ANÁLISIS DE ASOCIACIÓN DE LOS POLIMORFISMOS E155DEL, A140D Y E208K DE LA GLUTATIÓN S TRANSFERASA OMEGA 1-1 (GSTO1-1) CON LOS PERFILES DE EXPRESIÓN DE MEDIADORES INLFAMATORIOS Y APOPTÓTICOS EN INDIVIDUOS EXPUESTOS A ARSÉNICO.

102 

Texto completo

(1)

FACULTAD DE CIENCIAS QUÍMICAS, INGENIERÍA Y MEDICINA

PROGRAMAS MULTIDISCIPLINARIOS DE POSGRADO EN CIENCIAS

AMBIENTALES

TESIS QUE PARA OBTENER EL GRADO DE

DOCTORADO EN CIENCIAS AMBIENTALES

Análisis de asociación de los polimorfismos E155del, A140D y E208K de la

glutatión S transferasa Ω 1-1(GSTO1-1) con los perfiles de expresión de

mediadores inflamatorios y apoptóticos en individuos expuestos a arsénico

PRESENTA:

DIANA MARÍA ESCOBAR GARCÍA

DIRECTOR DE TESIS:

Dra. CLAUDIA ESCUDERO LOURDES

ASESORES:

Dra. LUZ MARÍA DEL RAZO JIMÉNEZ

(2)

FACULTAD DE CIENCIAS QUÍMICAS, INGENIERÍA Y MEDICINA

PROGRAMAS MULTIDISCIPLINARIOS DE POSGRADO EN CIENCIAS

AMBIENTALES

TESIS QUE PARA OBTENER EL GRADO DE

DOCTORADO EN CIENCIAS AMBIENTALES

Análisis de asociación de los polimorfismos E155del, A140D y E208K de la

glutatión S transferasa Ω 1-1 (GSTO1-1) con los perfiles de expresión de

mediadores inflamatorios y apoptóticos en individuos expuestos a arsénico

PRESENTA:

M. en C. DIANA MARÍA ESCOBAR GARCÍA

COMITÉ TUTELAR:

DIRECTORA: Dra. Claudia Escudero Lourdes _______________________________

ASESORA: Dra. Luz María Del Razo Jiménez_____________________________________

SINODALES:

PRESIDENTE: Dra. Claudia Escudero Lourdes _______________________________________

SECRETARIO: Dra. Luz María Del Razo Jiménez ________________________________________

VOCAL: Dra. Jaqueline Calderón Hernández _________________________________________

VOCAL: Dra.Ana Cristina Cubillas Tejada _________________________________________

(3)

2

PROYECTO REALIZADO EN:

Laboratorio de Inmunología y Biología Molecular, CIEP.

Facultad de Ciencias Químicas

CON FINANCIAMIENTO DE:

Proyecto SECTORIAL SEP-CONACYT No. M-44051

Responsable: Dra. Claudia Escudero Lourdes

A TRAVÉS DEL PROYECTO DENOMINADO:

“Análisis de los mecanismos involucrados en el efecto tóxico del As sobre

los procesos inflamatorios en un modelo murino de intoxicación con

arsenito de sodio”

AGRADEZCO A CONACyT EL OTORGAMIENTO DE LA BECA-TESIS

Becario No

198477

(4)

AGRADECIMIENTOS

Doy especial gracias a mi familia, Alexander Mateo

y Simón quienes constantemente son un ejemplo de

tenacidad y constancia, ellos son mi motivación para

seguir adelante.

Agradezco a la Dra Elizabeth Reynaga Hernández por

su excelente asesoría técnica, su contribución fue

invaluable para la realización de este trabajo;

igualmente agradezco a la Dra Lina Raquel Riego Ruiz

ya que gracias a sus enseñanzas desinteresadas hizo

posible la interpretación de las bases de datos de los

polimorfismos

secuenciados

y

la

resolución

de

múltiples problemas en técnicas de biología molecular.

Gracias a todas las personas que tuvieron que ver de

algún modo en la realización y culminación de este

(5)

4 RESUMEN

La exposición humana a arsénico (As) se ha asociado con el desarrollo de un

sinnúmero de enfermedades relacionadas con el desarrollo de procesos inflamatorios

y apoptóticos que pueden incluir tanto diferentes tipos de cáncer como enfermedades

no cancerosas, dentro de esta últimas podemos mencionar principalmente

enfermedades neurodegenerativas, aterosclerosis, hipertensión y diabetes mellitus

tipo 2. También es conocido que existe una gran susceptibilidad interindividual al

desarrollo de éstas enfermedades en el contexto de poblaciones expuestas a As ya

sea en el agua de bebido a por cualquier otra vía de exposición, dicha

susceptibilidad está dada principalmente por la presencia de polimorfismos en

enzimas metabólicas encargadas de la bio-transformación del arsénico inorgánico

(iAs ) como lo es la glutatión S transferasa omega 1-1 (GSTO1-1). La GSTO1-1, se

ha asociadas no solo con el metabolismo del iAs , sino también con las respuestas

ante procesos inflamatorios y apoptóticos de las células. Dentro de los polimorfismos

de la GSTO1-1, el polimorfismo A140D a ha sido asociado con alteraciones del perfil

de los metabolitos de arsénico excretados en orina en poblaciones crónicamente

expuestas a iAs por medio del agua de bebida, además, también ha sido asociado

con un mayor riesgo para el desarrollo de leucemia infantil y enfermedad pulmonar

obstructiva crónica (EPOC) en poblaciones no expuestas, sugiriendo que esta

enzima pudiera participar de manera muy importante en otros procesos fisiológicos

(6)

5 En este trabajo se evaluó la asociación de la presencia de los polimorfismos

A140D y E208K del gen de la GSTO1-1 con la expresión de genes que codifican

para proteínas implicadas en la respuesta inflamatoria y apoptótica en una población

humana expuesta crónicamente a iAs a través del agua de consumo. Se encontró

que el polimorfismo A140D está asociado con la expresión de genes que codifican

principalmente para la IL-8 y Apaf-1 en individuos heterocigotos, mientras que E208K se asoció con mayor expresión de IL-8 y TGF-β; en ambos casos, la asociación fue

independiente de los niveles de exposición a iAs. Estos resultados sugieren una

importante participación de la GSTO1-1 en la respuesta inflamatoria y el proceso de

apoptosis e indican que la presencia de los polimorfismos A140D y E208K en

población expuesta, podría incrementar el riesgo a desarrollar enfermedades

relacionadas con procesos inflamatorios y apoptóticos que podrían incluir cáncer y

(7)

Tabla de contenido

ANTECEDENTES ... 8

GLUTATIÓN STRANSFERASA (GST) ... 8

Glutatión s transferasa Ω (gsto) ... 9

ARSÉNICO ... 14

Arsénico y salud ... 15

Metabolismo del arsénico ... 19

Mecanismos de toxicidad del arsénico ... 23

Arsénico: inflamación y apoptosis ... 27

JUSTIFICACIÓN ... 31

HIPÓTESIS ... 33

OBJETIVOS ... 34

OBJETIVO GENERAL ... 34

Objetivos particulares ... 34

METODOLOGÍA ... 36

SITIO DE ESTUDIO Y SELECCIÓN DE LOS PARTICIPANTES ... 36

COLECCIÓN DE AGUA Y ORINA ... 37

DETERMINACIÓN DE ESPECIES DE ARSÉNICO ... 38

COLECCIÓN DE SANGRE PERIFÉRICA ... 39

AISLAMIENTO DE DNA ... 40

DETECCIÓN DE LOS POLIMORFISMOS ... 42

POLIMORFISMO A140D Y E155 DEL DE LA GSTO1-1 ... 42

POLIMORFISMO E208K DE LA GSTO1-1 ... 45

SECUENCIACIÓN ... 46

Purificación de productos de PCR ... 46

AISLAMIENTO DE RNA ... 47

(8)

