Effects of UV B radiation on anatomical characteristics, phenolic compounds and gene expression of the phenylpropanoid pathway in highbush blueberry leaves
11
0
0
Texto completo
(2) 86. C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. ozone, the principal agent absorbing UV radiation in the Earth's atmosphere (Russell et al., 1996). UV-B radiation induces diverse morphological, physiological and molecular responses in plants (Casati and Walbot, 2003; Zu et al., 2010). A high UV-B dose provokes damage to macromolecules such as DNA, RNA and proteins, reduces net photosynthesis and modifies the activities of some antioxidant enzymes (Britt, 1995; Ries, 2000; Feng et al., 2003; Agrawal et al., 2009). However, plants have developed several defensive strategies to cope with high UV-B radiation. Recently, at the molecular level the UV-B photoreceptor UV RESISTANCE LOCUS 8 (UVR8) in Arabidopsis thaliana has been identified. This receptor triggers morphological changes, antioxidant mechanisms, photorepair and accumulation of UV-B photoprotective compounds (Rizzini et al., 2011; Heijde and Ulm, 2012). Plants may attenuate the impact of UV-B radiation through the accumulation of different types of phenolics produced in the phenylpropanoid pathway (Rozema, 1999). Additionally, plants subjected to UV-B radiation respond by altering the anatomy of the leaves, which can act as an effective UV-B screen (Ruhland and Day, 1996). Depending on the species or genotype, the increase or decrease in the thickness of the epidermis of the leaf modifies the response to high UV-B doses and is considered a defense strategy according to Jansen et al. (1998) and Kakani et al. (2003a,b). Studies performed in Vaccinium myrtillus report that leaf thickness increases under elevated UV-B radiation (Phoenix et al., 2001). Moreover, under enhanced long term UV-B exposure, a decrease in adaxial trichome density in Vaccinium uliginosum has been observed (Semerdjieva et al., 2003). However, these effects on leaf morphology are not generalized in other Vaccinium species (Semerdjieva et al., 2003). On the other hand, a permanent discoloration is observed only of V. myrtillus leaves, due to a reduction in the chlorophyll content, while in leaves of Vaccinium vitis-idaea the chlorophyll content does not change significantly (Robakowski, 1999), suggesting different strategies to cope with UV-B radiation within the Vaccinium genus. Diverse abiotic stresses trigger the synthesis of a large class of secondary phenylpropanoid metabolites (Dixon and Paiva, 1995). In some plant species subjected to high doses of UV-B, a stimulation of the biosynthesis of UV-B absorbing and photoprotective compounds and carotenoids, has been observed (Campos et al., 1991; n et al., 2011). It is important to note that Gitz et al., 2004; Fabo the phenylpropanoid compounds induced by abiotic stresses, including UV-B radiation, are accompanied by raised transcriptional levels of a network of genes, such as L-phenylalanineammonia-lyase (PAL), chalcone synthase (CHS) and anthocyanidin synthase (ANS). These genes are regulated by transcription factors such as MYB (Davies and Schwinn, 2003; Zifkin et al., 2012). For example, the VvMYBF1 transcription factor has been described as a specific regulator of flavonol synthesis in grapevine (Czemmel et al., 2009) and the expression of its homolog in Arabidopsis is regulated by UV-B stress, through the UVR8 protein (Cloix and Jenkins, 2008; Rizzini et al., 2011). Chalcone synthase catalyses a key step in flavonoid biosynthesis. This enzyme follows an isomerization by chalcone isomerase to form a flavonone. Moreover, anthocyanidin flavinium ions are produced by ANS and then glycosylated by UDPGlc:flavonoid-3-O-glycosyltransferases (UFGT). The anthocyanidins can be diverted into proanthocyanidin (PA) synthesis via anthocyanidin reductase (ANR), which produces epicatechin-type flavan3-ols. In addition, MYB is also involved in the regulation of the metabolism of phenypropanoid compounds such as flavonoids in red apples and grape vines, subjected to sunlight (Takos et al., 2006; Matus et al., 2009) and proanthocyanidins in poplar under UV radiation (Mellway et al., 2009). In grape fruit has been reported VvMYBA1 which control the anthocyanin accumulation (Kobayashi et al., 2002). Likewise, two other MYBs (VvMYBPA1 and VvMYBPA2) regulate proanthocyanidins synthesis in the same plant species. (Bogs et al., 2007; Terrier et al., 2009). Similar regulation by VcMYBPA1 was observed in Vaccinium corymbosum (Zifkin et al., 2012). Highbush blueberry (V. corymbosum L.), is one of the most economically important crop species in southern Chile. Benefits attributed to human health of this species are associated mainly to the high content of polyphenols, especially flavonoids, which confer high antioxidant activity in fruits and leaves (Rasmussen et al., 2005; Wu et al., 2006; Inostroza-Blancheteau et al., 2011a). Furthermore, the antioxidant capacity and anthocyanin contents of highbush blueberry fruits grown in southern Chile surpass those of fruits grown in the northern hemisphere (Ribera et al., 2010). However, little is known about how this plant species copes with increased UV-B radiation, in terms of its effects on anatomical and metabolic responses and its influence on the transcriptional regulation of the phenylpropanoid pathway. 2. Materials and methods 2.1. Plant material and growth conditions Two genotypes of the most-commonly cultivated highbush blueberry in southern Chile were selected for this study (Brigitta and Bluegold). One-year-old saplings of these genotypes were provided by the “San Luis” farm located in Lautaro, Araucanía Region, and grown in a 3 L pot and solid substrate (1 oat: 1 shell sawdust: 1 pine needles). The plants were acclimated under greenhouse-controlled conditions of 25/20 C (day/night), photoperiod of 16/8 h (light/dark), 70% relative humidity and a mean photosynthetic active radiation (PAR) of around 500 mmol m2 s1 at midday, for two weeks. Then plants were subjected to the UV-B treatment and for all determinations fully developed leaves were used. 2.2. UV-B treatment The experiment was completely randomized with 2 genotypes and 4 treatments: No ultraviolet-B radiation (-UV-B control) or a maximum of 0.07, 0.12 or 0.19 Wm2 of biologically effective UV-B radiation was applied at midday (see below) for 0, 6, 24, 48 and 74 h. The maximum UV-B radiation in winter is 0.07 Wm2 and 0.12 Wm2 in summer. Simulating an eventual increase of 30% over the summer values of 0.19 Wm2 of UV-B radiation was used. The UV-B radiation (280e320 nm) was provided by 40 W UV-B lamps (Q-Panel 313, Cleveland, Ohio, USA). To prevent UV-C radiation, the lamps were wrapped with 0.08 mm thick cellulose diacetate film placed at 40 cm from the top of plants. Under this condition the transmitted energy is 57% of UV-B and only 5.7% UV-A radiation. Lamps were programmed with timers (model Temp-24 H, Santiago, Chile) simulating a daily course of UV-B radiation corresponding to the summer season in southern Chile (38 460 S), with 11 h of exposure (9:00 to 20:00 h), and a maximum peak of irradiance at midday (De los Ríos et al., 2007, 2010). The PAR was obtained using metal halide lamps (400 W, Phillips, Eindhoven, The Netherlands). PAR was maintained around 500 mmol photons m2 s1 during most of the day photoperiod. The intensity, duration and dose of UV and UV-B radiation were determined using a portable spectroradiometer (Li-Cor1800, Lincoln, NE, USA). 2.3. Leaf anatomical analysis The changes in leaf anatomy under UV-B radiation were observed by optical microscopy. Center sections of the leaves were fixed rapidly in formaldehyde, acetic acid and ethanol (FAA), for 48 h and preserved in 70% ethanol (v/v). Cross-sections of 8 mm of.
