Effect of bacteriophage V1P2 and of a phage cocktail on Vibrio harveyi CV1 in evolutionary and coevolutionary interactions

Texto completo

(1)Effect of bacteriophage V1P2 and of a phage cocktail on Vibrio harveyi CV1 in evolutionary and coevolutionary interactions Barbosa, Camilo & Vives, Martha J. Abstract Infections caused by luminescent Vibrio harveyi CV1 in shrimp hatcheries represent significant losses in this food production sector. As the use of antibiotics is restricted given the rapid emergence of resistance and the presence of residuals in shrimp tissues, new alternatives are needed to control the presence of pathogens. Phage therapy has grown as a viable alternative; the great abundance and diversity of phages, as well as their infectious lytic process, supports their therapeutic use in both clinical and industrial scenarios. Still, the natural interaction between the phage and its host allows the system to evolve, where the eventual emergence of bacterial resistance against the phage might take place. Since this is undesirable in contexts where phages are used as control agents, the main objective of this study was to evaluate the dynamic interactions of Vibrio harveyi CV1 and its lytic phage V1P2 in coevolutionary and evolutionary conditions. Moreover, evaluation of a phage cocktail composed of V1P1, V1P2 and V1G under the same conditions was considered, given that the use of more than one phage is a common strategy in phage therapy to avoid or delay bacterial resistance. Finally, molecular markers such as the outer membrane protein OmpK and CRISPR structures were followed in order to evaluate its variation throughout coevolutionary and evolutionary change. Coevolutionary and evolutionary interactions showed an increased and accelerated bacterial resistance driven by strong directional selection, where bacterial resistance was mostly favored and maintained. Treatment with the phage cocktail, compared to the treatment using solely phage V1P2, revealed that bacterial resistance is significantly reduced and no coevolutionary change is observed. From the OmpK gene analysis it was observed that most isolates from coevolutionary and evolutionary conditions diverged significantly from the ancestral bacterium (Vibrio harveyi CV1), but show no direct relation to the observed resistance patterns. On the other hand, we were unable to evidence the presence of CRISPR structures that could account the rapid emergence of resistance observed when using bacteriophage V1P2. The data mainly suggest that a coevolutionary arms race takes place with strong directional selection favoring rapid bacterial host resistance; it is noteworthy that the use of phage cocktails represents an important strategy in phage therapy since it reduces the emergence of resistance and sustains it for a prolonged period of time. Introduction Aquaculture in marine environments comprises one of the fastest growing food production sectors worldwide, involving all forms of animals and plants [1-3]. However, since the marine environment supports a significant amount of microbial diversity, aquatic pathogens can produce bacterial infection that ultimately threatens survival rates of marine animals and therefore food production [3, 4]. One of the most common infections in aquaculture is caused by luminescent vibrios (i.e. Vibrio harveyi, Vibrio campbelli and Vibrio parahemolyticus) on shrimp hatcheries (Penaeus monodon), especially during larval stages where a significant increase in mortality takes place [2, 5, 6]. Different control mechanisms are routinely used in order to prevent bacterial infections, being the use of complex filtering systems the most common practice. Still, despite filter. . 1 .