7

CUANTIFICACIÓN DE ÁCIDOS NUCLÉICOS... 48

EVALUACIÓN DE LA EXPRESIÓN DE GENES ... 49

ANÁLISIS ESTADÍSTICO ... 51

RESULTADOS ... 54

CARACTERÍSTICAS DE LA POBLACIÓN ... 54

CONCENTRACIÓN DE AS TOTAL EN EL AGUA DE BEBIDA ... 54

DISTRIBUCIÓN DE LOS POLIMORFISMOS A140D,E155DEL Y E208K Y SU COMBINACIÓN EN LA POBLACIÓN DE ESTUDIO: ... 55

CONCENTRACIÓN DE AS TOTAL (AST) EN ORINA... 57

CONCENTRACIONES DE IAS Y ESPECIES DE ARSÉNICO EN ORINA ... 58

ANÁLISIS DE ASOCIACIÓN DE LOS POLIMORFISMOS CON LA CONCENTRACIÓN URINARIA DE ESPECIES DE ARSÉNICO EN ORINA. ... 60

EFICIENCIA DEL PRIMER Y SEGUNDO PASO METABÓLICO. ... 65

ANÁLISIS DE ASOCIACIÓN DE LOS POLIMORFISMOS CON EXPRESIÓN GENÉTICA. ... 66

PROCESO APOPTÓTICO ... 67

RESPUESTA INFLAMATORIA ... 69

(9)

8

ANTECEDENTES

G

LUTATIÓN

S

T

RANSFERASA

(GST)

Las glutatión S transferasas (GSTs) son una gran familia de enzimas

citosólicas de fase II que desempeñan una gran variedad de funciones que van

desde la conjugación de xenobióticos hasta la modulación de vías de señales de

transducción y la formación y modulación de canales iónicos. Estas enzimas

participan en la síntesis de sustancias endógenas como las prostaglandinas y

hormonas esteroideas (Oakley, 2005) y en el metabolismo de xenobióticos tales

como el arsénico (As). Por otro lado, son de particular significancia en la biología del

cáncer debido a una intrínseca capacidad para desintoxicar un gran número de

compuestos carcinógenos (Mohr et al., 2003).

Se han descrito siete subfamilias de la GST: , , , , , , y  (Stanulla et

al., 2000; Marahatta et al., 2006). Dentro de cada una de estas subfamilias existe un

número variable de isoformas, cada una codificada por diferente locus genético. En

los genes que codifican para estas enzimas se han descrito diferentes polimorfismos

algunos de los cuales han demostrado que pueden aumentar el riesgo para el

desarrollo de enfermedad de Parkinson y Alzheimer como es el caso de sujetos que

presentan el polimorfismo N142D en GSTO1-1-2 y están expuestos a pesticidas (Li

(10)

9 sido más estudiados de esta familia son la GST del grupo  (GSTM) y las GST del

grupo  (GSTT); en estos grupos de familias de la GST se han descrito polimorfismos

nulos, en donde una deleción en el gen impide que se produzca una enzima

funcional dejando a los individuos que presentan éste polimorfismo en desventaja

para metabolizar una cantidad importante de carcinógenos, como los encontrados en

el humo del cigarrillo, lo que se traduce en una mayor susceptibilidad al desarrollo de

cáncer de pulmón (Mohr et al., 2003; Bolt & Thier, 2006).

G

LUTATIÓN S TRANSFERASA

(

GSTO

)

Esta proteína es producida por un amplio rango de especies, entre las que se

pueden mencionar la humana, rata, ratón, Drosophila melanogaster y

Caenorhabdetis elegans (Whitbread, et al., 2003; Aposhian. et al., 2004). En

humanos, se expresa en diversos tejidos incluyendo hígado, macrófagos, células

gliales y células endócrinas (Tanaka-Kagawa et al., 2003). Esta enzima es expresada

por 2 genes: hgsto1 y hgsto2 que codifican para las proteínas GSTO1-1 y GSTO1-2,

respectivamente. Ambos genes están localizados en el brazo largo del cromosoma

10 en la fracción 24.3 (Figura 1) y están separados por 7.5 kb (Schmuck et al., 2005).

El gen que codifica para GSTO1-1 llamado hgsto1-1 está constituido por 6 exones

(11)

10

Figura 1 Cromosoma 10. Localización de la GSTO.

Esta proteína presenta grandes diferencias con otras enzimas del grupo de las

GST como tener un residuo de cisteína en lugar de residuos de serina en el sitio

activo; además, contar con un residuo adicional de 19 aminoácidos en el extremo N

Terminal (Figura 2). La GSTO exhibe dos actividades que no están asociadas con

otras GSTs, como tener una actividad tioltransferasa y una actividad catalítica de

reducción de dehidroascorbato, ambas dependiente de glutatión (Board et al., 2000,

2007). Esta enzima muestra mínima actividad catalítica con muchos compuestos que

son sustratos para otros miembros de las otras clases de GSTs (Schmuck et al.,

2005). Concretamente la GSTO1-1 presenta una actividad de monometilarsenato

(MMAV) reductasa y está considerada como una enzima limitante en las vías de

biometilación del As inorgánico (iAs), pues muestra una Km para el sustrato que se

encuentra en el rango milimolar a diferencia de otras GSTs cuya Km se encuentran

(12)

11

Figura 2. Estructura de la GSTO1-1 humana.

Diferentes polimorfismos en el gen que codifica para GSTO1-1 han sido

identificados en diversos grupos étnicos como europeos y aborígenes americanos

(Figura 3) (Yu et al., 2003; Mukherjee et al., 2006); uno de ellos corresponde al

polimorfismo denominado A140D, en donde una mutación puntual en el exón 4 (C/A)

da lugar a la sustitución en la proteína, de una alanina por un ácido aspártico

produciendo una disminución del 25% en la actividad de tioltransferasa con relación

a la enzima silvestre (Tanaka-Kagawa et al., 2003). La presencia de este

polimorfismo A140D ha sido asociado con riesgo para desarrollar diferentes

enfermedades que incluyen enfermedad pulmonar obstructiva crónica (EPOC)

(Yanbaeva et al., 2009) así como leucemia linfoblástica aguda de la infancia

(Pongstaporn et al., 2009); sin embargo, no existen estudios que evalúen los factores

o mecanismos asociados. El polimorfismo E155del que consiste en una deleción de

(13)

12 de ácido glutámico de la enzima. Esta modificación causa una disminución en

estabilidad de la enzima al calor y está relacionado con una eliminación subnormal

de las formas metiladas del iAs presentes en la orina (Marnell et al., 2003). Otro

polimorfismo descrito es el E208K, se encuentra en el exón 6 (G/A) y corresponde a

un cambio de un residuo de un ácido glutámico por una lisina en la enzima (Marnell

et al., 2003). Este polimorfismo se asocia a modificaciones en la disposición de

metabolítos del iAs en orina (Marnell et al., 2003).

Figura 3 Mapa del hGSTO1-1. El mapa del gen muestra las características del gen así como los diferentes polimorfismos identificados.

Es importante mencionar que adicionalmente a las actividades enzimáticas

referidas en el metabolismo del As, la GSTO1-1 modula la función del receptor de

rianodina (RyRs) de los canales de liberación de calcio del retículo sarcoplásmico de

células esqueléticas y cardíacas, por lo que se ha propuesto que esta enzima juega

un papel importante en la protección de células en contra de la apoptosis inducida

por la movilización de Ca++ a partir de depósitos intracelulares (Lima et al., 2008;

(14)

13 Board et al., 2004; Dulhunty et al., 2001; Tanaka-Kagawa et al., 2003), ya que un

desequilibrio en la homeostasis de su liberación está implicada en el desarrollo de

varios desórdenes esqueléticos y cardíacos debido a procesos de envenenamiento

celular y apoptosis (Lemasters et al., 2009; Beard et al., 2009). Los RyRs también se

expresan en linfocitos T y B (Guse et al., 1999; Sei et al., 1999). Estas observaciones

inducen a asumir que alteraciones en la funcionalidad de esta enzima pueda verse

reflejado en un aumento en el grado de apoptosis celular. Otra función poco

documentada de esta enzima es su posible papel en el procesamiento

postraduccional y la liberación de la interleucina 1 beta (IL-1) de los monocitos (Li et

al., 2006). Como soporte a esta observación se ha descrito que GSTO1-1 es uno de

los principales blancos de los fármacos que inhiben la liberación de citocinas

(Laliberte et al., 2005). Tomando en cuenta que la IL-1 es un mediador

proinflamatorio producido abundantemente por los monocitos activados y macrófagos

es posible asumir que una alteración en la funcionalidad o en la expresión de

GSTO1-1 afectará asimismo la producción de IL-1 y, por consiguiente, las

respuestas inflamatorias, proliferación y diferenciación celular y, finalmente, la

(15)

El As es un elemento ampliamente distribuido en la naturaleza. Se obtiene

como producto secundario de desecho en los procesos de extracción y refinación de

minerales y metales como el cobre, plomo, zinc y estaño en forma de arsenopirita

(FeAsS), rejalgar (As2S2), oropimente (As2S3) y trióxido de As (As2O3).