(3) C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. the leaves were stained with safranine fast green and mounted in water-glycerol and finally examined by microscopy (Olympus, SZX7, Tokyo, Japan). The leaf anatomical measurements were analyzed using Q-Capture Pro 5.0 software. The width of the adaxial epidermis (ADE), palisade (P), mesophyll (M), intercellular cavities (IC) and abaxial epidermis (ABE) cell layers, after 72 h of treatment without or with UV-B radiation (0.19 Wm2), were measured. 2.4. Lipid peroxidation measurements In fresh leaves previously stored at 20 C, lipid peroxidation was measured using the thiobarbituric acid reacting substances (TBARS) assay according to Heath and Packer (1968). The absorbance was measured at 532, 600 and 440 nm in order to correct for the interference generated by TBARS-sugar complexes, as described by Du and Bramlage (1992). 2.5. Leaf chlorophyll and carotenoid concentrations Fully expanded leaves of blueberry subjected to UV-B radiation were removed and homogenized in cooled 96% ethanol, and then centrifuged at 10,000g for 10 min at 4 C in the dark according to Lichtenthaler and Wellburn (1983). The absorbance of the ethanol extracts was measured at 470, 649 and 665 nm by spectrophotometry (Thermo Scientific Spectronic Genesys 10 UV-Vis Scanning, Madison, WI, USA) and pigment concentrations were calculated as described (Lichtenthaler and Wellburn, 1983).. 87. 20e25 min of 100% B. The method of Nyman and Kumpulainen (2001) based on the determination of anthocyanidins (anthocyanin aglycones) was used for the anthocyanin analysis. Delphinidin, malvidin, petunidin, cyanidin and peonidin were used as anthocyanidin standards (Sigma Chemical Co.). For anthocyanin analyses, leaf samples (0.3 g) were extracted with 3 mL of acidified ethanol. Signals were detected at 530 nm. The mobile phase was composed of acidified water (acetic acid 10%) (A) and 100% acetonitrile (B) with the following eluent gradient: 0e23.9 min of 90% A/10% B, 23.9e24.1 min of 80% A/20% B, 24.1e27 min of 20% A/80% B, and then 27.1e37 min of 90% A/10% B.. 2.8. RNA isolation and cDNA synthesis Total RNA was extracted from approximately 250 mg frozen blueberry leaves as described Inostroza-Blancheteau et al. (2011b). RNAse-free DNAase I (Invitrogen) was used to remove contaminating genomic DNA. The integrity of the total RNA was checked by formaldehyde denaturing gel electrophoresis, and the concentration was measured spectrophotometrically using a NanoDrop instrument (NanoDropTM 1000; Thermo Scientific, Wilmington, VA, USA). The purity of the total RNA obtained was assessed using the A260/A280 and A260/A230 ratios. The first-strand of cDNA was synthesized from 1.0 mg total RNA using 200 U Superscript II reverse transcriptase (Invitrogen) and 1 mL oligo-dT25 (700 ng1).. 2.6. Total phenolics and anthocyanin contents in leaves. 2.9. Quantitative real-time PCR analysis. The total phenolic content was determined by the FolineCiocalteu method (Slinkardand Singleton, 1977) using chlorogenic acid as standard. Leaf samples were macerated with methanol (80% v/v), and the extract was centrifuged at 10,000g for 5 min at 4 C and the supernatant stored at 4 C until use. The reaction was measured by spectrophotometry at 765 nm and the results are expressed in mg of chlorogenic acid equivalents (CAE) per gram of fresh weight (FW). The extraction of anthocyanins was performed by hydrolysis method according to (Nyman and Kumpulainen, 2001). Briefly, 0.1 g of sample was macerated in a cold mortar, and adding 1 mL of acidified methanol. The extract was measured by spectrophotometry at 530 nm and at 657 nm with a molar extinction coefficient for cyanidin-3-glucoside of 29,600. The contents of total anthocyanin were expressed as mg of cyanidin-3-glucoside equivalent (c3g) per gram FW.. Real-time RT-PCR analysis of the phenylpropanoid biosynthetic genes of V. corymbosum (Vc) phenylammonia lyase (VcPAL), chalcone synthase (VcCHS), anthocyanidin synthase (VcANS), flavonoid-30 -hydroxylase (VcF30 H) and the transcription factor VcMYBPA1 was carried out using a Stratagene Mx 3000 pTM Real-Time PCR System (Stratagene/Agilent, Santa Clara, CA, USA). The reaction (25 mL) contained 12.5 mL SYBR® Premix Ex Taq (TaKaRa, Shiga, Japan), 0.4 mL forward-specific primer, 0.4 mL reverse-specific primer and 2 mL cDNA template. DNA amplification was conducted using the following thermocycling programme: 95 C for 10 min followed by 40 cycles at 95 C for 30 s, 58 C for 30 s and 72 C for 30 s. GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE (VcG3PDH) or METALLOTHIONEIN (VcMET) were used as reference genes as previously described (Naik et al., 2007; Zifkin et al., 2012). The set of primers VcPAL were designed using Amplifx 1.4.5 software. The list of the specific genes and their respective primer pairs are shown in Table 2. Dissociation curves were generated for each reaction to ensure specific amplification. Threshold values (Ct), which represent the PCR cycle at which the fluorescence passes the threshold, were generated using the RQ Study software. Gene expression data (Ct values) were employed to quantify relative gene expression using the comparative 2DDCt method described by Livak and Schmittgen (2001).. 2.7. HPLC-DAD analysis of phenolic compounds Qualitative and quantitative analyses of blueberry phenolic compounds (non-anthocyanin and anthocyanin-type metabolites) in leaf extracts under UV-B radiation were conducted in a high performance liquid chromatography (HPLC) system (Jasco LC-Net II/ADC) using a Kromasil reverse-phase (RP)-18 column (250 4.6 mm i.d.) equipped with a photodiode array detector (DAD) (Jasco MD 2015 Plus). The HPLC-analyses of phenolic acids and flavonols were undertaken as described by Ruhland and Day (2000), at a flow-rate of 1.0 mL min1. Phenolic acids, such as chlorogenic, caffeic, ferulic, gallic and p-coumaric and the flavonols quercetin, myricetin, kaempferol and rutin were used as standards (Sigma Chemical Co. St. Louis, MO). Signals were detected at 320 nm. Acidified water (phosphoric acid 10%) (A) and 100% acetonitrile (B) were used as the mobile phase. The eluent gradient was: 0e9 min of 100% A, 9.1e19.9 min of 81% A/19% B, and then. 2.10. Statistical analysis For data analyses, the reported values correspond to the average of three biological replicates for each genotype. All data passed the normality and equal variance tests according to the KolmogoroveSmirnov test. Data were subjected to three- or two-way analyses of variance (ANOVA). Means were compared using Tukey's Test at 95% confidence (p 0.05). All analyses were performed with Sigma Stat 2.0 software (SPSS, Chicago, IL, USA)..
