Iván Alejandro Giraldo Gómez M.Sc. Biological Sciences, Centro de Investigaciones Microbiológicas - CIMIC, Universidad de los
Andes Cra 1 Nº 18A- 12 Building J- 206 Bogotá, Colombia, [email protected]
Jenny Dussán Garzón Ph.D. Associate Professor, Department of Biological Sciences, Centro de Investigaciones Microbiológicas - CIMIC, Universidad de los Andes, Cra 1 Nº 18A- 12 Bogotá Building J- 206, Colombia. Telephone: (57-1) 3-394949 Ext 3644 of/ 2767 lab
New insight on Gold and Copper leaching from waste printed circuit boards by Chromobacterium violaceum : Three steps process
Abstract
Printed circuit boards (PCBs), have a high metal content including copper, silver and gold, making them interesting to recycle, both to reduce pollution and, from an economic perspective, by reusing the precious metals. We implemented a three-phase process leading to a) the bio production of hydrogen cyanide (HCN) in a commercial medium in a continuous flow stirred-tank reactor (CSTR), b) gold and copper leaching from PCBs, and c) HCN degradation by Chromobacterium violaceum. This process was more efficient at leaching gold than it was at leaching copper. HCN production by C. violaceum in CSTR was 94.1 g/m3 every 3 days in A5MNF medium, and was recovered by an absorption column. The addition of Iron (III) chloride had an effect on the expression of hcnA, while adding potassium nitrate improved the increase in biomass. The maximum expression of hcnA in A5MFN was obtained by a flow of 0.27 cm3/s, guaranteeing the best production of HCN in CSTR. The addition of H2O2 every 4 hours to
the leaching medium and a pH of 12.5 potentiated a higher recovery rate of gold over copper. The third step of this process is shown to be able to reduce the HCN concentrations from 12.8 g/m3 a 0.021 g/m3 in
4 days. The degradation of the remaining HCN from the leaching process responds to the formulation of new environmentally responsible technologies.
Keywords:
Biodegradation - Chromobacterium violaceum – Leaching – Gold - Electronic waste
Introduction.
Factors such as major advances in technology, the miniaturization of some electronic devices and the reduction of their life cycle, have lead to a new kind of waste: Electrical & Electronic Equipment Waste (WEEE). It was estimated that in 2005, the production of this type of residue reached 50 million tons
in the world [1], and the forecast for 2020, is that it will reach an annual growth ratio of around 2.5 to 2.7
per cent [2].
Amongst the WEEE, the most relevant electronic devices may be printed circuit boards (PCBs), which have a high content of metals such as copper, silver, gold etc., making them interesting to recycle not only to control pollution, because they are currently being dumped in landfills, causing a serious environmental harm in the form of leached hazardous compounds, but also from an economic perspective, by reusing the precious metals [2].
Different hydrometallurgical technologies are currently used to recover metals from this type of waste. One of the most important is bioleaching through cyanidation, which involves the use of cyanogenic bacteria such as Chromobacterium violaceum, capable of generating hydrogen cyanide (HCN) from glycine during the growth and early stationary phase of the bacteria [3]. This metabolite is produced by HCN synthase, encoded by the hcnABC operon [4]. The expression of the HCN synthase enzyme is controlled by an Anaerobic Regulator ANR/FNR, copper (III) as cofactor and high cellular density activator - GacA[4]. In batch cultures of Pseudomonas fluorescens and Pseudomonas aeruginosa, HCN syntehase production is optimally induced in a medium containing an iron concentration in the 3 to 300 µM range, and oxygen levels from 0.1 to 180 µM at pH 7 [5][6].
The leaching processes with cyanide requires a pH of above 10.5 and the presence of oxygen [7][8]. Under physiological conditions of bacteria growth (pH 7), the cyanide is mostly present as HCN, which can evaporate into the environment, according to its pKa of 9.3 [9]. An alkaline pH not only facilitates the retention of cyanide as ion CN- in liquid medium, but also potentiates the cyanidation reaction, [10]. The
dissolved oxygen (DO) in the medium potentiates the formation of gold ions. According to the Elsner equation, these ions are anodically completed by cyanide, forming a soluble complex of ions Au(CN)−
2,
which is important for the leaching process of this metal [11]. The addition of Hydrogen Peroxide (H2O2)
to the medium increases the DO levels [12]. The addition of H2O2 to a concentration of less than 0.0025
M of H2O2, potentiates the leaching of gold, but a concentration higher than 0.012 M stops the leaching,
due to cyanide oxidation by peroxide [13].