Adicionalmente, el As puede ser liberado al ambiente por actividad volcánica y

erosión de depósitos minerales o actividad minera con mala disposición de los

desechos dejados por esta actividad. Antiguamente se empleó en el tratamiento de la

sífilis, disentería amebiana y tripanosomiasis. En la actualidad, la utilización de este

metaloide se ha reservado a la fabricación de insecticidas, herbicidas y fungicidas; en

la producción de algunos colorantes; en tratamientos de enfermedades de la piel

como la psoriasis; en la disección de animales y conservación de pieles; en la

industria de la peletería y curtiduría, en la industria vidriera y microelectrónica y como

sellador de maderas. Aunque por razones geológicas naturales, el As se encuentra

por encima de las normas oficiales establecidas en el agua para beber en diferentes

países del mundo (0.01-3.7 mg/l), la mayor parte del As que se encuentra como

(16)

Es bien reconocido que la exposición crónica al iAs es causa de efectos en

salud a diferentes niveles como el gastrointestinal, hepático, renal, cardiovascular,

neurológico, dermatológico, respiratorio, hematopoyético, reproductivo y

endocrinológico (De BK et al., 2004). El As es considerado un agente carcinogénico

según diferentes autoridades en salud mundial como la Agencia para Sustancias

Tóxicas y Riesgo de Enfermedades (ATSDR), la Agencia Internacional para la

Investigación en Cáncer (IARC), El Departamento de Salud y Servicios Humanos

(DHHS), la Agencia de Protección Ambiental (EPA) y el Programa Nacional de

Toxicología (NTP). A través de estudios epidemiológicos se ha establecido una

relación entre la exposición a iAs y enfermedades cardiovasculares, pero los

mecanismos involucrados en este fenómeno no se han esclarecido aún (Bunderson

et al., 2004; Cheng et al., 2011). Por estos motivos, la presencia de iAs como

contaminante ambiental es actualmente considerado como uno de los mayores

problemas en salud pública a nivel mundial, ya que millones de personas en

diferentes países como Bangladesh, Estados Unidos, Argentina, Chile, China,

Ghana, Grecia, Hungría, India y México, están en riesgo de padecer cáncer de piel,

pulmón, bazo, hígado y riñón; enfermedades del corazón, diabetes y otros

(17)

16 al., 2007) las cuales pueden variar de un país a otro.

Dado que las principales rutas de exposición en el humano son la vía oral y

respiratoria, la intoxicación crónica se ha asociado con cáncer broncogénico y a

cáncer de piel, hígado, vejiga y riñón (Chiou et al., 2001; Smith et al., 1998;

Steinmaus et al., 2000; Shi et al., 2004a). Adicionalmente a estos efectos, se ha

establecido una relación epidemiológica entre la exposición crónica a As y la

enfermedad del pie negro, diabetes mellitus tipo II y enfermedades cardiovasculares

(Bunderson et al., 2004; Tseng et al., 1996).

La Organización Mundial de la Salud (OMS) recomienda que el As en el agua para consumo humano no deba exceder las concentraciones de 10 ppb (μg/l).

Mientras que en México, la Norma Oficial Mexicana, NOM 127 SSA-1994 modificada,

estipula que para el 2005, la concentración máxima permisible de As en el agua para uso y consumo humano no debe rebasar los 25 ppb (μg/l).

En México, el Primer Diagnóstico Nacional de Salud Ambiental y Ocupacional

que publicó en 2002 la Comisión Federal para la Protección contra Riesgos

Sanitarios, indicó que el hidroarsenicismo puede afectar a poblaciones grandes como

el caso de la Comarca Lagunera, que abarca comunidades de los estados de

(18)

17 algunas de las localidades más afectadas por altas concentraciones de iAs en el

agua para uso y consumo humano son los municipios de Matamoros, Francisco I.

Madero y San Pedro. Figura 4. En Zimapán (Hidalgo) las concentraciones reportadas van de 370 a 1,000 μg/l (Fuentes, 2004). Otro estado que reporta concentraciones de

As en agua para uso y consumo humano por encima de la norma es Sonora

(Roberge et al., 2012). La zona de estudio ( La comarca Lagunera) también presenta

una alta contaminación del agua de uso y consumo con flúor; este contamínate ha

sido claramente identificado como causal de efectos adversos a la salud (Pei et

al.,2012, Inkielewicz-Stepniak et al ., 2012)como fluorosis dental, y esquelética,

además, es bien conocido que el flúor pasa la barrera hemato-encefálica y produce

daños en el hipocampo y altos niveles de flúor en el agua de bebida (3-11 ppm)

afectan el sistema nervioso central, además diversos estudios argumentan que la

fluorosis puede ser causa del decremento de la inteligencia en niños de áreas

endémicas (Pei et al.,2012, Inkielewicz-Stepniak et al ., 2012).Las concentraciones

reportadas de este elemento químico en territorio mexicano son de 0.5 a 3.7 mg/l

(Armienta y Segovia 2008).

Adicional al problema del agua contaminada con estos dos elementos (As y F)

la zona de estudio (Torreón, Coahuila) esta reportada como una de las ciudades más

contaminadas del mundo debido a las emisiones derivadas de los procesos de

(19)
(20)

M

ETABOLISMO DEL ARSÉNICO

La toxicidad relativa del iAs depende de varios factores que incluyen

principalmente la vía y tiempo de exposición, estado de oxidación (III o V), de la

forma orgánica o inorgánica y de manera muy importante, de la variabilidad

interindividual de la población expuesta.

El iAs es metabolizado por reacciones de óxido-reducción y metilación (Figura

5). Las enzimas que participan en este proceso son la purina nucleótido fosforilasa

(PNP), también llamada arsenato reductasa, encargada de realizar la reducción del

arsenato a arsenito; la arsenito metiltransferasa (AS3MT), encargada de la adición de

grupos metilo (Marnel et al., 2003) usando como cofactor a la S-adenosilmetionina y,

la monometil As reductasa, actualmente conocida como Glutatión S Transferasa

Omega (GSTO), que participa en la reducción de los metabolitos pentavalentes de

As (MMAV) a trivalentes (MMAIII) (Marnell et al 2003; Agusa et al., 2010; Cáceres et

al., 2010; Aposhian et al., 2004; Schläwicke-Engström et al., 2007). Aunque también

se ha documentado que factores endógenos como el ácido lipoico y el GSH son

excelentes reductores de los arsenicales pentavalentes, previo a su metilación

oxidativa (Waters et al., 2000). Una vez que el As entra a la célula vía

acuagliceroporinas, transportadores de glucosa en el hígado (GLUT2), en corazón y

(21)

20 et al., 2010), se lleva a cabo la metilación en dos fases consecutivas, dando lugar al

metabolito monometilado III y V (MMA) y al metabolito dimetilado III y V (DMA).

La mayor parte del As que ingresa al organismo es principalmente excretado

en orina por la acción conjunta de estas enzimas en forma de DMA en un 60-80%,

MMA en un 10-15% y iAs en un 10-20% (Raml et al., 2007). Los metabolitos

metilados existen en forma trivalentes y pentavalentes. La determinación de especies

de As en orina ha sido usado como biomarcador de habilidad individual de metilación

de As (Chen et al., 2003 a-b).

Las diferencias en la susceptibilidad a desarrollar enfermedades puede

deberse a la variabilidad interindividual en la biotransformación del As y de igual

manera, a la presencia de los polimorfismos en genes que codifican enzimas

involucradas en procesos metabólicos (Loffredo et al., 2003); ya que la metilación del

As parece afectar su toxicidad; por lo tanto, es esencial identificar los factores que

afectan la capacidad de metilación para entender mejor el riesgo a padecer algún

tipo de enfermedad relacionada con el contacto con este contaminante a través de

cualquier vía de ingreso al organismo.

En estudios previos, se consideraba la metilación como un mecanismo de

desintoxicación; sin embargo, recientes estudios in vitro indican que las formas

metiladas del As pueden servir como cocarcinógenos o promotores de tumores y

(22)

21 arsenato es un análogo de los fosfatos, por estas características es capaz de

interferir con reacciones de fosforilación compitiendo con el fosfato en el transporte

(Habib, 2009); mientras que el arsenito es una molécula que reacciona con grupos

sulfiidrilo de las proteínas pudiendo inhibir diferentes rutas bioquímicas (Teixeira et

al., 2007).