(4) 88. C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. Table 1 Anatomical changes in the thickness of leaf tissues and in total leaf thickness of two blueberry genotypes subjected to UV-B radiation for 72 h. The values represent averages of ten measurements ± s.e. Different capital letters indicate significant differences (P 0.05) between treatments at the same timepoint (72 h). Different lowercase letters indicate differences (P 0.05) between genotypes within the same treatment of UV-B. Layer leaves/treatments. Brigitta. Bluegold 2. Control Adaxial epidermis (ADE) Palisade (P) Mesophyll (M) Intercellular Cavities (IC) Abaxial epidermis (ABE) Total leaf thickness. 23.5 49.3 20.2 15.4 14.1 122.5. ± ± ± ± ± ±. 0.07 W m 2.8Aa 3.1Aa 1.8Aa 4.4Aa 2.0Aa 1.0Aa. 5.5 31.9 14.1 23.6 8.8 83.5. ± ± ± ± ± ±. 1.0Bb 3.5Bb 4.1Ba 15.6Aa 1.8Ba 4.6Bb. 2. 0.12 W m 8.2 36.8 14.7 27.3 8.2 95.1. ± ± ± ± ± ±. 1.9Ba 3.0Ba 3.5Ba 11.2Aa 2.0Ba 3.9Bb. 2. 0.19 W m 4.2 30.2 16.1 22.6 9.9 82.9. ± ± ± ± ± ±. 0.9Bb 2.6Bb 5.1Ba 10.8Aa 1.8Ba 4.0Bb. 0.07 W m2. Control 21.9 56.5 17.0 17.3 16.2 128.9. ± ± ± ± ± ±. 3.3Aa 10.2Aa 4.4Aa 6.3Aa 2.2Aa 3.1Aa. 12.5 52.0 14.0 18.2 12.0 108.6. ± ± ± ± ± ±. 2.7Ba 6.1Aa 4.1Aa 6.0Aa 2.4Aa 1.8Ba. 0.12 W m2 13.3 43.9 16.0 24.5 13.0 110.6. ± ± ± ± ± ±. 4.4Ba 5.8Aa 4.3Aa 6.9ABa 2.0Aa 1.8Ba. 0.19 W m2 9.0 61.8 22.8 27.4 11.9 132.9. ± ± ± ± ± ±. 2.0Ba 1.5Ba 3.6Ba 12.0Ba 3.4Aa 4.1Aa. 0.19 Wm2 UV-B radiation. Moreover, no significant changes were observed in the carotenoids of both genotypes (Table 3).. 3. Results 3.1. UV-B radiation induced anatomical changes in highbush blueberry leaves. 3.4. Total phenolics and anthocyanin contents in leaves. Leaf thickness significantly changed under UV-B radiation (Fig. 1). In both genotypes, significant decreases in adaxial epidermis (ADE) thickness in comparison with the controls at the highest UV-B doses (0.19 Wm2) were found. This decrease was greater (5.6-fold) in Brigitta than in Bluegold (2.4-fold). Reductions in both genotypes were also observed in the ADE at doses of 0.07 and 0.12 Wm2 of UV-B radiation. The deeper cell layers of leaves such as palisade (P), mesophyll (M) and abaxial epidermis (ABE) were less affected by this radiation, but still contributed to the reduction in total leaf thickness in both genotypes, especially in Brigitta (Fig. 1 and Table 1). On the other hand, in Bluegold a significant increase (around 58%) in the diameter of intercellular cavities (IC) in UV-B treated leaves with respect to the control was observed, whereas in Brigitta this increase was lower (46%) (Fig. 1 and Table 1).. In both genotypes, an increase in total phenolic content in leaves was observed. Bluegold showed a significantly greater phenolic content (P 0.05) at 0.12 Wm2 in almost all times. Noteworthy, this cultivar exhibited the highest total phenolic level in all doses of UV-B radiation at 72 h compared to control, while Brigitta showed this tendency mainly after 6 and 24 h of treatment (Fig. 3). On the other hand, a differential response in total anthocyanins among genotypes and UV-B radiation treatments was found. In fact, while Bluegold showed a significant increase in anthocyanins (P 0.05) in all UV-B treatments at 48 and 72 h compared to the control, in Brigitta greater anthocyanin concentrations were observed only at 0.12 Wm2 doses, and at all timepoints compared to the control (Table 4).. 3.2. Lipid peroxidation. The presence of three main groups of phenolic compounds -hydroxycinnamic acid, flavonoids and anthocyanins-from extracts of UV-B treated and untreated leaves was examined after 72 h by HPLC-DAD analysis (Tables 5 and 6). Chlorogenic acid was the most abundant compound of hydroxycinnamic acid in both genotypes, and the concentration in Brigitta was 1.9-fold greater than in Bluegold at the lowest UV-B dose. On the other hand, rutin was the most abundant flavonoid, being higher in Brigitta than in Bluegold subjected to UV-B radiation (Table 5). Interestingly, while Brigitta manteined its rutin concentration at the higher UV-B doses, Bluegold decreased significantly (5.6-fold) at the same treatments compared to the control. Minor concentrations of other hydroxycinnamic acids, such as p-coumaric acid, feluric acid, and flavonoids such as myricetin, appeared in both genotypes (data not shown). With respect to the anthocyanidin group, delphinidin was the most abundant especially in Bluegold, rising by around 3-fold with respect to the control at the highest UV-B dose. Cyanidin, petunidin, peonidin and malvidin were also present in minor concentrations in both genotypes and treatments (Table 6).. Biological damage to membranes as a result of UV-B radiation was assessed by the accumulation of TBARS in leaves as an index of lipid peroxidation. In Bluegold, a significant increase (P 0.05) in oxidative damage in response to UV-B stress in all treatments and times was found (Fig. 2). This increase was over twice as high in Bluegold compared to Brigitta (Fig. 2). 3.3. Pigment concentrations in leaf The photosynthetic pigments (Chlaþb and Chla/b), fell significantly (P 0.05) in both genotypes subjected to 0.12 and Table 2 Gene-specific primers used for gene expression analysis in highbush blueberry by qRT-PCR. Gene. Primers. Sequence (50 /30 ). Reference. VcPAL. Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse. TCATGTCCAAAGTGCTGAGC AACCAAGTGGCACTCATGAG CTTGACTGAGGAAATCTTGAAGG AGCCTCTTTGCCCAATTTG AGTTTGCTTTGAAGGCTGTTG ATGTGCTGGTGTGCATTTG CGAGATTCGATGCGTTTCTGAGTG GATTTCGGTATCGGTGAGCTTCC GATATCTATCGCTCTTGAATTGC CAGGTTTTACTCAGGACTCATCA GGTTATCAATGATAGGTTTGGCA CAGTCCTTGCTTGATGGACC ACCCTGACATGAGCTTCTCG ACCCAAATCTCTGCTTGCTG. This work. VcCHS VcANS 0. VcF3 H VcMYBPA1 VcG3PDH VcMET. Zifkin et al., 2012 Zifkin et al., 2012 Zifkin et al., 2012 Zifkin et al., 2012 Zifkin et al., 2012 Naik et al., 2007. 3.5. HPLC-DAD analysis of phenolic compounds in leaves. 3.6. Gene expression analysis of the phenylpropanoid pathway under UV-B radiation We investigated the transcriptional regulation of phenylpropanoid pathway genes under different doses of UV-B radiation in highbush blueberry leaves. The expression of VcPAL, VcCHS, VcANS, VcF30 H and VcMYBPA1 was analyzed using qRT-PCR. The genes encoding for VcPAL, VcCHS and VcF30 H were induced transiently in both genotypes at 6 and 24 h of treatment mainly in the 0.07 and 0.12 Wm2 UV-B radiation doses, except VcCHS in Brigitta.
(5) C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. 89. Fig. 1. Anatomical features of two highbush blueberry genotypes exposed for 72 h to different UV-B biological effective doses (-UV-B or Control; þUV-B 0.07 Wm2; 0.12 Wm2 and 0.19 Wm2). The image of the transverse section of the leaves shows the adaxial (ADE), abaxial epidermis (ABE), palisade layer (P), mesophyll layer (M) and intercellular cavities (IC). Scale bars represent: 50 mm.. (Fig. 4). Downstream of the biosynthesis of flavonoids, VcANS showed a similar behavior in Brigitta being induced at 6 and 24 h at 0.12 and 0.19 Wm2 UV-B radiation. Nonetheless, the transcription factor VcMYBPA1, associated with general flavonoid and proanthocyanidin (PA) biosynthesis, showed a significant and sustained induction at higher doses of UV-B radiation in both genotypes compared to the controls (P 0.05) (Fig. 4). 4. Discussion The depletion of the ozone layer increases the level of ultraviolet radiation (UV-B) reaching the earth surface, especially in the southern Hemisphere (Madronich et al., 1995; Rozema et al., 2002; Son et al., 2009). According to measurements taken in Temuco (38.7 S, 72.6 W), the active UV-B irradiance at noon on a clear day. in summer, reaches a maximum value of 4.0 Wm2 (De los Ríos et al., 2007; De los Ríos and Acevedo, 2010), equivalent to biologically effective UV-B radiation of 0.12 Wm2, similar to that obtained with UV-B lamps, and lower than those obtained in Laguna Negra, Chile (33.6 S, 70.1 W) by Tartarotti et al. (1999). In southern Chile, at (39 S) daily UV radiation doses are higher than those at the corresponding latitude in the northern Hemisphere (Germany 48 N). UV radiation doses similar to those found in the southern Hemisphere (New Zealand 45 S and Australia 38 S) has been reported (Lovengreen et al., 2000; Houvinen et al., 2006). Additionally, the risk of UV exposure could be up to 37 times higher in summer than in winter in this region (Houvinen et al., 2006). In this sense, several studies have shown that exposure to UV-B radiation has negative effects on the physiology and growth of plants under laboratory and field conditions (Caldwell et al., 1995; Rozema et al.,.
