrogen. Cardiac tissue was taken from the left ventricle infarcted region, the remote area and the border regions in infarcted animals and from the LV free wall in mice that underwent transaortic constriction. Samples were frozen in liquid nitrogen and stored at -80 ° C.

RNA isolation

Tissue stored at -80 o C was crushed using a pestle and mortar on dry ice. Powdered tissue was added to 1ml of Trizol reagent. Using a Qiagen tissue homogenizer, tissue was homogenized and incubated at room temperature for 5 minutes. 200 µl of chloroform was added to sample and the sample was inverted vigorously and incubated for 10 minutes at room temperature.

The samples were spun at 12,000 × g for 15 minutes at 4℃. The treated sample separated into two distinct phases were RNA was present in the clear aqueous phase. The aqueous phase was

(41)

56

retained and 1 ml of 75% ethanol was added to the sample and centrifuged at 7500 × g for 5 minutes at 4 o C. The supernatant was discarded and the pellet was allowed to air dry. The sample was resuspended in 20 µl of RNase free water. An additional RNA precipitation step was carried out on all samples to fully remove phenol from the sample. 2 µl of 3M Sodium Acetate was added to the sample in order to allow for the RNA to precipitate from solution. 20 µl of Isopropanol was added to the sample which enhances the precipitation of nucleic acids from solution ensuring that any loss of sample was minimised. The sample were centrifuged at 14,000 × g at 4 o C and the resulting pellet was washed using 70% ethanol. Once dried the sample was resuspended in 20 µl RNase free water.

cDNA synthesis

cDNA was synthesised using 100 ng of isolated total RNA per sample and the Applied Biosystems High Capability cDNA Reverse Transcription kit. The Applied Biosystems High Capability cDNA Reverse Transcription kit uses primers that hybridise randomly in the reverse transcription reaction to syntheses cDNA. Samples were run at 25 o C for 10 minutes, 37 o C for 120 minutes, 85 o C for 5 minutes and held at 4 o C until removed from the Thermo Cycler.

Quantitative Real Time PCR

Quantitative Real Time PCR (qRT-PCR) was carried out on the Applied Biosystems 7900. Fast real time PCR kit was used to prepare the samples with SYBR green probes (Table1) and TaqMan probes (Table 2) added to the reaction were appropriate to amplify the corresponding cDNA sequence. The results were exported from Applied Biosystems SDS software package and analysed using LinReg PCR. Relative Units of expression were normalized with GAPDH (Ruijter et al., 2009).

Histological analysis

Organs analysed by histology were fixed in 4% PFA / PBS for 16 h and subsequently washed, dehydrated and embedded in paraffin. 5 µm-thick sections of the tissue were cut. To determine the presence of fibrosis in cardiac tissues, Masson’s trichrome staining was performed.

Quantification of interstitial fibrosis was performed in two different regions of each heart at 40X magnification with ImageJ software. Perivascular fibrosis was quantified in two different regions per heart at a magnification of 40X and was normalized by vessel diameter for each section. Masson’s trichrome stained heart sections were used to determine scar length through

(42)

57

the midline method (Takagawa et al., 2007). The length of the midline of the infarcted wall were more than 50% of the wall is composed of infarct scar tissue is measured and expressed as a percentage of the whole left ventricular circumference.

Statistical analysis

All data have been presented as mean ± SEM as indicated in the legend of the figures. CnAβ1 expression in organs was analysed by one-way ANOVA followed by Dunnett’s post-test. In the all other data, an unpaired parametric T-Test was used to test for statistically significant difference between groups. The changes were considered significant at p <0.05. All data was analysed using GraphPad Prism 6 (Graph pad Software, Inc.).