Tanto el AsIII como el AsV pueden tener efectos similares in vivo, ya que el

arsenato absorbido es rápidamente reducido a arsenito en sangre (Shi et al., 2004 b).

Adicionalmente, se ha reconocido que los metabolitos MMAIII y DMAIII son potentes

inductores de apoptosis; poseen la capacidad de unirse a diferentes proteínas

citosólicas y se les asocia al desarrollo de hiperplasia epitelial en exposiciones in

vitro de células del epitelio humano de tráquea fetal a concentración de 1µM

(Yamanaka et al., 2000; Hughes et al., 2000; Dong et al., 1995; Zhoux et al., 2003).

De igual manera, se ha documentado que el DMAIII reacciona con el oxígeno

molecular generando un radical peróxido, el cual induce rupturas en la cadena de

DNA (Yu et al., 2003).

Dada la gran variabilidad interindividual reportada en el metabolismo del As,

se ha sugerido que ésta puede ser un determinante de la susceptibilidad humana

para el desarrollo de enfermedades asociadas a la exposición a este tóxico.

Estudios recientes revelan una agregación familiar en los perfiles metabólicos de

(23)

22 esta variación. Otros trabajos sobre polimorfismos de esta enzima se han realizado

para evaluar su relación con el riesgo en el desarrollo de diferentes tipos de cáncer

como carcinoma hepatocelular y colangiocarcinoma, entre otros (Marahatta et al.,

2006). Asimismo, alteraciones en los niveles de expresión del gen que codifica

para GSTO1-1 se han asociado con el desarrollo de la enfermedad de Alzheimer

(Li et al., 2004). Debido a que esta enzima está involucrada en procesos

inflamatorios y apoptóticos, así como en el en el metabolismo del As, representa un

interés especial estudiar la posible asociación de los polimorfismos de la GSTO1-1

con alteración en la expresión de genes apoptóticos e inflamatorios en individuos

expuestos a altas concentraciones de As.

(24)

23 Independientemente de los mecanismos involucrados en el desarrollo de

enfermedades por exposición crónica al iAs, ha sido reconocido que la

susceptibilidad a la toxicidad de As y la gravedad en las manifestaciones varía entre

los individuos. La variabilidad interindividual en la biotransformación del As parece

ser un factor clave en tales diferencias (Schläwicke-Engström et al., 2007). Los

metabolitos formados durante la biotransformación del As poseen diferente grado de

citotoxicidad siendo los derivados trivalentes del As los más tóxicos (Wang et al.,

2007). Además, diferentes estudios epidemiológicos han encontrado asociaciones

entre la biotransformación del As y efectos de salud relacionados con este tóxico

(Kile et al., 2009). Por ejemplo, se ha descrito que un aumento de los niveles

relativos de las formas monometiladas del As (MMA III o V) y una disminución en los

niveles relativos de las formas dimetiladas (DMA III o V) en la orina de individuos

expuestos, se ha asociado con el desarrollo de enfermedades periféricas vasculares

(Tseng et al., 2006), carcinomas de vejiga [Chen et al., 2003 a] y cánceres de la piel

[Chen et al., 2003(b)].

M

ECANISMOS DE TOXICIDAD DEL ARSÉNICO

El As puede existir en el ambiente y los sistemas biológicos formando

compuestos orgánicos o bien, puede encontrarse en forma inorgánica, siendo ésta

última la forma que ha demostrado ser más tóxica tanto para humanos como para

(25)

24 oxidación 0); As (III) (estado trivalente o arsenito); y, As (V) (estado pentavalente o

arsenato). Las formas trivalentes y pentavalentes (metabolitos) son respectivamente

más tóxicas que el propio iAs (Shi et al., 2004 b); ATSDR, 2003; Styblo et al., 2000).

La amplia variedad de efectos en la salud observados por exposición al As es

debida a la inducción de estrés oxidante, condición que provoca una disfunción de

enzimas críticas y daño celular. La principal causa de estrés oxidativo durante una

exposición al As se debe a la generación de especies reactivas de oxígeno (ROS)

(Kumagai & Sumi, 2007; Wnek et al., 2009). Importantes enzimas flavin como la

NAD(P)H oxidasa y las isoenzimas de la óxido nítrico sintetasa (NOS) están

involucradas en la generación de ROS asociada a la exposición al As. Se ha

demostrado que el As activa NAD(P)H oxidasa a través de la activación de Cdc42 en

células endoteliales murinas (Kumagai & Sumi, 2007); sin embargo, se ha indicado

que el As también subregula la expresión de NAD(P)H oxidasa a nivel de la

expresión de p22 phox, translocación de Rac1, aumentando así la producción de O2.

-sin embargo, ROS también pueden ser generadas por monometil arsénico (MMA), el

cual es generado por la unión covalente del As al grupo tiol de la óxido nítrico

sintetasa endotelial (Kumagai & Sumi, 2007). ROS juegan un papel muy importante

en la alteración de las vías de transducción de señales y la regulación de los factores

de transcripción, por activación o inactivación de varias señales en las cascadas de

(26)

25 Por otro lado, bajo condiciones normales las enzimas de la NOS generan altos

niveles de óxido nítrico (NO) a partir de L-arginina, con una mínima formación de ion

superóxido. Sin embargo, en condiciones inusuales, el desacoplamiento de las

isoenzimas de la NOS resultan en un decremento de la producción de NO y en la

consecuente reducción de oxígeno molecular a superóxido. Éste a su vez puede

reaccionar rápidamente con NO produciendo peroxinitritos y dando lugar a una

disminución importante de esta molécula, lo cual se ve reflejado en la disminución del

tono vascular (Lee et al., 2003). Consistente con esta noción se ha observado que

animales y humanos expuestos al As muestran una disminución en los niveles

corporales de NO (Kumagai & Sumi, 2007). El arsénico no sólo genera ROS, también

está demostrado que participa en la generación de especies reactivas de nitrógeno

(RNS) en sistemas biológicos. La producción de óxido nítrico (NO) a partir del

metabolismo del As es controversial, ya que el NO es una molécula mensajera que

juega un importante papel en el desarrollo de la respuesta inmune; además de ser un

importante neurotransmisor y vasodilatador. Parece ser que la estimulación de la

producción de NO por As es por activación de la óxido nítrico sintetasa endógena

(Kumagai & Sumi, 2007).

Autores como Kumagai y Sumi 2007 han demostrado que la exposición al As

desencadena la generación de ROS en varios sistemas celulares producidos

principalmente pero no de manera exclusiva por la mitocondria, ya que ROS puede

(27)

26 arsina peroxil (CH3)2As0·), el cual juega un papel muy importante en el daño al DNA

y en la producción de ion superóxido. De igual manera, las especies de metilarsénico

pueden liberar hierro activo de la ferritina y este hierro libre puede jugar un papel en

la generación de ROS y finalmente estas pueden también ser formadas durante la

oxidación del arsenito a arsenato.

La exposición a iAs puede provocar una disminución en los niveles de

moléculas antioxidantes como la glutatión S reductasa (GSR), encargada de

mantener el estado redox en la célula, lo cual desencadena un aumento de estrés

oxidativo, obedeciendo a la teoría de que el estrés oxidativo es una falta de balance

entre la generación de radicales libres y la cantidad de moléculas de antioxidantes en

los organismos vivos.

Se ha propuesto que la disminución celular de GSH en presencia de As puede

deberse a tres razones: (1) la GSH actúa como un posible donador de electrones

para la reducción del As pentavalente a As trivalente; (2) el As presenta una alta

afinidad por la GSH y, (3) la oxidación de GSH por generación de radicales libres

inducidos por As (Han et al., 2008).

La generación de ROS, alteraciones en las cascadas de señales y el

desbalance en los niveles de antioxidantes, activan de manera alternante la

(28)

27

A

RSÉNICO

:

INFLAMACIÓN Y APOPTOSIS

Diferentes estudios demuestran que el consumo crónico de agua contaminada

con iAs a concentraciones superiores a las recomendadas por la OMS se asocia con

la prevalencia de procesos inflamatorios crónicos como la arterosclerosis y el asma

(Sakurai et al., 2004) y se apoya en los hallazgos de estudios in vitro donde se

muestra que el As estimula la expresión de las ciclooxigenasas 1 y 2 (COXs 1 y 2) en

células del endotelio (Bunderson et al., 2002, 2004). Estas enzimas catalizan la

síntesis de prostaglandinas que son importantes mediadores proinflamatorios y

además, se han encontrado sobreexpresadas en procesos neoplásicos tanto en

modelos experimentales como en humanos expuestos. (Raspollini & Taddei, 2007).