(6) 90. C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95 Table 3 Concentration of chlorophyll (chl) pigment and total carotenoids in two genotypes of highbush blueberry exposed to UV-B radiation. The values represent averages of three replicates ± s.e. Different capital letters indicate significant differences (P 0.05) between treatments at the same timepoint. Different lowercase letters indicate differences (P 0.05) between timepoints, within the same treatment of UV-B for the same cultivar. Genotypes Pigments Time (h) Treatments UV-B radiation (mg g1 FW) Brigitta Chlaþb. Chla/b. Car. Bluegold. Chlaþb. Chla/b. Fig. 2. Lipid peroxidation in leaves of two highbush blueberry genotypes exposed for 72 h to different UV-B biological effective doses (-UV-B or Control; þUV-B 0.07 Wm2; 0.12 Wm2 and 0.19 Wm2). The values represent averages of three replicates ± s.e. Different capital letters indicate differences (P 0.05) between UV-B treatments at the same timepoint for the same cultivar. Different lowercase show differences between the same treatment and the same cultivar (P 0.05). Asterisks indicate significant differences (P 0.05) between genotypes at the same timepoint.. 1997; Kakani et al., 2003a,b; Yao and Liu, 2009). In this study, the changes in anatomical and biochemical characteristics, phenolic compounds and gene expression of the phenylpropanoid pathway in the leaves of two highbush blueberry genotypes (Brigitta and Bluegold) subjected to UV-B radiation were investigated. Both genotypes showed a significant reduction in ADE thickness at 72 h in all treatments of UV-B exposure (0.07, 0.12 and 0.19 Wm2): Brigitta exhibited a greater decrease compared to Bluegold (Fig. 1 and Table 1). Similarly, UV-B treatments of cotton leaves resulted in a reduction in leaf thickness of both the palisade and spongy mesophyll layers (Kakani et al., 2003a,b). In addition, the size of the cotton mesophyll cells was severely reduced at the higher UV-B dose, augmenting the number of intercellular cavities (IC). In our case, similar effects were observed in the IC, in both genotypes (Fig. 1 and Table 1). We also found that the ADE layer and total leaf thickness in both genotypes significantly fell at the lowest UV-B dose, compared to the control. This could suggest a protective function against UV-B radiation. In fact, slower cell division provides additional time for DNA repair mechanisms, which is one of the strategies employed to protect against UV-B-induced damage (Frohnmeyer and Staiger, 2003). Furthermore, the diminished thickness in Brigitta could also be associated with a reduction of cell division and expansion in the ADE cell surface area (Hofmann et al., 2001). It has been observed in pea plants that UV-B radiation s affected cell division more than cell expansion in leaves (Nogue et al., 1998). However, Bluegold at the highest UV-B treatment showed a tendency to increase its total leaf thickness compared to the control. This was mainly due to the expenses of the increase in the intercellular spaces, a mayor disorganization of the mesophyll. Car. Control 6 24 48 72 Control 6 24 48 72 Control 6 24 48 72 Control 6 24 48 72 Control 6 24 48 72 Control 6 24 48 72. 0.07 0.26 0.24 0.24 0.26 0.22 2.92 2.77 2.76 2.90 2.70 0.06 0.06 0.06 0.04 0.06 0.24 0.21 0.20 0.22 0.26 3.01 2.85 2.83 2.76 2.86 0.06 0.05 0.05 0.06 0.06. Wm2 ± 0.07Ba ± 0.01Aa ± 0.01Ba ± 0.03Aa ± 0.03Aa ± 0.68Aa ± 0.40Ba ± 0.54Ba ± 0.16Aa ± 0.65Aa ± 0.00Aa ± 0.02Aa ± 0.01Aa ± 0.02Aa ± 0.01Aa ± 0.02Ba ± 0.03Ba ± 0.00Bb ± 0.03Ba ± 0.05Aa ± 0.07Ba ± 0.48Aa ± 0.09Aa ± 0.24Ab ± 0.31Aa ± 0.01Aa ± 0.01Aa ± 0.00Aa ± 0.00Aa ± 0.02Aa. 0.12 0.35 0.22 0.26 0.23 0.21 3.50 3.16 2.97 2.74 2.81 0.09 0.06 0.06 0.05 0.06 0.27 0.26 0.27 0.27 0.31 3.29 2.72 2.89 2.29 2.96 0.05 0.07 0.05 0.06 0.07. Wm2 ± 0.02Aa ± 0.03Ab ± 0.01Ab ± 0.03Ab ± 0.03Ab ± 0.04Aa ± 0.36Ab ± 0.33Ab ± 0.24Ab ± 0.22Ab ± 0.02Aa ± 0.01Aa ± 0.00Aa ± 0.01Ab ± 0.01Aa ± 0.02Bb ± 0.01Bb ± 0.01Ab ± 0.01Ab ± 0.02Aa ± 0.22Aa ± 0.19Ab ± 0.28Aa ± 0.03Bb ± 0.22Aa ± 0.00Aa ± 0.02Aa ± 0.01Aa ± 0.01Aa ± 0.02Aa. 0.19 0.30 0.25 0.28 0.24 0.21 3.48 3.45 3.06 2.88 2.99 0.06 0.06 0.06 0.06 0.04 0.41 0.34 0.22 0.26 0.25 3.42 2.95 2.25 2.81 2.96 0.06 0.07 0.06 0.07 0.06. Wm2 ± 0.00Ba ± 0.00Ab ± 0.01Ab ± 0.05Ab ± 0.00Ab ± 0.15Aa ± 0.09Aa ± 0.15Ab ± 0.31Ab ± 0.27Ab ± 0.01Aa ± 0.01Aa ± 0.01Aa ± 0.00Aa ± 0.00Ab ± 0.06Aa ± 0.03Aa ± 0.02Bb ± 0.03Bb ± 0.07Ab ± 0.08Aa ± 0.38Ab ± 0.62Ab ± 0.51Ab ± 0.12Ab ± 0.01Aa ± 0.02Aa ± 0.01Aa ± 0.02Aa ± 0.01Aa. and palisade layer (Fig. 1 and Table 1). This suggests a greater sensitivity of this genotype to elevated UV-B doses. Furthermore, it is important to mention that in our work despite non statistic significant differences in the ADE layer between the UV-B radiation treatment of 0.12 Wm2, compared with the lowest dose (0.07 Wm2), a tendency to increase ADE layer in the 012 Wm2 treatment was observed. This could be explained by the significant increase in the concentration of total phenols in the dose of 0.12 Wm2 (Fig. 3). Many studies in plants subjected to UV-B radiation, can result in high levels of phenolic compounds in epidermal cells, which has have been associated to a protection strategy of UV-B radiation (Burchard et al., 2000; Laakso et al., 2000). Phenolic compounds also may impact on the leaf development and the final leaf size (Dale 1992; Warren et al., 2002). On the other hand, recent studies at cellular levels, in response to UV-B radiation revealed an increase in the production of reactive oxygen species (ROS) in mitochondria and chloroplasts which can activate programmed cell death (PCD) (Agati et al., 2013). For example, PCD in Arabidopsis metacaspase 8 (AtMC8) is induced in response to oxidative stress caused by ROS, which could act downstream of the radical induced cell dead (AtRCD1) gene initiate the process of programmed cell death (Nawkar et al., 2013). Nonetheless, controversy exists about UV-B induced thickness leaf in some plants. Although a broad consensus is that UV-B induces relatively compact leaf architecture, an appreciable diversity depending on genotype and species is reported (Robson et al., 2014). The reduction of thickness in Brigitta compared to Bluegold is also associated with reduced lipid peroxidation (Fig. 2), which can be interpreted as a better response to UV-B of this.