Not only does C. violaceum have the capacity to generate HCN, but it is also able to reincorporate HCN into different metabolic pathways to degrade it afterwards [14]. Three possible enzymes might be involved in this process: β-cyanoalanine synthase, γ-cyano-α-aminobutyric acid synthase and rhodanese [9]. It is believed that the β-cyanoalanine synthase enzyme plays a major role in the decontamination of HCN. In the post-cyanogenic period, the β-cyanoalanine synthase concentrations increase. Under conditions of low aeration, this enzyme is induced by the presence of cysteine, which reacts with the HCN to form β-cyanoalanine, to later be transformed, via hydrolysis, into asparagine [15].
Currently, many of the processes reported for HCN production by C. violaceum to be used for hydrometallurgical purposes, are carried out in specialised mediums such as Luria–Bertani (LB) and YP medium, supplemented with glycine [16][17], which tend to be the more expensive options. At the same time, the leaching of the metals is performed in the same microbiological growth medium, which yields to optimal parameters of pH and DO of production, but is out of the optimal range of conditions for leaching and degradation of HCN. This leads to a decrease in the competitiveness of these types of technologies compared to conventional alternatives. Due to the reasons exposed above, the purpose of this study was to implement a three-phase process leading to a) the production of HCN in a commercial medium, b) the leaching of gold and copper present in PCBs, and c) HCN degradation by C. violaceum.
Materials and Methods
Evaluation of growth mediums and preliminary determination of HCN.
C. violaceum strain M1 was obtained from the collection of microorganisms at the Centro de Investigaciones Microbioloógicas (CIMIC) at Universidad de los Andes [18]. It was revived in LB medium at 7 pH and 30 ºC with shaking at 150 rpm for 2 days [19].
C. violaceum growth and HCNproduction were evaluated in different growth mediums described in Table 1. C. violaceum growth was assessed by viable cell count performed every 30 minutes for 10 hours. To produce HCN, 5 mg/cm3 of glycine were added to each medium [16]. The experimental setup
included 15 cm3 of medium at pH 7 on gum screw-cap tubes incubated at 30 °C, with 3.25 g/m3 of DO at
150 rpm [19]. These tubes were connected to an air pump and an absorption column at pH 12.5. The setups were prepared in triplicate. At pH 7 and 30ºC, over 99% of the cyanide generated existed as hydrogen cyanide (HCNg) [20]. This HCNg was introduced into the absorption column at pH 12.5 to be
recovered as hydrocyanic acid (HCN(ac)), which was then measured every 4 hours for 24 hours. The
concentration of HCN(ac) was quantified in the form of free and disassociated cyanide using a
photometric 0.002 – 0.005 mg/cm3 CN- Spectroquant® test kit (Spectroquant Nova 60A, Merk).
Recovering gold and copper from the PCBs
A three-step process was carried out to recover gold (Au) and copper (Cu) from the PCBs: the production of HCN by C. violaceum, the leaching of Au and Cu, and HCN degradation by C. violaceum (Fig. 1). The production step (step 1) involved a continuous flow stirred-tank reactor (CSTR), connected to an absorption column at pH 12.5 that absorbs HCN gases generated by the CSTR. In the leaching step (step 2), the HCN produced in step 1 was applied to the PCBs in order to recover the gold and copper. Finally, the degradation step (step 3) used a batch reactor fed by the products from steps 1 and 2.