(43)

58

Table 1. Sequence of the SYBR green primers used in qRT-PCR

Name Forward Sequence Reverse Sequence

CnAβ1 ATGCTGTTTCCTTCCTCTGC GACTGAACCAAGTGCAGCAA

CD31 AATGGCAACTGGAGCGAGCACT GGAGAAGGCGAGGAGGGTTAGGT

Table 2. TaqMan probes used in qRT-PCR

Gene TaqMan Primer (Applied Biosystem)

Acta1 Mm00808218_g1

BNP/Nppb Mm01255770_g1

Col1a1 Mm00801666_g1

Lox Mm00495386_m1

Thy1 Mm00493681_m1

Acta2 Mm01204962_gh

Gapdh 4352339E

Luciferase Mr03987587_mr

(44)

60

RESULTS

4

(45)

62

RESULTS

AAV9-CnAβ1 overexpresses CnAβ1 in cardiac tissue of adult mice after systemic administration

In vivo imaging of bioluminescence allows for the imaging and qualification of the enzymatic activity of luciferase in the presence of D-Luciferin, the enzymatic substrate of luciferase. To examine the presence of functional luciferase and as such the expression of the vector construct, adult C57BL/6 mice were injected with AAV9-CnAβ1 at a dose of 3.5e10 VP (Viral Particles) (n=5) systemically via femoral vein at day 0. 21 days post AAV9-CnAβ1 administration animals the received the vector (n=5) and a control group of adult C57BL/6 mice (n=5) that received no virus underwent in vivo imaging.

Figure 9. In vivo imaging of bioluminescence as a result of Luciferase activity 28 days after the systematic administration of AAV9-CnAβ1 - Visualisation of bioluminescence present after IP injection of D-Luciferin in adult male C57BL/6 mice that received no virus (A) and 3.5e10 VP (E) of AAV9- CnAβ1 exposed for 30-45” for image acquisition. After image acquisition the animals were sacrificed and D- Luciferin was topically administered to the organs (kidney, spleen, lung, skeletal muscle, heart) of animals that received no virus (B) and 3.5e10 VP of AAV9-CnAβ1 (F). Animals that received AAV9-CnAβ1 at a dose of 3.5e10 VP had observable bioluminescence in heart (F and G) and liver (F and H) tissues respectively while the heart of animals that receive no virus showed no bioluminescence in heart (B and C) and liver (B and D).

Mice that received no virus demonstrated no bioluminescence upon image acquisition as there no endogenous expression of luciferase occurs in C57BL/6 mice (Figure 9 A). Upon completion of the image acquisition animals were sacrificed and the organs were analysed for

(46)

63

presence of bioluminescence. Additional D-Luciferin was topically applied to the harvested organs and again no bioluminescence was observed in spleen, skeletal muscle, kidney (Figure 3B), liver (Figure 9B and D) and heart (Figure 9B and C) of animals that did not receive systemic dose of AAV9-CnAβ1. This indicates a lack of functional luciferase in any tissues.

In mice that received a 3.5e10 VP dose of AAV9-CnAβ1, bioluminescence at a range of intensities (5.09e5 – 2.00e6 p/sec/cm2/sr) was observed in the upper abdominal region of the torso (Figure 9 E). Upon completion of the initial imaging, the animals were sacrificed and their organs were analysed for bioluminescence after the additional administration of D- Luciferin.

Figure 10. AAV9-CnAβ1 drives luciferase expression in adult male C57BL/6 mice

Luciferase expression was observed in the skeletal muscle (S. Muscle), liver and heart 21 days post administration of 3.5e10 VP of AAV9-CnAβ1. AAV9-CnAβ1 drives luciferase expression in a cardiac specific manner however luciferase expression also occurs in the livers of mice that received AAV9-CnAβ1 indicating the presence of functional vector genomes. Skeletal muscle demonstrates no luciferase expression. Data are represented as mean fold induction ± SEM. # P <0.05 skeletal muscle versus liver, ** p <0.01 skeletal muscle versus heart, † P <0.05 liver v heart, One-way ANOVA followed by a Dunnett’s post-test (n=5).

Referencias

Documento similar