(7) C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. 91. Table 5 Concentrations of phenolic acids and flavonoids (detected by HPLC-DAD) in leaves of two genotypes of highbush blueberry exposed to UV-B. The values represent averages of three replicates ± s.e. Different capital letters indicate significant differences (P 0.05) between genotypes at the same timepoint. Different lowercase letters indicate differences (P 0.05) between UV-B treatments within the same timepoint for the same cultivar. UV-B treatments. Phenolic compounds (mg g1 FW). Brigitta. Bluegold. Chlorogenic acid Control 0.07 Wm2 0.12 Wm2 0.19 Wm2. 14905 27330 18412 19453. ± ± ± ±. 902Ac 402Aa 1341Ab 1672Ab. 8843 8722 13595 13221. ± ± ± ±. 896Bb 832Bb 482Ba 1338Ba. 26574 28667 19001 19563. ± ± ± ±. 154Ab 924Aa 929Ac 1402Ac. 21809 6553 7194 7485. ± ± ± ±. 557Ba 786Bb 471Bb 185Bb. Rutin Control 0.07 Wm2 0.12 Wm2 0.19 Wm2. Fig. 3. Total phenolics of leaves of two highbush blueberry genotypes exposed for 72 h to different UV-B biological effective doses (-UV-B or Control; þUV-B 0.07 Wm2; 0.12 Wm2 and 0.19 Wm2). The values represent averages of three replicates ± s.e. Different capital letters indicate differences (P 0.05) between UV-B treatments at the same timepoint for the same cultivar. Different lowercase show differences between the same treatment and the same cultivar (P 0.05). Asterisk indicate significant differences (P 0.05) between genotypes at the same timepoint.. genotype. In fact, it is possible to observe a higher level of disorganization of cell layers in the leaves of Bluegold compared to Brigitta. Agrawal and Rathore, (2007) reported that chlorophyll and carotenoid contents are indicators of resistance to UV-B radiation. We observed a significant reduction of Chl a/b after 6 h in Brigitta at the greater UV-B doses (Table 3). This behavior was only observed at the highest UV-B dose for Bluegold, but this reduction was lower than in Brigitta. This could be associated with a reduction in the size of the antenna chlorophyll as a means of protecting the reaction centers from excess light, thus reducing the delivery of energy to the photosystems and thereby preventing their photoinhibition (Adams et al., 2004). In our work, this reduction is presumably a. Table 4 Concentration of anthocyanins in two genotypes of highbush blueberry exposed to UV-B radiation. The values represent averages of three replicates ± s.e. Different capital letters indicate significant differences (P 0.05) between genotypes at the same timepoint. Different lowercase letters indicate differences (P 0.05) between UV-B treatments within the same timepoint for the same cultivar. Genotype. Time (h). Anthocyanins [cyanidin 3-O-glycoside (mg g 0.07 Wm2. Brigitta. Bluegold. Control 6 24 48 72 Control 6 24 48 72. 0.14 0.14 0.13 0.13 0.15 0.11 0.13 0.15 0.16 0.20. ± ± ± ± ± ± ± ± ± ±. 0.01Aa 0.00Ba 0.02Ba 0.02Aa 0.03Aa 0.01Ac 0.01Ac 0.03Bb 0.01Ab 0.01Aa. 0.12 Wm2 0.10 0.17 0.19 0.13 0.15 0.08 0.12 0.17 0.18 0.14. ± ± ± ± ± ± ± ± ± ±. 0.03Bc 0.02Aa 0.01Aa 0.01Ab 0.02Ab 0.02Bc 0.00Ab 0.01Aa 0.07Ab 0.02Bb. -1. FW)]. 0.19 Wm2 0.15 0.13 0.14 0.13 0.16 0.12 0.13 0.13 0.14 0.14. ± ± ± ± ± ± ± ± ± ±. 0.01Aa 0.01Ba 0.02Ba 0.03Aa 0.03Aa 0.01Ab 0.01Aab 0.02Bab 0.00Aa 0.02Bab. strategy to decrease the absorption of light and prevent possible damage to the photosystems under excessive UV-B radiation. These results agree with the reports in other plant species such as Brassica napus (Larsson et al., 1998); Zea mays (Gao et al., 2004) and Raphanus sativus (Singh et al., 2012). Carotenoids not only protect plants from excess UV radiation, but also provide protection against ROS (Ruhland et al., 2007). We did not observe significant changes in carotenoid concentrations in the studied genotypes (Table 3). Other secondary metabolites, such as phenolic compounds (anthocyanidins and flavonoids) also act as photo-protective molecules under UV-B radiation (Poulson et al., 2006; Sangtarash et al., 2009). Our findings show that the anthocyanidin concentration of the Bluegold genotype is significantly augmented (P 0.05) under the 0.07 and 0.12 Wm-2 doses at all times, while in Brigitta an increase was found only at the intermediate doses (Table 4). Similar results were obtained by Ravindran. Table 6 Anthocyanidin concentration obtained by hydrolysis and detected by HPLC-DAD in leaves of two genotypes of highbush blueberry exposed to UV-B. The values represent averages of three replicates ± s.e. Different capital letters indicate significant differences (P 0.05) between genotypes at the same timepoint. Different lowercase letters indicate differences (P 0.05) between UV-B treatments within the same timepoint for the same cultivar. n.d., not detected. Treatment UV-B Anthocyanins (mg g1 FW) Brigitta. Bluegold. Delphinidin Control 0.07 Wm2 0.12 Wm2 0.19 Wm2. 7140 8216 12697 14167. ± ± ± ±. 809Bb 455Bb 208Ba 1268Ba. 516 824 874 917. ± ± ± ±. 62Ab 79Aa 32Aa 56Aa. 49 48 53 41. ± ± ± ±. 5Aa 2Ba 4Ba 1Ba. 13204 30163 33455 36412. ± ± ± ±. 902Ac 685Ab 760Aa 628Aa. 437 641 710 1116. ± ± ± ±. 38Ac 61Ab 48Ab 46Aa. 36 153 110 124. ± ± ± ±. 3Ac 9Aa 18Ab 10Ab. Cyanidin Control 0.07 Wm2 0.12 Wm2 0.19 Wm2 Petunidin Control 0.07 Wm2 0.12 Wm2 0.19 Wm2 Peonidin Control 0.07 Wm2 0.12 Wm2 0.19 Wm2. 10 12 26 26. ± ± ± ±. 0.02Ab 0.4Ab 2Aa 3Aa. n.d. 11 ± 1.2Aa 11 ± 1.2Ba n.d.. Malvidin Control 0.07 Wm2 0.12 Wm2 0.19 Wm2. 247 355 399 578. ± ± ± ±. 15Ab 36Ab 38Ab 19Aa. 236 275 206 212. ± ± ± ±. 15Aa 18Aa 13Ba 60Ba.
(8) Fig. 4. Real time PCR (qRT-PCR) analysis of mRNA levels of phenylpropanoid genes in leaves of highbush blueberry under UV-B radiation. Three independent biological replicas were performed. All data were normalized to VcG3PDH expression levels. Different lowercase letters indicate differences (P 0.05) between UV-B treatments with in the same timepoint for the same cultivar. Asterisks show differences between the same treatment and the same cultivar (P 0.05) according to the Tukey test..