(2) usage the appearance of different pathogens is custom [6, 7]. The prophylactic use of antibiotics (AB) is also common, but several concerns arise from this practice [2, 5, 6, 8]. For instance, while laboratory trials have demonstrated the effectiveness of AB, field studies show rather low promising results [5, 6]; there’s a significant amount of evidence regarding the emergence of resistance, and the presence of AB residuals on shrimp tissue, which will eventually remain in human consumers and facilitate AB resistance among opportunistic pathogens [2, 3, 5, 6, 8-10]. Ultimately, these considerations have resulted in the ban of AB use from food producing sectors like shrimp production, generating the need for developing new alternatives to control bacterial pathogens in hatchery systems [2, 3, 10]. Over the last years, the use of bacteriophages (phages), viruses that specifically infect bacteria, has grown as an alternative for the control of bacterial infections in industrial and clinical contexts [10-15]. Phages represent one of the most abundant and diverse biological entities in the marine environment, acting as the most active predator of bacteria, therefore controlling bacterial populations in this environment [10, 16-20]. In this context, the natural interaction between a phage and its host is typically initiated by binding to the host’s surface, with the subsequent injection of its genetic material to the hosts cell interior. As it uses host’s cellular machinery to replicate its genetic material and synthetize structural proteins, it produces numerous phage progeny that is lately released through cell lysis [10, 19, 20]. Since this is a highly specific and self-replicative process, a high viral concentration could be obtained; therefore the efficient control of particular bacterial populations could be exploited [10, 21]. An important characteristic of this interaction is the dynamic process of infection that allows the system to rapidly evolve, allowing both to co-exist [16, 19, 20, 22]. The dynamics of co-existence between bacterial populations and their respective phages has been described as a model of antagonistic coevolution [23-27], in which a constant evolutionary arms race takes place with bacteria using a diverse array of resistance mechanisms and phages counteracting them [20, 28]. In this co-evolutionary system, a susceptible bacterium generates or activates a resistance mechanism that allows it to grow in spite of the pressure exerted by the phage [25, 28]. As this resistant population develops and dominates its environment, the susceptible population diminishes; meanwhile phages overcome the resistance barrier, mostly by point mutations or nitrogenous base modification that allows them to infect the resistant and abundant population [19, 20, 25, 26, 28]. Direct evidence of coevolution is scarce given difficulties such as the time-scale of coevolutionary change, the measurement of interactions across time and lack of control over the environment and genetics [20, 26, 27, 29]. The use of laboratory populations of bacteria addresses these problems since they can be carefully propagated in replicated environments, where any change in host resistance or parasite infectivity can be ascribed to mutation and selection, with the subsequent reciprocal selection between the interacting populations, and not to other environmental variation [20, 25, 27, 29, 30]. Additionally, long-term storage facilitates the measurement of interactions across time and space [13, 27, 30, 31]. The genetic basis that drive molecular evolution and generation of defense mechanisms in both bacteria and phage, greatly influence the dynamics and level of coevolutionary change [13, 14, 26, 32, 33]. For instance, bacteria have shown to readily evolve resistance through a large array of defense mechanisms such as cell structure modification or the. . 2 .