Table 1 Composition of the different growth medium
Step 1: Production of HCN and expression of hcnA by qRT-PCR
The behavior in step 1 was assessed using the viable cells concentration method in the A5M medium supplemented with nitrogen 2 mg/cm3 of KNO
3 (A5MN): with iron 0.040 mg/cm3 of FeCl3 (A5MF) and
the two salts (A5MFN). HCN production was evaluated every 12 hours. The expression efficiency of hcnA was assessed at 0.22 cm3/s, 0.27 cm3/s and 0.31 cm3/s medium flow rates by Real-Time Quantitative Reverse Transcription PCR (Real-Time qRT-PCR). The CSTR was inoculated with 0,0025 m3 of A5M medium and 0,0005 m3 of medium with C. violaceum in log phase. It was operated at 30º C
with shaking at 120 rpm and a concentration of 3.25 g/m3 of DO, with permanent air supply. The recovery efficiency of HCNg into the absorption column was evaluated through pressure ranges from
150hPa to 180 hPa every day for 45 days. The absorption column had a pH of 12.5.
Fig.1 The flowchart of the process for the production of HCN by C. violaceum (1), the leaching of Au and Cu (2), and the degradation of HCN by C. violaceum (3). CSTR: Continuous flow stirred-tank reactor, AP: Air Pump, AC: Absorption Column, RMG: Ring Mill Grinder, LG: Gold leach tanks LC: Copper leach tanks. S1-2 Storage tanks, BR: Batch Reactor
To assess the expression of hcnA, RNA extractions were performed on a 350 µl sample of the liquid medium using the kit Quick-RNA MicroPrep (ZYMO RESEARCH). The samples were purified with
Composition
LB
Yeast extract (Extra Pure grade) Tryptone
NaCl
5 mg/cm3
10 mg/cm3
10 mg/cm3
LS Yeast extract (Extra Pure grade) NaCl
15 mg/cm3
10 mg/cm3 A5 Commercial yeast extract (Technical grade)
White sugar
16.5 mg/cm3 1.62 mg/cm3
B1
Commercial yeast extract (Technical grade) White sugar
NaCl
12.75 mg/cm3 1.7 mg/cm3
1.7 mg/cm3
M
KH2PO4
NH4Cl
Na2SO4
CaCl2 6H2O
MgSO4 7H2
0.5 mg/cm3
1 mg/cm3 2 mg/cm3
0.001 mg/cm3
5'ACTGCTGCCTGGTCAAGATAG3' 5'CATTGCAAACCCTCCGTATTCA3' were designed to amplify the hcnA gene. Real-time PCR (RT-PCR) reactions were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems), using the Maxima SYBR Green/ROX qPCR Master Mix (2X) kit (Thermo) with a total reaction volume of 25 µl per well. For all RT-PCR reactions, rpoB and gyrB were used as controls for normalization between samples [21] [22]. RNA and cDNA sample concentrations were determined by an absorbance ratio of A260/A280 with a Nanodrop ND-1000 (Thermo Scientific). The integrity of the samples was confirmed using 1.0% agarose gel electrophoresis showing an expected specific band.
Step 2: Leaching of Au and Cu from the printed circuit boards (PCBs)
For step 2, the printed circuit boards (PCBs) were obtained from an electronic device shop in Bogota, Colombia. The scrap from the PCBs was cut to 1mm x 1mm size squares, and then ground to 150–200 µm sieve fraction by using a ring mill grinder [23]. Leaching was carried out in Schott flasks (500ml) using 300 ml of water at pH 12.5 with a HCN concentration of 54 g/m3 de HCN and 15 mg/cm3 of pulp
[24]. The setups were incubated for 8 days at 45°C and 220 rpm. Every 2 days, a concentration of 0.0020 M H2O2 was added to the medium [8]. The concentration of gold and copper was measured by
Inductively Coupled Plasma Mass Spectrometry (ICP-MS). The total amounts of gold and copper present in the PCBs were determined through the leaching of the samples in aqua regia [7].
Step 3: Degradation of HCN by C. violaceum.
HCN degradation by C. violaceum was evaluated through the concentration of HCN in the growth medium and by viable cell count every 12 hours for 4 days. Two types of setups were configured. The first setup was made of Schott flasks (500ml) with 200 mL C. violaceum in stationary phase, and 30 mL of HCN at 68 g/m3 and pH 7. The setups were made in triplicate and were kept at 100 rpm and 30 ºC [14].