(9) C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. et al. (2001) in the leaves of Suaeda maritime, where an enhancement of anthocyanidin and flavonoids under UV-B radiation was observed. Since these compounds are very important for coping with the harmful effects of UV-B radiation, we analyzed these phenolics in greater detail by HPLC-DAD. In the present study we found a variety of phenolic compounds in both genotypes; however, chlorogenic acid, and the groups of flavonols and anthocyanidins were the most abundant ones detected (Tables 5 and 6). Chlorogenic acid was the most prevalent compound in both genotypes, but the concentration in Brigitta was significantly higher than in Bluegold in all UV-B treatments. On the other hand, rutin was the most abundant flavonoid. Nonetheless, while Brigitta maintained its rutin concentration at the higher UV-B doses, levels in Bluegold decreased significantly (5.6-fold) at the same treatments compared to the control (Table 5). These compounds absorb UV-B light in the 280e320 nm region acting as UV-B filters (Agati et al., 2011; Emiliani et al., 2013). It has been suggested that these metabolites function as ROS scavengers, which agrees with the lower oxidative damage found in Brigitta, as determined by the membrane lipid peroxidation. UV-B radiation can stimulate key transcripts of enzymes of the phenylpropanoid pathway in species such as Hordeum vulgare (Liu et al., 1995), Spirodela intermedia (Gitz et al., 2004), Vitis vinifera (Matus et al., 2009) and Populus spp (Mellway et al., 2009). In our study, the genes of the phenylpropanoid pathway required for flavonoid synthesis are differentially affected by UV-B radiation (Fig. 4). In Brigitta a significant induction of VcPAL, VcANS and VcF30 H transcripts mostly in the first hours of treatments (6e24 h) at the higher UV-B doses (0.12 and 0.19 Wm2) was observed, whereas in Bluegold similar expression patterns, except at 0.07 and 0.12 Wm2 were found. Interestingly, the transcription factor VcMYBPA1 was steadily induced in both genotypes. MYB genes have been extensively studied and are involved in various biochemical and physiological processes including the regulation of secondary metabolites (Du et al., 2009). In studies in apple exposed to UV light, a strong correlation between MdMYB10 gene expression and anthocyanin levels during fruit ripening was observed (Espley et al., 2007). Some reports in grapevine indicate that MYB5a, MYB5b and MYBAPA1 may regulate the synthesis of general flavonoids and flavan-3-ol through the control of LEUCOANTHOCYANIDIN (LAR) and ANTHOCYANIDIN REDUCTASE (ANR) (Deluc et al., 2006, 2008; Bogs, 2007). In Populus spp., MYB134 regulates the biosynthesis of proanthocyanidin induced by UV-B light (Mellway et al., 2009). On the other hand, it is reported that VvMYBPA1 control also proanthocyanidins synthesis in grape (Kobayashi et al., 2002). In our case the VcMYBPA1 gene was expressed mainly in the high UV-B doses at all times suggesting a positive correlation between high UV-B radiation and MYBPA1 expression. According to our findings, it appears that MYBPA1 is induced by UV-B radiation and that it could be key to the synthesis of phenolic compounds and may also contribute to anthocyanin synthesis due to the activation of common biosynthetic pathways of structural genes in highbush blueberry. Furthermore, the phylogenetic analysis showed that VcMYBPA1 had the highest similarity (99%) to VvMYBPA1 gene (Supplementary Fig. 1), confirming the participation of VcMYBPA1 in the anthocyanin synthesis. In summary, the exposure of blueberry plants to increased UV-B radiation affects anatomical characteristics, decreasing differentially total leaf thickness in both genotypes, apparently as a defense strategy against increasing doses of UV-B radiation. Interestingly, the anatomical leaf tissue changes found in our study under UV-B radiation resemble to changes observed during cell death, which could be associated to UV-B gene expression related to PCD. Although, in our study we have not experimentally determinate PCD it could be interesting as a future research line. On the other. 93. hand, chlorophyll also decreased significantly in both genotypes at the highest UV-B doses, while the carotenoid content was maintained constant. Moreover, anthocyanin and total phenols were increased mainly at 0.12 Wm2 compared to the control in both genotypes. HPLC-DAD analysis showed that chlorogenic acid was the most abundant hydroxycinnamic acid in Brigitta and it increased significantly (P 0.05) with increasing doses of UV-B in comparison to Bluegold. Nonetheless, Brigitta maintained its rutin concentration at the higher UV-B doses compared to Bluegold. In terms of transcriptional levels, the regulation of the phenylpropanoid pathway under UV-B conditions appears to vary according to the intensities or timing imposed. In fact, it was possible to observe different patterns of expression in flavonoid-related genes under UV-B radiation. Interestingly, the MYBPA1 gene was differentially affected by high UV-B doses. The other genes evaluated did not respond in the same manner as MYBPA1, suggesting that this transcription factor could be an important regulator of flavonoid biosynthesis in highbush blueberry leaves. Our data suggest that the reduction of leaf thickness and less disorganization of their cell layers could be a defense strategy of Brigitta against UVB radiation, concomitant with lower lipid peroxidation and enhanced secondary metabolites. This fact was associated with a stable induction of MYBPA1. These results therefore indicate a better performance of the Brigitta genotype under increasing doses of UV-B radiation, compared to Bluegold. Nonetheless, further efforts are needed to understand the interaction between UV-B radiation and anatomical changes in this plant species, and their effects on a complex regulatory network in which metabolic compounds are being preferentially synthesized and accumulated. Author's contribution CI-B, MR-D, M.A designed and coordinated the experiment. CI-B formulated the manuscript and CI-B, MR-D, MA and PA-J revised and corrected it. CI-B, AA, MR-D carried out the biochemical analyzes. ML performed histological assays and PA contributed with measurements of UV-B irradiance. RL performed the qRT-PCR analysis. CI-B, AA and RL performed statistical analysis. Acknowledgments This work was supported by the FONDECYT-POSTDOCTORAL project N 3120248 and FONDECYT N 1120917 CONICYT, Chile. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.plaphy.2014.10.015. References Adams, W.W., Zarter, C.R., Ebbert, V., Demmig-Adams, B., 2004. Photoprotective strategies of over wintering evergreens. Bioscience 54, 41e49. Agati, G., Brunetti, C., Di Fernandino, M., Ferrini, F., Pollastri, S., Tatini, M., 2013. Functional roles of flavonoids in photoprotection: new evidence, lessons from the past. Plant Physiol. Biochem. 72, 35e45. Agati, G., Biricolti, S., Guidi, L., Ferrini, F., Fini, A., Tattini, M., 2011. The biosynthesis of flavonoids is enhanced similarly by UV radiation and root zone salinity in L. vulgare leaves. J. Plant Physiol. 168, 204e212. Agrawal, S.B., Mishra, S., 2009. Effects of supplemental ultraviolet-B and cadmiumon growth, antioxidant and yield of Pisum sativum L. Ecotox. Environ. Safe 72, 610e618. Agrawal, S.B., Rathore, D., 2007. Changes in oxidative stress defense system in wheat (Triticum aestivum L.) and mung bean (Vigna radiata L.) cultivars grown with and without mineral nutrients and irradiated by supplemental ultravioletB. Environ. Exp. Bot. 59, 21e23. Bjorn, L.O., 1996. Effects of ozone depletion and increased UV-B on terrestrial ecosystems. Int. J. Environ. Stud. 51, 217e243..