Adicionalmente, se ha reportado que el aumento en la expresión COX-2 se

asocia a un incremento en la apoptosis en células mono nucleares (CMN), aumento

en el potencial metastásico de células endoteliales y promoción de la angiogénesis,

la cual está directamente relacionada con una de las patologías más claramente

asociadas al consumo de agua contaminada con iAs, como la enfermedad del pie

negro (Sales et al., 2002; Corsini et al., 1999), que se ha relacionado además con la

iniciación de enfermedades hiperplásicas inflamatorias cutáneas (Huang et al., 2004).

El As es capaz de modular la expresión de genes por medio de la activación

(29)

28 factor nuclear kB (NF-kβ), la proteína p53 y a las clásicas proteínas kinasa activadas

por mitógenos (MAPKs) (Shi et al., 2004 b), las cuales juegan un papel importante en

la proliferación, transformación, diferenciación celular y mantenimiento de la

integridad del genoma (Huang et al., 2004), así como en la respuesta inflamatoria y

la regulación de la apoptosis celular. Por otro lado, la presencia de ROS es crítica

para la respuesta de citocinas, factores de crecimiento y para la activación o

inactivación de diferentes factores de transcripción (Lee, 1993). Existen evidencias

que asocian un estado inflamatorio crónico con el desarrollo de enfermedades como

diferentes tipos de cáncer (Balkwill, 2001; Mantovani, 2001; Balkwill, 2003);

aterosclerosis y diabetes (Guha-Mazumder, 2008); asma, alergias y parasitosis

(Soto-Peña et al., 2006). La respuesta inflamatoria juega un papel importante en la

patogenia de estas enfermedades, ya que las diferentes citocinas proinflamatorias

presentes en el tejido tumoral y sus alrededores, inducen la infiltración de leucocitos,

la angiogénesis, el crecimiento y migración de células tumorales así como la

metástasis (Balkwill, 2006). Es de especial interés el hecho de que la exposición a As

induce un aumento en la respuesta inflamatoria tanto in vivo como in vitro en

diferentes modelos experimentales (Simeonova et al., 2003; Bunderson et al., 2004;

Trouba & Germolec, 2004; Lantz & Hays, 2006; Aguirre-Bañuelos et al., 2008; Wu et

al., 2008; Escudero-Lourdes et al., 2010).

Por otro lado, la producción de ROS inducida por la exposición al iAs también

(30)

29 aumento o disminución de NO, el cual participa de una manera directa en la

inducción del proceso apoptótico (Florea et al., 2005). Otro de los mecanismos

reportados a través del cual el As puede inducir muerte celular programada, involucra

la disminución de la expresión de la proteína securin, la cual es un proto-oncogen

que participa en la regulación de la proliferación celular y la tumorigénesis. (Chao et

al., 2005).

En lo que respecta al efecto de la exposición al iAs sobre los mecanismos

apoptóticos, se ha demostrado que la forma por la cual el As induce apoptosis es

compleja, siendo el peróxido de hidrógeno (H2O2) la molécula más involucrada en

este proceso (Dong, 2002). El H2O2 cumple un papel de mediador para inducir

apoptosis a través de la liberación de citocromo “c” al citosol, activa la proteasa

CPP32 (Caspasa 3) que es el paso previo a la apoptosis final y la degradación de

PARP [poly (ADP-ribosa) polimerasa] que es una proteína que promueve e inicia la

reparación del DNA (Jing et al., 1999; Qin et al., 2008). Por otro lado, el estrés

oxidativo resultante de la exposición al iAs puede también afectar los niveles y la

función de moléculas redox sensibles tales como: p53, NF:kB y AP-1, alterando la

señalización celular y el sistema de expresión genética e inducir de apoptosis.

Los genes p53 y NF-kB son considerados factores de transcripción de

respuesta a estrés que controlan la expresión de una gran variedad de genes

(31)

30 53) es un importante gen supresor de tumores que juegan un importante papel en el

control del ciclo celular, apoptosis y en el control de la reparación de ADN. Las

moléculas AP-1 y NF-KB son expresadas en diferentes tipos de células expuestas al

As (Peng et al., 2007)

A concentracionesbajas, el As puede inducir apoptosis directa a través de la

regulación de puntos de restricción (check point), mientras que a altas

concentraciones induce apoptosis directa por vías diferentes a las que involucra la

(32)

JUSTIFICACIÓN

La exposición humana a compuestos arsenicales se relaciona con una mayor

prevalencia de enfermedades cuyo común denominador es un estado inflamatorio

crónico como la aterosclerosis, la diabetes y el cáncer; adicionalmente, existen

evidencias de que tanto en individuos como en modelos experimentales se presenta

un mayor índice de apoptosis en CMN tras la exposición al iAs. Sin embargo, en el

humano, el riesgo de padecer alguna enfermedad como las mencionadas, así como

el grado del daño observado a nivel celular, parece depender de manera importante

de varios factores como son la respuesta interindividual, la dosis y la vía de

exposición al tóxico. Se ha sugerido que esta respuesta interindividual es debida a la

existencia de diferencias en genes que codifican para enzimas involucradas en el

metabolismo del As como la GSTO1-1. Dado que la GSTO1-1 es una enzima

limitante en el proceso de la bioactivación del As y presenta polimorfismos asociados

a alteraciones en el metabolismo de este tóxico, es posible que polimorfismos

genéticos en esta enzima pudieran ser un factor importante en la variación

interindividual de la respuesta al As. Otros estudios indican que el polimorfismo

E208K está asociado a una incapacidad para metabolizar el AsV, lo que se ve

reflejado en una disposición anormal de iAs y sus metabolitos en orina. Además, la

eficiencia de la actividad enzimática para GSTO1-1 que portan los individuos que

(33)

32 actividad de tioltransferasa en la enzima respecto a la enzima normal. Las

observaciones anteriores sugieren que la presencia de los polimorfismos de la

GSTO1-1 en las diferentes poblaciones humanas puede jugar un papel importante

como factor de riesgo a desarrollar efectos adversos a la salud, ya que estos

polimorfismos pueden modificar su papel: en el metabolismo de tóxicos, en su

función dentro de procesos fisiológicos, en su papel dentro de la respuesta

inflamatoria y el proceso apoptótico.

En este trabajo se evaluó la asociación entre la presencia de los polimorfismos

A140D y E208K del gen que codifica para GSTO1-1 con la expresión de genes que

codifican para proteínas involucradas en la respuesta inflamatoria y apoptótica en

(34)

HIPÓTESIS

La presencia de polimorfismos del gen hgsto1-1 (E155del, A140D y E208K) en

población expuesta al iAs se asocia con una modificación en la expresión de genes

inflamatorios y apoptóticos y con la disposición anormal de iAs y sus metabolitos en

(35)

34

OBJETIVOS

O

BJETIVO GENERAL

Determinar si existe asociación entre la presencia de polimorfismos del gen

hgsto1-1 (A140D, E155del y E208K) y sus combinaciones, con la expresión de genes

involucrados en los procesos apoptóticos e inflamatorios y con alteraciones en la

disposición de iAs y sus metabolitos en individuos expuestos a este tóxico.

O

BJETIVOS PARTICULARES

1- Determinar la frecuencia de los polimorfismos E155del A140D y

E208K de la GSTO1-1 y sus combinaciones en individuos expuestos a iAs en

una población de Coahuila.

2- Evaluar los niveles de expresión de genes apoptóticos (p53, bcl-2, c-myc, ICE3, ICE5, ICE8, ICE9 y ApaF-1,) e inflamatorios (TNF-α,IL-1β IL-6,

IL-8, GM-CSF y TGF-β.), mediante amplificación por PCR Multiplex (MPCR).

3- Realizar la secuenciación de aminoácidos de regiones

(36)

35 4- Determinar los patrones de excresión del iAs y sus metabolitos

en individuos expuestos, mediante espectrofotometría de absorción atónica con

generación de hidruros (HG-AAS).