With the data obtained from the first setup, a second setup was configured where HCN degradation was carried out in a batch reactor. The batch reactor was fed with 400 mL of medium generated at the exit of the CSTR (biomass at early stationary phase) and 60 mL of HCN remaining from leaching from step 2 at pH 7. The batch reactor was operated at 75-hour cycles, at 25 ºC and 100 rmp. During each cycle, 0,0003 µg/cm3 of L-Cysteine hydrochloride monohydrate was added [15]. The HCN concentration released into
the environment was determined by its recuperation in the absorption column.
Statistical analysis
The data obtained from the production of HCN in different mediums was analysed by calculating the statistical significance using ANOVA and Tukeys’ significance test using R software (3.1.1 GUI 1.65 Mavericks build (6784)) with a p-value of less than 0.05. The comparative and statistical analysis of relative expression results in real-time PCR was calculated using the relative expression software tool (REST©)[25]
Results and Discussion
Evaluation of the medium for C. violaceum growth and HCN production
C. violaceum M1 reached the early stationary phase in LB medium (control) in about 6 to 8 hours (DO at 660nm of 1.3) with a cellular density of 2,4x108 CFU/cm3 a 30ºC, 150 rpm and pH 7. In the LS medium, it reached this same stage after 8 hours, with a cellular density of 2,4x108 CFU/cm3 while in mediums
A5M and B1M they reach this stage after 10 hours (3,4x107 CFU/cm3) and 12 hours (9,7x106 CFU/cm3)
respectively (Fig.2a). HCN(ac) production in LB medium was of 19.9 g/m3 after 20 hours. In A5M
medium, 19.5 g/m3 was recorded after the same amount of time. In B1M and LS medium, HCN(ac),
production was lower than the two previous media and reached concentrations of 12.4 g/m3 after 16 hours
and 10.4 g/m3 after 20 hours respectively (Fig.2b). Even though the A5M medium had a lower growth of
C. violaceum than the LS medium, it had a similar HCN(ac) production as the one found in the LB
medium. In terms of comparison between cell population vs. cyanide concentration, the A5M medium was better for the production of HCN(ac) than the conventional LB medium.
HCN production and hcnA gene expression by qRT-PCR into the CSTR of step 1
The increased production of HCN(g) in the CSTR, implies a higher concentration HCN(ac) available for
leaching. This relationship depends on the medium and the specific growth velocity (µmax) by the flow, in
order to maintain the bacteria growth in the early stationary phase for hcnA synthesis. The results showed that HCN(ac) production in the A5M medium in the CSTR was 12 g/m3, with a cellular density of 1,6x106
CFU/cm3 in 4 days, (Fig. 3). According to Rodgers P.B. in 1982, under low nutrients conditions, C. violaceum is able to raise the levels of β-cyanoalanine synthase, to use the HCN generated for its own growth [20], possibly explaining low HCN production with A5M medium in the CSTR. The A5M medium was not the most adequate option for the CSTR. To improve the A5M medium, we added Iron (III) chloride (as cofactor) and potassium nitrate.
A B
Fig. 2 Evaluation for growing C. violaceum by cell a) population and b) production of HCN(g) in B1M,
LS, A5M and LB mediums.