(10) 94. C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95. , F.W., Takos, A.M., Walker, A.R., Robinson, S.P., 2007. The grapevine Bogs, J., Jaffe transcription factor VvMYBPA1 regulates proanthocyanidin synthesis during fruit development. Plant Physiol. 143, 1347e1361. Britt, A.B., 1995. Repair of DNA induced by ultraviolet radiation. Plant Physiol. 108, 891e896. €ck, G., 2000. Contribution of hydroxycinnamates Burchard, P., Bilger, W., Weissenbo and flavonoids to shielding of UV-A and UV-B radiation in developing rye primary leaves as assessed by ultraviolet-induced chlorophyll fluorescence measurements. Plant Cell Environ 23, 1373e1380. €rn, L.O., Caldwell, M.M., Teramura, A.H., Tevini, M., Bornman, J.F., Bjo Kulandaivelu, G., 1995. Effects of increased solar ultraviolet radiation on terrestrial plants. Ambio 24, 166e173. ~ ol, M.T., Boronat, A., Tiburcio, A.F., 1991. Carotenoid and Campos, J.L., Figueras, X., Pin conjugated polyamine levels as indicators of ultraviolet-C induced stress in Arabidopsis thaliana. Photochem. Photobiol. 53, 689e693. Casati, P., Walbot, V., 2003. Gene expression profiling in response to ultraviolet radiation in maize genotypes with varying flavonoid content. Plant Physiol. 132, 1739e1754. Cloix, C., Jenkins, G.I., 2008. Interaction of the Arabidopsis UV-B-specific signaling component UVR8 with chromatin. Mol. Plant 1, 118e128. Czemmel, S., Strake, R., Weisshaar, B., Cordon, N., Harris, N.N., Walker, A.R., Robinson, S.P., Bogs, J., 2009. The grapevine R2R3-MYB transcription factor VvMYBF1 regulated flavonol synthesis in developing grape barries. Plant Physiol. 151, 1513e1530. Davies, K.M., Schwinn, K.E., 2003. Transcriptional regulation of secondary metabolism. Funct. Plant Biol. 30, 913e925. Dale, J.E., 1992. How do leaves grow? Biosciences 42, 423e432. De los Ríos, P., Acevedo, P., 2010. Effects of natural ultraviolet radiation exposure in inland water ecosystems of Chilean Patagonia. In: Collignon, L.N., Normand, C.B. (Eds.), Photobiology: Principles, Applications and Effects. Nova Science Publishers, Hauppauge, NY, pp. 195e207. De los Ríos, P., Hauenstein, E., Acevedo, P., Jaque, X., 2007. Littoral crustaceans in mountain lakes of Huerquehue National Park (38S, Araucania region, Chile). Crustaceana 80, 401e410. Deluc, L., Barrieu, F., Marchive, C., Lauvergeat, V., Decendit, A., Richard, T., Carde, J.P., rillon, J.M., Hamdi, S., 2006. Characterization of a grapevine R2R3-MYB Me transcription factor that regulates the phenylpropanoid pathway. Plant Physiol. 140, 499e511. Deluc, L., Bogs, J., Walker, A.R., Ferrier, T., Decendit, A., Merillon, J.M., Robinson, S.P., Barrieu, F., 2008. The transcription factor VvMYB5b contributes to the regulation of anthocyanin and proanthocyanidin biosynthesis in developing grape berries. Plant Physiol. 147, 2041e2053. Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell. 7, 1085e1097. Du, H., Zhang, L., Liu, L., Tang, X.F., Yang, W.J., Wu, Y.M., Huang, Y.B., Tang, Y.X., 2009. Biochemical and molecular characterization of plant MYB transcription factor family. Biochimistry 74, 1e11. Du, Z., Bramlage, W.J., 1992. Modified thiobarbituric acid assay for measuring lipid oxidation in sugar-rich plant tissue extracts. J. Agric. Food Chem. 40, 1556e1570. Emiliani, J., Grotewold, E., Falcone Ferreira, M.L., Casati, P., 2013. Flavonols protect Arabidopsis plant against UV-B deleterious effects. Mol. Plant 6, 1376e1379. Espley, R.V., Hellens, R.P., Putterill, J., Stevenson, D.E., Kutty-Amma, S., Allan, A.C., 2007. Red colouration in apple fruit is due to the activity of the MYB transcription factor, MdMYB10. Plant J. 49, 414e427. n, G., Monforte, L., Las Heras, R.T., Nun ~ ez-Olivera, E., Martínez-Abaigar, J., 2011. Fabo Dynamic response of UV-absorbing compounds, quantum yield and the xanthophyll cycle to diel change in UV-B and photosynthetic radiations in an aquatic liverwort. J. Plant Physiol. 169, 20e26. Feng, H., An, L., Chen, T., Qiang, W., Xu, S., Zhang, M., Wang, X., Cheng, G., 2003. The effects of enhanced ultraviolet-B radiation on growth, photosynthesis and stable carbon isotope composition (13C) of two soybean cultivars (Glycine max) under field conditions. Environ. Exp. Bot. 49, 1e8. Frohnmeyer, H., Staiger, D., 2003. Ultraviolet-B radiation-mediated responses in plants. Balancing damage and protection. Plant Physiol. 133, 1420e1428. Gao, W., Zheng, Y., Slusser, J.R., Heisler, G.M., Grant, R.H., Xu, J., He, D., 2004. Effects of supplementary ultraviolet-B irradiance on maize yield and qualities: a field experiment. Photochem. Photobiol. 80, 127e131. Gitz, D.C., Gitz, L.L., McClure, J.W., Huerta, A.J., 2004. Effects of a PAL inhibitor on phenolic accumulation and UV-B tolerance in Spirodela intermedia (Koch.). J. Exp. Bot. 398, 919e927. Heath, R.L., Packer, L., 1968. Photoperoxidation in isolated chloroplast. I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem.. Biophys. 125, 189e198. Heijde, M., Ulm, R., 2012. UV-B photoreceptor-mediated signalling in plants. Trends Plant Sci. 17, 230e237. Hoffman, R.W., Campbell, B.D., Fountain, D.W., Jordan, B.R., Greer, D.H., Hunt, D.Y., Hunt, C.L., 2001. Multivariable analysis of intraspecific responses to UV-B radiation in white clover (Trifolium repens L.). Plant Cell. Environ. 24, 917e927. mez, I., Lovengreen, C., 2006. A five-year study of solar ultraviolet Huovinen, P., Go radiation in southern Chile (39 S): potential impact on physiology of coastal marine algae? Photochem. Photobiol. 82, 515e522. Inostroza-Blancheteau, C., Aquea, F., Reyes-Díaz, M., Alberdi, M., Arce-Johnson, P., 2011b. Identification of aluminum-regulated genes by cDNA-AFLP analysis of. roots in two contrasting genotypes of highbush blueberry (Vaccinium corymbosum L.). Mol. Biotechnol. 49, 32e41. Inostroza-Blancheteau, C., Reyes-Díaz, M., Aquea, F., Nunes-Nesi, A., Alberdi, M., Arce-Johnson, P., 2011a. Biochemical and molecular changes in response to aluminium-stress in highbush blueberry (Vaccinium corymbosum L.). Plant Physiol. Biochem. 49, 1005e1012. Jansen, M.A.K., Gaba, V., Greenberg, B.M., 1998. Higher plants and UV-B radiation: balancing damage, repair and acclimation. Trends Plant Sci. 3, 131e135. Kakani, V.G., Reddy, K.R., Zhao, D., Mohammed, A.R., 2003a. Effects of utravioled-B radiation on cotton (Gossypium hirsutum L.) morphology and anatomy. Ann. Bot. 91, 817e826. Kakani, V.G., Reddy, K.R., Zhao, D., Sailaja, K., 2003b. Field crop responses to ultraviolet-B radiation: a review. Agric. For. Meteorol. 120, 191e218. Kobayashi, S., Ishimaru, M., Hiraoka, K., Honda, C., 2002. Myb-related genes of the Kyoho grape (Vitis labruscana) regulate anthocyanin biosynthesis. Planta 215, 924e933. Kumar, S., Nei, M., Dudley, J., Tamura, K., 2008. MEGA: a biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 9, 299e306. Laakso, K., Sullivan, J.H., Huttunen, S., 2000. The effects of UV-B radiation on epidermal anatomy in loblolly pine (Pinus taeda L.) and Socts pine (Pinus sylvestris L.). Plant Cell Environ 23, 461e472. Larsson, E.H., Bornman, J.F., Asp, H., 1998. Influence of UV-B radiation and Cd2þ on chlorophyll fluorescence, growth and nutrient content in Brassica napus. J. Exp. Bot. 49, 1031e1039. Lichtenthaler, K., Wellburn, R., 1983. Determination of total carotenoids and chlorophylls a and b of leaf extracts in different solvent. Biochem. Soc. Trans. 11, 591e592. Liu, L., McClure, J.W., 1995. Effects of UV-B on activities of enzymes of secondary phenolic metabolism in barley primary leaves. Physiol. Plant 93, 734e739. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2DDCT method. Methods 25, 402e408. Lovengreen, C., Fuenzalida, H., Villanueva, L., 2000. Ultraviolet solar radiation at Valdivia, Chile (39.8 S). Atmos. Environ. 