5- Buscar asociación entre los polimorfismos de GSTO1-1 y sus

combinaciones con la expresión de genes inflamatorios y apoptóticos y con la

(37)

36

METODOLOGÍA

S

ITIO DE ESTUDIO Y SELECCIÓN DE LOS PARTICIPANTES

El presente estudio fue desarrollado con un total de 128 sujetos con promedio

de edad de 17.1 años (rango 5-55), que habitan los municipios de Matamoros y Francisco I. Madero (ejido “El Lequeitio”) en el estado de Coahuila, ubicado al norte

de México. Esta zona ha sido históricamente identificada como una región con altos

niveles de As en el agua potable (Del Razo et al., 1993; García-Vargas, 2004;

Méndez-Gómez et al., 2008). En esta región las concentraciones de iAs en el agua

de beber han sido previamente reportadas en el rango de 10 a 620 µg/l en un gran

número de pozos que son utilizados para obtener agua para el consumo humano;

mientras que en nuestro estudio, la concentración promedio de As fue de 70 µg /l con

un rango de 20-130 µg/l.

El estudio fue aprobado por el Comité de Ética del Instituto Mexicano del

Seguro Social (IMSS). Miembros de Departamento de Epidemiología del IMSS y de

la Facultad de Medicina de la Universidad Autónoma de Coahuila (Torreón),

realizaron una campaña informativa con algunos directores de escuela que se

encuentran ubicadas en zonas donde hasta esos momentos, la concentración de As

en el agua de bebida era superior al valor de referencia que indica la NOM 127; los

(38)

37 dirigida a los padres de familia que tenían niños entre 5 y 15 años y que vivieran en

la zona de interés para asistir a una plática donde se les informó generalidades del

proyecto y en qué consistía la participación en el mismo; así como los criterios

generales que debían cumplir para poder participar. Antes de la obtención de las

muestras se firmarmó un consentimiento informado por cada participante. La

colección de las muestras se realizó de acuerdo a los estándares éticos. Tras una

breve revisión médica y la aplicación de un cuestionario conteniendo información

demográfica general, se determinó que todos los participantes del estudio fueran

sanos en el momento de su inclusión en el estudio. Los sujetos incluidos cumplieron

los siguientes criterios: (i)vivir en la región elegida por un periodo superior a 4 años; (ii)

beber y cocinar con agua de la red municipal; (iii) tener un buen estado general de

salud; (iv) no tener antecedentes de enfermedades crónicas ni recibir medicación; y,

(v)

excluir los mariscos de su dieta durante 7 días anteriores a la recolección de

muestras biológicas.

C

OLECCIÓN DE AGUA Y ORINA

Todos los participantes donaron muestras de la primera orina de la mañana en

ayunas (~ 100 ml). Se tomaron 80 muestras de agua que los participantes utilizan

normalmente para beber; las muestras de agua y orina fueron recogidas en

(39)

38 10% durante toda la noche y enjuagados con agua desionizada. Tras su colección,

todas las muestras fueron almacenadas a -70 °C hasta su análisis.

D

ETERMINACIÓN DE ESPECIES DE ARSÉNICO

La determinación de las especies de As en orina se realizó por la generación

de arsinas volátiles, seguida por la separación cromatográfica y la detección final de

estas especies por medio de un espectrofotómetro de absorción atómica (Perkin

Elmer. Analyst 400) acoplado a un generador de hidruros (HG-AAS) (Del Razo et al.,

2001; Valenzuela et al., 2005). Los arsenicales se separaron en una sola corrida (iAs,

MMA, y DMA), los cuales se identificaron por su tiempo de retención. Este método

genera arsinas arsenicales tri y pentavalentes, separándolas por estructura y no por

su estado de oxidación. De esta manera se determina el iAs incluyendo al iAsIII y

iAsV, MMA que incluye MMAIII y MMAV, y el DMA que incluye al DMAIII y DMAV. Todo el proceso es llevado a cabo en una reacción a ≤ pH2 de la siguiente manera: a 1 ml

de orina se le adicionó 5 ml de agua desionizada y 1 ml de HCl 6M. Esta mezcla se

hizo en una cápsula hermética equipada con una válvula que permite controlar tanto

la salida de las arsinas como la adición de soluciones; el pH final de la mezcla debe

de estar entre 1-2; se deja reposar por 1 minuto al término del cual se inyecta 1 ml de

una solución de NaBH4 al 4% en NaOH 0.02M para que se generen las arsinas

(40)

39 El equipo debe estar acoplado a una trampa de vidrio en forma de ”U” que en

el interior cuenta con una resistencia conectada a un termostato. Inicialmente, la

trampa de vidrio se debe mantener sumergida en nitrógeno líquido. Las arsinas atrapadas son liberadas del tubo en “U”, el cual debe ser removido inmediatamente

de la trampa de nitrógeno líquido, a la cual se le debe aplicar calor para que

finalmente se separen las arsinas por medio de un gradiente de temperatura. Para

validar el análisis se usó un NIST que tiene valor de referencia de As total de 60 µg/l

cuyas réplicas dieron valores de 64±5 µg/l. El porcentaje de recuperación estuvo

entre 90-110% con un coeficiente de variación de <10%.

La determinación de As total (Ast) se consideró como la suma de iAs y de los

metabolitos MMA y DMA y la proporción relativa de cada especie arsenical fue

calculada considerando la suma del Ast como el 100%.

Para normalización de los valores de As en orina, se determinó creatinina

urinaria mediante la reacción de Jaffe, utilizando un sistema comercial (Randox).

C

OLECCIÓN DE SANGRE PERIFÉRICA

Personal capacitado, tomó 10 ml de sangre venosa periférica utilizando tubos

vacutainer ® con EDTA como anticoagulante. Los tubos fueron codificados y

mantenidos en refrigeración hasta su procesamiento en el laboratorio. El paquete

(41)

40 el aislamiento de RNA (esta porción se mezcló con RNAlater (Ambion) en proporción

1:5).

A

ISLAMIENTO DE

DNA

El DNA fue extraído de las muestras de sangre periférica usando una técnica

convencional de fenol-cloroformo como se describe a continuación.

Partiendo de un volumen de paquete celular de 400 µl en un tubo eppendorf

nuevo y estéril, se agregó 1 ml de solución de lisis de eritrocitos, se tapó el microtubo

y se mezcló por inversión durante 10 minutos; al cabo de este tiempo se centrifugó a

6,000 rpm/5 minutos y se descartó el sobrenadante. Nuevamente se agregó 1 ml de

solución de lisis de eritrocitos, se tapó el microtubo y se mezcló por inversión, se

centrifugó a 6,000 rpm/5 minutos se descartó nuevamente el sobrenadante.

Posteriormente se agregaron 400 µl de TE 1X y se resuspendió la pastilla

(golpeando con la uña la base del tubo), se centrifugó a 6,000 rpm/5 minutos y se

descartó el sobrenadante. Nuevamente se agregó 400 µl de TE 1X y se resuspendió

la pastilla como se indicó anteriormente; subsecuentemente se agregaron 400 µl de

solución de lisis total, se mezcló por inversión durante 1 minuto y se agregó 10 µl de

proteinasa K en concentración de 10 mg/ml; se homogeneizó suavemente la mezcla

y se incubó a 55ºC durante 3 horas. Pasado este tiempo se dejó enfriar la digestión a

(42)

41 µl de SEVAG; se mezcló fuertemente con vortex durante 15 segundos y se centrifugó

a 10,000 rpm durante 10 minutos. Inmediatamente se recuperó cuidadosamente el

sobrenadante (fase superior) y se reservó en un tubo nuevo y estéril. Nuevamente se

agregaron 200 µl de fenol saturado y 200 µl de SEVAG, se mezcló fuertemente con

vortex durante 15 segundos, se centrifugó a 10,000 rpm durante 10 minutos, se

recuperó cuidadosamente el sobrenadante (fase superior) y se reservó en un tubo

nuevo y estéril. Con el fin de purificar el DNA se agregó 200 µl de acetato de amonio

7.5 M, se mezcló fuertemente y se dejó reposar en congelador por un periodo de 20

minutos. A continuación, se centrifugó a 10,000 rpm durante 10 minutos y se rescató

el sobrenadante en un tubo nuevo y estéril. Posteriormente, se procedió a precipitar

el DNA con etanol, agregando 2 volúmenes de etanol absoluto a temperatura

ambiente y se mezcló por inversión e incubó por 30 minutos en hielo. Transcurrido

este tiempo, las muestras se centrifugaron a 14,000 rpm durante 10 minutos y se

descartó el sobrenadante. Se lavó el DNA agregando a la pastilla resultante 1 ml de

etanol al 70% previamente helado, se mezcló por inversión durante 1 minuto y se

centrifugó a 14,000 rpm durante 10 minutos, descartándose el sobrenadante. El

botón de DNA se dejó secar durante 10 minutos manteniendo el tubo invertido en

ambiente de mechero o campana. Finalmente, el botón de DNA se resuspendió en

(43)

D

ETECCIÓN DE LOS POLIMORFISMOS

Las características generales de los polimorfismos estudiados en este trabajo

se describen en la Tabla 1.