A B
Fig. 3 Evaluation for a) Cell concentration and b) HCN production into the CSTR
The addition of Iron (III) chloride to the medium (A5MF) elevated the production of HCN(ac) from 12 g/m3 to 39.7 g/m3 (Fig. 3b), and hcnA was 6.3 times more highly expressed in this medium than in the
0.003 0.03 0.3 3 30
0 2 4 6 8 10 12 14 16
C e ll p o p u la ti o n x 1 0
7 [c
e
ll
/
c
m
3 ]
Time [hrs] LS LB B1M A5M 0 5 10 15 20
0 5 10 15 20 25
c y a n id e c o n c e n tr a ti o n [g /m 3] Time [hrs] B1M LS A5M LB 0.019 0.19 1.9 19
0 1 2 3 4
C e ll p o p u la ti o n x 1 0
7 [c
e ll / c m 3] Time [d] A5M A5MF A5MN A5MNF 0 10 20 30 40 50 60
0 1 2 3 4
c y a n id e c o n c e n tr a ti o n [g /m 3] Time [d] A5MF A5MN A5MNF A5M
of hcnA expression in this medium was 0.31 cm3/s flow (Fig. 4b). When potassium nitrate was added to the medium (A5MN), cellular concentration increased from 5,6x106 CFU/cm3 to 4,2x108 CFU/cm3, but
the concentration of HCN(ac) decreased by 30.6 g/m3 compared to the A5MF medium (Fig. 3). hcnA
expression in A5MN was 1.8 times more than in the A5M medium and had its highest expression with a flow of 0.22 cm3/s (Fig. 4). The combination of these two mediums (A5MFN) increased the production of
HCN(ac) from 39.7 g/m3 to 55.2 g/m3 compared with the A5MF medium. The expression of hcnA in this
medium is 6.5 times higher than in A5M. The highest production in this medium was obtained with a 0.27 cm3/s flow and 4.2 times more highly expressed in A5MN and 0.9 higher than the maximum expression in A5MF (Fig. 4). Constant monitoring for 45 days showed that hcnA expression remains constant with this flow throughout the time. The cellular concentration in the A5MFN medium did not generate any significant change compared with the A5MN medium. According to Knowles and Bunch (1986), a high concentration of carbon and nitrogen in the medium inhibits the production of some enzymes responsible for recycled cyanide [9]. In this case, the addition of an extra nitrogen source may not only decrease the production of β-cyanoalanine synthase—which avoids HCN degradation by the bacteria—but it also solved a deficiency in nutrients required to increase the volume of the growth medium in the CSTR. The finest production of HCN(g) in CSTR in step 1, was obtained using the
A5MFN medium, with a constant flow of 0.27cm3/s. At this flow, bacteria growth remains at an early stationary phase throughout the process, guaranteeing maximum optimisation in the synthesis of hcnA for HCN(g) production.
Fig. 4a Relative quantification (2-ΔΔCt) of hcnA gene. Fold change compared to the calibrator (sample A5M medium)
Fig. 4b Relative expression radio of hcnA gene with different flows. Fold change compared to the calibrator (sample A5M medium)
Importance of the pressure in the HCN(ac) in the absorption column of step 1
The gas transfer systems for liquid phases, such as absorption columns, showed a relationship between the bubble size and efficiency for recovery [26]. The air pressure in the CSTR, affects the bubble size in the extraction column, and consequently the concentration of HCN(ac) in the step 1. On days 17 and 33,
the pressure was decreased between 120 and 50 hPa, generating bigger bubble sizes, which lead to a reduction of HCN(ac) contraction, lowering the levels from 27.7 g/m3 to 18.9 g/m3 and from 40.23 g/m3 to
31.24 g/m3 respectively (Fig. 5). On days 12 and 21, the pressure was increased between 200 and 220 hPa. This generated a smaller bubble size than the one usually found. The values of HCN(ac) on these days
increased from 3.91 g/m3 to 19.3 g/m3 and, from 53.21 g/m3 to 67.11 g/m3 respectively. This pressure, of
over 200 hPa, damaged the CSTR valves. A pressure above 150 hPa generates an appropriate size of bubbles in a nozzle measuring 0.8mm – 0.45mm. At the end of 45 days of standardization of the absorption column, in the step 1, it was possible to generate a production of 94.1 g/m3 de HCN
(ac) every 3
days. Similar researches such as Jinki Jeong and collaborators showed that C. violaceum generated a concentration of HCNac between 54 and 68 g/m3 on the growth medium [21], considerably lower than the
ones found in this study. These types of systems, implemented in step 1, had shown to be the most effective for obtaining higher concentrations of HCN(ac) [27].