34, 4051e4061. €rn, L.O., 1995. Changes in ultraMadronich, S., Mckenzie, R.L., Caldwell, M.M., Bjo violet radiation reaching the earth's surface. Ambio 24, 143e153. ~ a-Neira, A., Bordeu, E., Arce-Johnson, P., Matus, J.T., Loyola, R., Vega, A., Pen Alcalde, J.A., 2009. Post-veraison sunlight exposure induced MYB-meditaed transcriptional regulation of anthocyanin and flavonol synthesis in berry skin of Vitis vinifera. J. Exp. Bot. 60, 853e867. Mellway, R.D., Tran, L.T., Prouse, M.B., Campbell, M.M., Constabel, C.P., 2009. The wound-, pathogen-, and ultraviolet B-responsive MYB134 gene encoded an R2R3 MYB transcription factor that regulates proanthocyanidin synthesis in poplar. Plant Physiol. 150, 924e941. Naik, D., Dhanaraj, A.L., Arora, R., Rowland, L.J., 2007. Identification of genes associated with cold acclimation in blueberry (Vaccinium corymbosum L.) using a subtractive hybridization approach. Plant Sci. 173, 213e222. Nawkar, G.M., Maibam, P., Park, J.H., Sahi, V.P., Lee, S.Y., Kang, C.H., 2013. UV-Induced cell death in plants. Int. J. Mol. Sci. 14, 1608e1628. s, S., Allen, D.J., Morison, J.I.L., Baker, N.R., 1998. Ultraviolet-B radiation effects Nogue on water relations, leaf development, and photosynthesis in droughted pea plants. Plant Physiol. 117, 173e181. Nyman, N.A., Kumpulainen, J.T., 2001. Determination of anthocyanidins in berries and red wine by high-performance liquid chromatography. J. Agric. Food Chem. 49, 4183e4187. Phoenix, G.K., Gwynn-Jones, D., Callaghan, T.V., Sleep, D., Lee, J.A., 2001. Effects of global change on a sub-arctic heath: effects of enhanced UV-B radiation and increased summer precipitation. J. Ecol. 89, 256e267. Poulson, M.E., Boeger, M.R.T., Donahue, R.A., 2006. Response of photosynthesis to high light and drought for Arabidopsis thaliana grown under a UV-B enhanced light regime. Photosynth. Res. 90, 79e90. Rasmussen, S.E., Frederiksen, H., Krogholm, K., Poulsen, L., 2005. Dietary proanthocyanidins: occurrence, dietary intake, bioavailability, and protection against cardiovascular disease. Mol. Nutr. Food Res. 49, 159e174. Ravindran, K.C., Kumar, N.M., Amirthalingam, V., Ranganathan, R., Chellappan, K.P., Kulandaivelu, G., 2001. Influence of UV-B supplemental radiation on growth and pigment content in Suaeda Maritima L. Biol. Plant 44, 467e469. ~ iga, G.E., Mora, M.L., 2010. Antioxidant Ribera, A.E., Reyes-Díaz, M., Alberdi, M., Zun compounds in skin and pulp of fruits change among genotypes and maturity stages in highbush blueberry (Vaccinium corymbosum L.) grown in southern Chile. J. Soil Sci. Plant Nutr. 10, 509e536. Ries, G., Heller, W., Putchta, H., Sandermann, H., Seidlitz, H.K., Hohn, B., 2000. Elevated UV-B radiation reduced genome stability in plants. Nature 406, 98e101. Rizzini, L., Favory, J.J., Cloix, C., Faggionato, D., OHara, A., Kaiserli, E., Baumeister, R., Shafer, E., Nagy, F., Jenkins, G.I., Ulm, R., 2011. Perception of UV-B by the Arabidopsis UVR8 protein. Science 332, 103e106. Robakowski, P., 1999. Impact of Ultraviolet-B Radiation on Two Species of Forest Dwarf. Robson, M.T., Klem, K., Urban, O., Jansen, M.A.K., 2014. Re-interpreting plant morphological responses to UV-B radiation. Plant Cell. Environ. http:// dx.doi.org/10.1111/pce.12374. €rn, L.O., Bornman, J.F., Gaberscik, A., H€ Rozema, J., Bjo ader, D.P., Trost, T., Germ, M., Klisch, M., Groniger, A., Sinha, R.P., Lebert, M., He, Y.Y., Buffoni-Hall, R., DeBakker, N.V.J., Van de Staaij, J., Meijkamp, B.B., 2002. The role of UV-B.
(11) C. Inostroza-Blancheteau et al. / Plant Physiology and Biochemistry 85 (2014) 85e95 radiation in aquatic and terrestrial ecosystems- an experimental and functional analysis of the evolution of UV-absorbing compounds. J. Photochem. Photobiol. B: Biol. 66, 2e12. Rozema, J., 1999. In: Rozema, J. (Ed.), Stratospheric Ozone Depletion. The Effects of Enhanced UV-B Radiation on Terrestrial Ecosystems. Backhuys Publishers Leiden, The Netherlands, pp. 59e69. €rn, L.O., Caldwell, M.M., 1997. UV-B as an environRozema, J., van de Staaij, J., Bjo mental factor in plant life: stress and regulation. Trends Ecol. Evol. 12, 22e28. Ruhland, C.T., Day, T.A., 1996. Changes in UV-B radiation screening effectiveness with leaf age in Rhododendron maximum. Plant Cell. Environ. 19, 740e746. Ruhland, C.T., Day, T.A., 2000. Effects of ultraviolet-B radiation on leaf elongation, production and phenylpropanoid concentrations in Deschampsia antarctica and Colobanthus quitensis in Antarctica. Physiol. Plant 109, 244e251. Ruhland, C.T., Fogal, M.J., Buyarski, C.R., Krna, M.A., 2007. Solar ultraviolet-B radiation increases phenolic content and ferric reducing antioxidant power in Avena sativa. Molecules 12, 1220e1232. Russell, J.M., Luo, M.Z., Cicerone, R.J., Deaver, L.E., 1996. Satellite confirmation of the dominance of chlorofluorocarbons in the global stratospheric chlorine budget. Nature 37, 526e529. Sangtarash, M.H., Qaderi, M.M., Chinnappa, C.C., Reid, D.M., 2009. Differential sensitivity of canola (Brassica napus) seedlings to ultraviolet-B radiation, water stress and abscisic acid. Environ. Exp. Bot. 66, 212e219. Semerdjieva, S.I., Phoenix, G.K., Hares, D., Gwynn-Jones, D., Callaghan, T.V., Sheffield, E., 2003. Surface morphology, leaf and cuticle thickness of four dwarf shrubs from a sub-Arctic heath following long-term exposure to enhanced levels of UV-B. Physiol. Plant 117, 289e294. Singh, S., Kumari, R., Agrawal, M., Agrawal, S.B., 2012. Differential response of radish plants to supplemental ultraviolet-B radiation under varying NPK levels: chlorophyll fluorescence, gas exchange and antioxidants. Physiol. Plant 145, 474e484. Slinkard, K., Singleton, V.L., 1977. Total phenol analysis: automation and comparison with manual methods. Am. J. Enol. Vitic. 28, 29e55.. 95. Son, S., Tandon, N.F., Poluani, L.M., Waugh, D.W., 2009. Ozone hole and Southern Hemisphere climate change. Geophys. Res. Lett. 36, 1e5. , F.W., Jacob, S.R., Bogs, J., Robinson, S.P., Walker, A.R., 2006. LightTakos, A.M., Jaffe induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples. Plant Physiol. 142, 1216e1232. Tartarotti, B., Cabrera, S., Psenner, R., Sommaruga, R., 1999. Survivorship of Cylops abyssorum tatricus (Cyclopoida, Copepoda) Boeckella gracilipes (Calanoida, Copepoda) under ambient levels of solar UVB radiation in two high-mountain lakes. J. Plankton Res. 21, 549e560. s, C., Cheynier, V., Romieu, C., Terrier, N., Torregrosa, L., Ageorges, A., Vialet, S., Verrie 2009. Ectopic expression of VvMybPA2 promotes proanthocyanidin biosynthesis in grapevine and suggests additional targets in the pathway. Plant Physiol. 149, 1028e1041. Warren J.M., Bassman J.H., Mattinson D.S., Fellrnan J.K.,Edwards G.E. and Robberecht R., Alteration of foliageflavonoids chemistry induced by enhanced UV-B radiation infield-grown Pinus ponderosa, Quercus rubra, and Pseudotsuga menziesii. J. Photochem. Photobiol. B Biol. 66, 125e133. Wu, X., Beecher, G.R., Holden, J.M., Haytowitz, D.B., Gebhardt, S.E., Prior, R.L., 2006. Concentration of anthocyanins in common foods in the United States and estimation of normal consumption. J. Agric. Food Chem. 54, 4069e4075. Yao, X., Liu, X., 2009. The effects of enhanced ultraviolet-B and nitrogen supply on growth, photosynthesis and nutrient status of Abies faxoniana seedlings. Acta Physiol. Plant 31, 523e529. Zifkin, M., Jin, A., Ozga, J.A., Zaharia, L.I., Schernthaner, J.P., Gesell, A., Abrams, S.R., Kennedy, J.A., Constabel, C.P., 2012. Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism. Plant Physiol. 158, 200e224. Zu, Y.G., Pang, H.H., Yu, J.H., Li, D.W., Wei, X.X., Gao, Y.X., Tong, L., 2010. Responses in the morphology, physiology and biochemistry of Taxus chinensis var. mairei grown under supplementary UV-B radiation. J. Photochem. Photobiol. B 98, 152e158..
(12)
Documento similar