Tabla 1. Características generales de los polimorfismos que fueron evaluados.

Gen Hgsto1-1

Localización cromosomal 10q 25.1

SNIP ID rs4925 rs11509437 rs7077635

Polimorfismo CTATGC/ATGGCC AGAGGAGG/-TAATT AACACG/ATTTTC

Aminoácido cambiado A140D E155del E208K

Oligonucleótidos forward

5’-3’ GACCAAGCCAGCATTTTAGGC

GACCAAGCCAGCATTTT AGGC

CTGTGATGTCATCCT AGTTG

Oligonucleótidos reverse 5’-3’

CTTGTGGAAACGTCCCT ACAATTTC

CTTGTGGAAACGTCCCT ACAATTTC

CATGCAACCTGAAC CTTGGT

Producto de PCR 586 pb 586 pb 308 pb

Número de ciclos 35 35 35

Exón 4 4 6

Temperatura de alineamiento 50°C 50°C 63.5°C

P

OLIMORFISMO

A140D

Y

E155

DEL DE LA

GSTO1-1

Para los polimorfismos A140D y E155del se amplificó el exón 4 del gen de la

GSTO1-1 mediante el uso de oligonucleótidos que amplifican una región de 586

pares de bases y el producto de PCR se usó para hacer ensayos de secuenciación.

Las secuencias del par de oligonucleótidos usados en la detección de este

(44)

Tabla 2 Oligonucleótidos para la amplificación por PCR de los polimorfismos de interés y sus características

Para realizar los ensayos de amplificación por PCR se usó una mezcla de los

oligonucleótidos con los diferentes reactivos a concentraciones necesarias para

amplificar el fragmento deseado, de la manera que se indica en la Tabla 3.

Tabla 3. Concentración de reactivos necesarios para hacer la amplificación por PCR.

DNA 50ng/µl 100 ng 2 µl

Buffer Tris-HCL 20mM

KCl 50 mM

5 µl

Oligonucleótidos 1 µM Forward 1µl

Reverse 1µl

dNTP’s 10 mM 1µl

MgCl2 1.5 mM 1.5 µl

taq DNA polimerasa 1 U/µl (invitrogen life Technologies).

0.8µl

Agua ultrapura 37.7 µl

Volumen final 50 µl

De igual manera, para amplificar los diferentes segmentos se optimizaron las

condiciones para cada primer.

Las condiciones de amplificación para el exón 4 del gen de la GSTO1-1 se

reportan en la Tabla 4.

Polimorfismos A140D E155del E208K

Oligonucleótidos forward

5’-3’ GACCAAGCCAGCATTTTAGGC

GACCAAGCCAGCATTTT AGGC

CTGTGATGTCATCCT AGTTG

Oligonucleótidos reverse 5’-3’ CTTGTGGAAACGTCCCT ACAATTTC CTTGTGGAAACGTCCCT ACAATTTC CATGCAACCTGAAC CTTGGT

Producto de PCR 586 pb 586 pb 308 pb

Número de ciclos 35 35 35

Exón 4 4 6

(45)

44

Número de ciclos Temperatura Tiempo

Primer paso (D) 1 95°C 2(min)

Segundo paso (D, A, E) 35 94° C 30 (sec)

66.3° C 30 (sec)

a 72° C 30 (sec)

Tercer paso (E) 1 72°C 10 (min)

(46)

P

OLIMORFISMO

E208K

DE LA

GSTO1-1

Para el polimorfismo E208K se amplificó el exón 6 del gen de la GSTO1-1

mediante el uso de oligonucleótidos que amplifican una región de 308 pares de

bases y el producto de PCR se usó para hacer ensayos de secuenciación. Las

secuencias del par de oligonucleótidos usados en la detección de este polimorfismo

se pueden observar en la Tabla 2.

Las condiciones de amplificación para el exón 6 del gen de la GSTO1-1, se

reportan en la tabla 5.

Tabla 5. Condiciones de corrida para amplificar el exón 6. Número de ciclos

Temperatura Tiempo

Primer paso (D) 1 95°C 5 (min)

Segundo paso (D, A, E) 35 95° C 1 minuto

50° C 30 (sec)

a 72° C 1 (min).

Tercer paso (E) 1 72°C 10 (min)

Todas las reacciones de PCR se llevaron a cabo en un termociclador Techne

de 25 pozos y los resultados se sometieron a electroforesis en geles de agarosa al

1.5% a 90 volts por un periodo de 40 minutos y se analizaron en un

fotodocumentador Gel-Doc 2000 BIO-RAD mediante el uso del programa Quantity

(47)

S

ECUENCIACIÓN

P

URIFICACIÓN DE PRODUCTOS DE

PCR

Previo a la secuenciación fue necesario purificar los productos de PCR para lo

cual se usó el kit QIAquick PCR Purification Kit Protocolo de QIAGEN®. Este kit está

diseñado para purificar fragmentos de DNA tanto de cadena sencilla como de cadena

doble, obtenidos como producto de PCR con el objetivo de remover todo exceso de

oligonucleótidos, nucleótidos, polimerasas y sales mediante el uso de columnas,

dejando solamente disponibles el fragmento de DNA de nuestro interés que en este

caso es de 308 y 586 pares de bases según el polimorfismo.

El protocolo de purificación se realizó siguiendo las instrucciones del

proveedor. Subsecuentemente el producto purificado se cuantificó con el fin de

asegurar que la concentración de ácidos nucleicos fuera superior a 40 ng

(concentración mínima requerida para los ensayos de secuenciación). Por último, las

muestras se dispensaron en placas de 96 pozos y se pusieron a secar a no más de

60°C.

Por último, los productos de PCR purificados fueron enviados para su

secuenciación en ambas direcciones, junto con 200 µl de cada uno de los

oligonucleótidos al Laboratorio Nacional de Genómica para la Biodiversidad del

(48)

47 por medio del uso del editor de secuencias BioEdit (http://bioeditor.sdsc.edu).

A

ISLAMIENTO DE

RNA

El RNA genómico fue extraído de paquete celular de sangre periférica el cual

fue conservado en RNAlater® en proporción de 1:5. Para proteger el RNA en

muestras frescas o así, se eliminó la necesidad de procesar las muestras

inmediatamente. Las muestras son sumergidas en el RNAlater® y almacenadas para

su posterior extracción lo cual facilita el trabajo en campo. La posterior extracción de

RNA se realizo con el uso del kit RiboPureTM-Blood. Finalmente, se hicieron

alícuotas de 33 µl y se cuantificó el ARN.

S

ÍNTESIS DE C

DNA

El cDNA se obtuvo por medio de RT-PCR usando un sistema de transcripción

reversa SuperScript II (Accesolab). En un microtubo de 200 µl se puso 1 µl del buffer

DNasa 10X, 1 µl de DNasa 1 (1 U/ µl), 1 µl de agua DEPC al 0.1%, 0.5 µg de RNA y

finalmente se agregó la cantidad necesaria de agua DEPC 0.1% hasta completar 10

µl. De esta manera, se obtuvo un ARN libre de ADN. Esta mezcla se incubó por un

periodo de 15 minutos a temperatura ambiente, se le agregó 1 µl de EDTA 25mM, se

calentó a 65°C por un periodo de 10 minutos (en el Termociclador), al cabo de los

(49)

48 Termociclador). Al término de este periodo, los tubos se pusieron en hielo inmediatamente y se les adicionó 1 µl de dNTP’s 10mM, 4 µl de buffer RT 5X, 2 µl de

DTT 100mM y 1 µl de RNAsa out (40 U/µl). Esta mezcla se homogeneizó

cuidadosamente y se incubó a temperatura ambiente por un periodo de 2 minutos.

Posteriormente, se le adicionó 1 µl de transcriptasa reversa superscript II y se llevó al

Termociclador bajo las condiciones que se especifican en la Tabla 6.

Tabla 6. Condiciones para síntesis de cDNA.