0 1 2 3 4 5 6 7 8
A5M A5MN A5MF A5MFN
R
Q
R
e
la
ti
v
e
q
u
a
n
ti
fi
c
a
ti
o
n
2 4 8 16
0.22 0.27 0.31
R
e
la
ti
v
e
Ex
p
re
s
s
io
n
R
a
d
io
[l
o
g
2
]
Flow Rate [cm3/s] A5MN
A5MF A5MFN
Fig. 5 Relation between the pressure inside the CSTR with bubble size and concentration of HCN in the absorption column (the step 1)
Leaching of Au and Cu from the printed circuit boards (PCBs) - step 2
The leaching profiles for gold and copper in the leaching step are shown in Fig. 6. The data shown correspond to leaching efficiency. In the first 48 hours, gold leaching was prevalent, with an efficiency of 5.29% recovery. For copper, the efficiency was 0.266%. Between days 2 and 4, gold recovery efficiency decreased by 4.5%, while copper increased by 1.13% with respect to the first 48 hours. The addition of H2O2 to the system on the fourth day, again, raised the amount of gold leachates from 6.04% to 14.91% in
two days, but this leads to a decrease of the amount of copper leachates from 1.62% to 1.37%. After the sixth day, gold recovery efficiency decreased by 8.4%, while the copper increased by 0.4% with respect to the two previous days, possibly due to the consumption of DO in the leaching reaction. This relationship between H2O2 and increased gold leaching efficiency against copper leaching could be
related to the complexity in the composition of metals in the PCBs such as lead and thallium. According to Deschênes in 1997, lead in leaching processes increases gold recovery in samples with a high cooper content [28]. Likewise, according to Guzman in 1999, the addition of H2O2, in the presence of thallium,
can triple gold leaching at pH 11.5. A pH over 10.5 stimulates the stability of Au(CN)−
2, while
Cu(CN)−2 is more stable at pH 9, this is shown in the Eh –pH diagram [13]. At this stage of the system,
the absence of the bacteria is possibly due to the contaminated waste generated after leaching. All these factors showed that the HCN generated by C. violaceum in CSTR and recovered in the absorption column of step 1 at pH 12.5, was more efficient in leaching for gold in PCBs than it was for copper, even though there was more copper.
Degradation of HCN by C. violaceum in Step 3
C. violaceum was able to degrade 97.2% of total HCN during the first 60 hours, decreasing it from a concentration of 12.2 g/m3 to 0.34 g/m3 (Fig. 7). During the 5 days of the experiment, the cellular density
remained constant between 5,2x108 CFU/cm3 and 3.6x108 CFU/cm3. A control without HCN in the media
showed a decrease of the population from 4.4x108 CFU/cm3 a 6.5x106 CFU/cm3 in the same amount of
time. These results suggest that C. violaceum uses HCN as a substrate for its growth. The degradation of HCN inside the batch reactor in step 3 showed that a performance with work cycles of 4 days can remove the 99,8% of cyanide, obtaining a final concentration of 0.021 g/m3 of HCN. The concentration of HCN
recovered in the absorption column, for 4 days is 0,012 g/m3, showing that the HCN is not being
transferred to the medium as gas. The biomass generated in the CSTR for the degradation of cyanide used in the leaching process, has the advantage of not using other chemical compounds, such as hydrogen peroxide, for destruction. This has the advantage of reducing costs and avoiding the use of chemical products. The breakdown of this compound by the system is a responsible option to adequately treat the environmental liabilities that are generated from these types of technologies and one that responds to one of the concerns exposed by Friedhelm Korte and collaborators [26].
-15 5 25 45 65 85 105
0 50 100 150 200 250
0 5 10 15 20 25 30 35 40 45 cyan
id
e c
on
ce
n
tr
ati
on
[g/
m
3]
P
re
ss
u
re
[h
P
a]
Time [days]
Fig. 6 Leaching efficiency of gold and copper with 54g/m3 de HCN(ac) and 15mg/cm3 of pulp.
Fig. 7 Degradation of HCN by C.violaceum
Conclusions
This study demonstrated the feasibility of the implementation of a leaching process at an industrial scale, able to produce HCN for the leaching of gold and copper found in PCBs and to degrade it using C. violaceum as a model microorganism. Due to this process, it was possible to reach a production of 94.1 g/m3 of HCN over 3 days. The A5MFN medium was a good candidate as a substrate for the production of
HCN at an industrial scale. The results show that the addition of Iron (III) chloride had an effect on the expression of hcnA, while adding potassium nitrate improved the increase in biomass. The maximum efficiency of hcnA expression in A5MFN is obtained by a flow of 0.27 cm3/s, guaranteeing the best
production of HCN in the CSTR.
The addition of H2O2 every 4 hours to the leaching medium and a pH of 12.5 potentiated a higher
recovery rate of gold over copper (1.9 g/m3 y 574.3 g/m3 respectively). This difference is of great
importance in terms of the process’ economic viability owed to the high price of gold against copper on the global market [22]. One of the greatest advantages of using C. violaceum in these kinds of processes is that as well as the microorganism’s ability to synthesize HCN, it also has the genetic machinery to metabolize it. The third step of this process proved to be able to reduce the HCN concentrations in 4 days, from 12.8 g/m3 a 0.021 g/m3. The reuse of the waste generated in step 1 in step 3 avoids overruns to
eliminate HCN. The degradation of the remaining HCN from the leaching process responds to the formulation of new environmentally responsible technologies.
Acknowledgements
We are indebted to Manuel Rodríguez Susa for his help in technical concepts of the processes and provide the equipment necessary for some of the experiments. We also thank Natalia Otero, Javier E. Medina and Juan S. Chirivi for their support in engineering topics.
This work was performed with funds provided by the Microbiological Research Center – CIMIC and the Research Committee of the Science Faculty at Universidad de los Andes, Colombia.
Bibliography
1. Huisman J, Magalini F, Kuehr R, et al. (2007) 2008 Review of Directive 2002/96 on Waste Electrical and Electronic Equipment (WEEE) - Final report.
2. Ilyas S, Lee J (2014) Biometallurgical Recovery of Metals from Waste Electrical and Electronic Equipment: a Review. ChemBioEng Rev 1:148–169. doi: 10.1002/cben.201400001
0 0.5 1 1.5 2 2.5 0 2 4 6 8 10 12 14 16 18
0 2 4 6 8
c o p p e r le a c h in g e ffi c ie n c y (% ) g o ld l e a c h in g e ffi c ie n c y (% ) Time [d] Au Cu 0 2 4 6 8 10 12
0 1 2 3 4 5
c y a n id e c o n c e n tr a ti o n [g /m 3] Time [d] Schott Batch Reactor Batch Reactor
3. Blumer C, Haas D (2000) Mechanism, regulation, and ecological role of bacterial cyanide biosynthesis. Arch Microbiol 173:170–177. doi: 10.1007/s002039900127
4. Haas D, Blumer C (2000) Iron regulation of the hcnABC genes encoding hydrogen cyanide synthase depends on the anaerobic regulator ANR rather than on the global activator GacA in Pseudomonas fluorescens CHA0. Microbiology 146:2417–2424. doi: 10.1099/00221287-146-10-2417
5. Laville J, Blumer C, Von Schroetter C, et al. (1998) Characterization of the hcnABC gene cluster encoding hydrogen cyanide synthase and anaerobic regulation by ANR in the strictly aerobic biocontrol agent Pseudomonas fluorescens CHA0. J Bacteriol 180:3187–96.
6. Castric PA (1983) Hydrogen cyanide production by Pseudomonas aeruginosa at reduced oxygen levels. Can J Microbiol 29:1344–1349. doi: 10.1139/m83-209
7. Natarajan G, Ting YP (2015) Gold biorecovery from e-waste: An improved strategy through spent medium leaching with pH modification. Chemosphere 136:232–238. doi:
10.1016/j.chemosphere.2015.05.046
8. Kita Y, Nishikawa H, Takemoto T (2006) Effects of cyanide and dissolved oxygen concentration on biological Au recovery. J Biotechnol 124:545–551. doi: 10.1016/j.jbiotec.2006.01.038
9. Knowles CJ, Bunch AW (1986) Microbial Cyanide Metabolism. In: Adv. Microb. Physiol. Academic Press is an imprint of Elsevier, pp 73–111
10. Campbell SC, Olson GJ, Clark TR, McFeters G (2001) Biogenic production of cyanide and its application to gold recovery. J Ind Microbiol Biotechnol 26:134–139. doi:
10.1038/sj.jim.7000104
11. Raphulu MC, Scurrell MS (2015) Cyanide leaching of gold catalysts. Catal Commun 67:87–89. doi: 10.1016/j.catcom.2015.04.011
12. Eksteen JJ, Oraby E (2015) The leaching and adsorption of gold using low concentration amino acids and hydrogen peroxide: Effect of catalytic ions, sulphide minerals and amino acid type. Miner Eng 70:36–42. doi: 10.1016/j.mineng.2014.08.020
13. Guzman L, Segarra M, Chimenos J, et al. (1999) Gold cyanidation using hydrogen peroxide. Hydrometallurgy 52:21–35. doi: 10.1016/S0304-386X(99)00006-7
14. Rodgers PB, Knowles CJ (1978) Cyanide Production and Degradation During Growth of Chromobacterium violaceum. J Gen Microbiol 108:261–267. doi: 10.1099/00221287-108-2-261
15. Brysk MM, Corpe WA, Hankes L V (1969) Beta-cyanoalanine formation by Chromobacterium violaceum. J Bacteriol 97:322–7.