Número de ciclos

Tiempo en minutos

Temperatura en °C

1 10 25

1 50 42

1 15 70

C

UANTIFICACIÓN DE ÁCIDOS NUCLÉICOS

Se hizo una dilución de la muestra con agua ultrapura a una concentración de

1:100 ó 1:50 y se registraron lecturas en espectrofotómetro Spectronic genesis 8:

una a 260 nm (que es donde se registra el máximo pico de absorción para ácidos

nucleícos) y otra a 280 nm (que es donde se detecta el máximo pico de absorción

para proteínas). Se anotaron ambas lecturas y se sacó la concentración y la relación

ácidos nucleícos/proteínas.

Relación ácidos nucleicos/proteínas= Absorbancia a 260

(50)

49

Esta relación debe ser superior a 1.5 lo cual representa la pureza del material genético.

La concentración de ácidos nucleicos se determinó multiplicando la

absorbancia registrada a 260 nm por una constante que en el caso de cDNA y DNA

tiene un valor de 50 y en el caso de RNA el valor de la constante es 40. La

concentración final de ácidos nucleicos se expresó en ng/µl ó µg/ml. Finalmente, la

concentración de las muestras se ajustó a 50 ó 100 ng/µl con agua ultrapura, y

fueron almacenadas a -70°C hasta su uso en la amplificación de genes que

participan tanto en procesos apoptóticos como inflamatorios y de igual manera en la amplificación de genes endógenos llamados housekeeping (β-actina) como controles

de carga y de expresión.

EVALUACIÓN DE LA EXPRESIÓN DE GENES

Con el cDNA obtenido se evaluó la expresión de genes implicados en

procesos de apoptosis como p53, bcl-2, c-myc ICE3, ICE5, ICE8, ICE9 y ApaF-1 y genes implicados en procesos inflamatorios como TNF-α,IL-1β IL-6, IL-8, GM-CSF y

TGF-β, por medio del uso de un sistema comercial de PCR multiplex (MPCR, Maxim

Biotech, Inc). En la evaluación de la expresión de los genes mencionados se

establecieron las concentraciones de reactivos y material genético como se describe

(51)

Buffer 2X de PCR multiplex

25 µl

Mezcla de

oligonucleótidos 10X

5.0 µl

taq DNA polimerasa

(5U/ µl).

0.5 µl

cDNA (0.5ng/µl) 10.0 µl

agua ultrapura 9.5 µl

Volumen final 50µl

Las condiciones de corrida para la amplificación del MPCR donde se evalúa la

expresión de genes apoptóticos, se reportan en la Tabla 8.

Tabla 8. Condiciones de corrida para la determinación de genes apoptóticos.

Número de ciclos Temperatura Tiempo

Primer paso (D) 2 96°C 1 minutos

60°C 4 minutos

Segundo paso (D, A) 35 94° C 1 minuto

60° C 2 minutos

Tercer paso (E) 1 70°C 10 minutos

Las condiciones de corrida para la amplificación del MPCR donde se evalúa la

(52)

Número de ciclos

Temperatura Tiempo

Primer paso (D) 2 96°C 1 minuto

64°C 4 minutos

Segundo paso (D, A) 35 94° C 1 minuto

64° C 2 minutos

Tercer paso (E) 1 70°C 10 minutos

Una vez finalizada la reacción, los productos de PCR se sometieron a

electroforesis horizontal en geles de agarosa ultra pura (Invitrogen) al 2 %, a no más

de 90 volts por un periodo de 2.5 horas en amortiguador TBE 0.5X. Finalmente, se calculó la expresión genética relativa teniendo en cuenta la relación expresión de β

actina como gen endógeno y se comparó con el gen de interés. Los análisis fueron

realizados en un sistema de documentación Quantity one (Bio-Rad).

ANÁLISIS ESTADÍSTICO

Para determinar si la presencia de los polimorfismos, y disposición de

metabolitos de iAs se asocia a la expresión de genes inflamatorios y apoptóticos, los

datos obtenidos del análisis de expresión de estos genes fueron establecidos como

variables de respuesta, mientras que las variables de sexo, edad, polimorfismos y

concentración de las especies de As y la suma de las especies (Ast) en orina se

establecieron como variables explicativas. Dado que las variables de respuesta

fueron continuas, se utilizó regresión múltiple con el coeficiente de determinación

múltiple para medir la importancia de las variables explicativas. Para determinar el

(53)

52 DMA y iAs, las proporciones o porcentajes de los mismos excretados en orina, fueron

establecidos como variables de respuesta; mientras que la presencia de los

polimorfismos fue establecida como variable explicativa. Los datos faltantes en la

base de datos fueron asignados mediante imputación múltiple cuando fue posible. Se

establecieron los mejores modelos para el análisis basado en los objetivos del

trabajo; la dependencia entre las variables fue determinada mediante pruebas de

ANOVA. Todas las pruebas de significancia se llevaron al 95% nivel de confianza.

Para los modelos que resultaron significativos se efectuó simplificación mediante

pruebas de razón de verosimilitud hasta que todos los términos resultaron

significativos. Si la variable explicativa que resultó significativa es discreta, entonces

se utilizó la prueba de Turkey HSD (Honestly Significant Difference) usando el

paquete computacional Multcomp (Bretz & Westfall, 2011). Diferencias y

correlaciones fueron consideradas significativas con un valor <0.05.

Para el análisis de la expresión de los genes que participan tanto en procesos

apoptóticos como inflamatorios se comparó cada uno de ellos con las variables que

se describen en la tabla 10. Para la obtención de los índices de variabilidad genética,

se utilizó la prueba de equilibrio Hardy Weinberg (HW) mediante el uso de la formula

(54)

Tabla 10. Genes evaluados y variables comparativas empleadas en el estudio.

Genes evaluados Variables comparativas

Apoptóticos inflamatorios Edad

p53 bcl-2 c-myc ApaF-1

TGF-beta IL8 IL6 CMS-CF

Sexo

Combinación de polimorfismos

Concentración de iAs Concentración de MMA

Concentración de DMA

Concentración de As Total

Relación MMA/iAs

Relación DMA/MMA

% iAsV

%MMAV

Figure

Actualización...

Referencias

  1. (Oakley, 2
  2. (Li http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&term=%22Li+YJ%22%5BAuthor%5D
  3. (Lima e
  4. (Del Razo e
  5. it (http://bioeditor.sdsc.edu).
  6. Interleukin 8 and cardiovascular disease.
  7. . Arsenic and fluoride in the groundwater of México.
  8. TNF-alpha in promotion and progression of cancer.
  9. . Inflammation and cancer: back to Virchow?
  10. .http://www.ncbi.nlm.nih.gov/pubmed?term=%22Dulhunty%20AF%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract
  11. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=17226937&query_hl=17&itool=pubmed_docsum
  12. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=10783391&query_hl=17&itool=pubmed_docsum
  13. . CLIC-2 modulates cardiac ryanodine receptor Ca2+ release channels.In
  14. Relevance of the deletion polymorphisms of the glutathione S-transferases GSTT1 and GSTM1 in pharmacology and toxicology.
  15. . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&term=%22Beall+HD%22%5BAuthor%5D
  16. . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=AbstractPlus&list_uids=12392964&query_hl=3&itool=pubmed_docsum
  17. 2010. Polymorphism of glutathione S-transferase (GST) variants and its effect on distribution of urinary arsenic species in people exposed to low inorganic arsenic in
  18. . http://www.ncbi.nlm.nih.gov/pubmed?term=%22Santucci%20R%22%5BAuthor%5D
  19. Atherosclerosis induced by arsenic in drinking water in rats through altering lipid metabolism.
  20. Expression of angiogenesis-related genes regulates different steps in the process of tumor
  21. (a). Arsenic methylation and skin cancer risk in southwestern Taiwan.
  22. Arsenic methylation and bladder cancer risk in Taiwan.
  23. . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&term=%22Kundu+S%22%5BAuthor%5D
  24. Barbier O,
  25. . http://www.ncbi.nlm.nih.gov/pubmed?term=%22Cebrian%20ME%22%5BAuthor%5D
  26. Mutat Res.
  27. Cullen WR,
  28. . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_AbstractPlus&term=%22Thomas+DJ%22%5BAuthor%5D
  29. . http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&term=%22Luo+XM%22%5BAuthor%5D
  30. The molecular mechanisms of arsenic-induced cell transformation and apoptosis.
Descargar ahora (102 página)