16. Tran CD, Lee J-C, Pandey BD, et al. (2011) Bacterial Cyanide Generation in the Presence of Metal Ions (Na+, Mg2+, Fe2+, Pb2+) and Gold Bioleaching from Waste PCBs. J Chem Eng JAPAN 44:692–700. doi: 10.1252/jcej.10we232
17. Brandl H, Lehmann S, Faramarzi MA, Martinelli D (2008) Biomobilization of silver, gold, and platinum from solid waste materials by HCN-forming microorganisms. Hydrometallurgy 94:14– 17. doi: 10.1016/j.hydromet.2008.05.016
18. Shaw DR, Dussan J (2015) Mathematical Modelling of Toxic Metal Uptake and Efflux Pump in Metal-Resistant Bacterium Bacillus cereus Isolated From Heavy Crude Oil. Water, Air, Soil Pollut 226:112. doi: 10.1007/s11270-015-2385-7
19. Faramarzi MA, Stagars M, Pensini E, et al. (2004) Metal solubilization from metal-containing solid materials by cyanogenic Chromobacterium violaceum. J Biotechnol 113:321–326. doi: 10.1016/j.jbiotec.2004.03.031
20. Fleming CA (2005) Cyanide recovery. In: Dev. Miner. Process. pp 703–727
21. Reiter L, Kolstø A-B, Piehler AP (2011) Reference genes for quantitative, reverse-transcription PCR in Bacillus cereus group strains throughout the bacterial life cycle. J Microbiol Methods 86:210–217. doi: 10.1016/j.mimet.2011.05.006
22. La Duc MT, Satomi M, Agata N, Venkateswaran K (2004) gyrB as a phylogenetic discriminator for members of the Bacillus anthracis–cereus–thuringiensis group. J Microbiol Methods 56:383– 394. doi: 10.1016/j.mimet.2003.11.004
23. Liang G, Mo Y, Zhou Q (2010) Novel strategies of bioleaching metals from printed circuit boards (PCBs) in mixed cultivation of two acidophiles. Enzyme Microb Technol 47:322–326. doi: 10.1016/j.enzmictec.2010.08.002
24. Chi TD, Lee J, Pandey BD, et al. (2011) Bioleaching of gold and copper from waste mobile phone PCBs by using a cyanogenic bacterium. Miner Eng 24:1219–1222. doi:
10.1016/j.mineng.2011.05.009
25. Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST(C)) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30:36e–36. doi: 10.1093/nar/30.9.e36
26. Leonard C, Ferrasse J-H, Boutin O, et al. (2015) Bubble column reactors for high pressures and high temperatures operation. Chem Eng Res Des 100:391–421. doi: 10.1016/j.cherd.2015.05.013
27. Giraldo IA, Dussán J (2015) Efecto del oxigeno, el pH y el FeIII en la síntesis de cianuro para procesos hidrometalúrgicos por. Rev. Ing. Univ. los Andes. ID 875
28. Deschênes G, Prud’homme PJH (1997) Cyanidation of a copper-gold ore. Int J Miner Process 50:127–141. doi: 10.1016/S0301-7516(97)00008-2