(3) innate mechanism orchestrated by the CRISPR/Cas (Clustered Regulated Interspaced Short Palindromic Repeats) loci [34-36]. For example, among vibrios outer membrane proteins (OMPs), OmpK has been reported as a common broad-host phage receptor in Vibrio harveyi [22, 37, 38]. Even though its function is not fully understood; it has been shown that it plays an important role in responses to different environmental stresses [39, 40]. The implication of OmpK in both contexts makes it a good molecular marker to evaluate particular variations in the host that could confer resistance or variations in specificity [37, 40]. On the other hand, the CRISPR loci acts as a heritable mechanism that incorporates sequences derived from foreign genetic elements, such as phages or plasmids, that further develop into a small RNA repertoire that will subsequently program an enzymatic complex to specifically recognize and destroy the invader from which the sequence was incorporated [34, 35, 41-43]. The emergence of resistance, as a result of the coevolutionary arms race, is undesirable in both clinical and industrial scenarios such as shrimp hatcheries where phage therapy can be a viable alternative [3, 11, 44, 45]. Thus, considering the use of phages as an alternative to control the presence of pathogens in shrimp hatcheries, evaluation of coevolution dynamics of phage and their host is important in order to establish more suitable strategies, such as the use of phage cocktails or optimization and timing of viral doses [46-49]. This could allow to efficiently control both the emergence of pathogens and phage resistance. Therefore the aim of this study was to evaluate the dynamics of hostparasite interactions, under evolutionary and coevolutionary conditions, of the lythic phage V1P2 on Vibrio harveyi (CV1), as well as the effect over this interaction when a phage cocktail composed of V1P1, V1P2 and V1G is used. Additionally, molecular variation of the OmpK gene was evaluated for isolates from evolutionary and coevolutionary interactions. Materials and Methods Microorganisms Vibrio harveyi (CV1) was isolated from infected shrimp larvae by Ceniacua in Cartagena, Colombia. Vibrio bacteriophages V1P1, V1P2 and V1G were isolated from shrimp hatcheries sediments at the CIMIC, Universidad de los Andes (Bogota, Colombia). CV1 was stored at -80°C with 10% Glycerol. Similarly, high titer bacteriophage stocks were stored at 4°C in SM Buffer until used. Bacterial populations were activated in Luria Bertani (LB) broth and statically incubated at 30°C for 18-20 hours. Coevolutionary conditions To ensure the persistence of coexistence of bacteria and phages, and to evaluate coevolutionary change, six replicate microcosms (25 mL glass universals containing 6 mL of Luria Bertani (LB) broth) were inoculated with 106 cells of CV1 and 107 viral particles of V1P2, and statically incubated at 30°C for 24 days. A fixed portion of each culture was propagated into fresh broth at regular intervals, hereby termed as transfers. Each transfer consists of a sixty microliters inoculum transferred to fresh broth every 2 days, for a total of 12 transfers. A sample of each transfer was processed in order to separate bacterial cultures by serial dilutions in LB plates, and isolating 5 colonies per replicate; each bacterial colony isolated in the dilution process will be considered as a distinct bacterial population as in Buckling & Rainey 2002 [20]. In order to obtain phages, centrifugation with 0,1 vol. chloroform and 0.22µm filtering was performed; similarly, phages isolated at each transfer will be considered as distinct phage populations as in Buckling & Rainey 2002. . 3 .

(4) [20]. Bacterial and phage populations were stored at -80°C and 4°C respectively until the end of the 12 transfers. In order to evaluate the effect of a phage cocktail composed of V1P1, V1P2 and V1G, the same procedure was carried out. In this case, propagation was carried out until the sixth transfer, with to particular purposes: First, to evaluate if a phage cocktail could disrupt any particular pattern in resistance during the co-evolutionary process, and; second, to observe if during the developmental period of shrimp larvae (12 days) a phage cocktail is effective in the control of bacterial infection [1, 7]. Evolutionary control An evolutionary control is needed in which the host population is held constant, and only the phage will be allowed to evolve, in order to control the confounding effect of time on the changes driven by coevolutionary change that could be acquired trough drift or general adaptation to experimental media [26]. To achieve these conditions, the same general procedure was carried out as previously explained; but in this case, propagation involved the initial separation of the phage population by centrifugation and filtering (0,22 µ), followed by a 60µL transfer of this population into fresh broth; in order to maintain the bacterial population constant, an overnight culture (ON) of the parental was also inoculated into fresh broth at every transfer, where the phage population was already transferred. The same procedure was carried out to evaluate the phage cocktail previously mentioned, but in this case propagation was carried out until the sixth transfer as previously explained. Measuring bacterial resistance For every replicate at each transfer, 5 bacterial populations and one phage population were isolated (a total of 30 bacterial and 6 phage populations per transfer were obtained for the co-evolutionary model and the evolution control for treatments with the phage cocktail and with V1P2 only). In order to evaluate the resistance of the bacterial populations at every transfer, a spot plaque assay was performed. Briefly, an overlay of LB soft agar containing 100 µL of the bacterial population was added into a LB plate; subsequently, after solidification, 3 µL of the phage populations were added superficially over the soft agar layer in order to form a spot and evaluate the formation of plaques or bacterial growth. At every assay, the phage populations obtained from all 12 transfers (6 for the phage cocktail treatment) were spotted. The ancestral phage V1P2 was also spotted in order to evaluate susceptibility to coevolved and evolved phages. Similarly, when the phage cocktail was used as a treatment, ancestral phages V1P1, V1P2 and V1G were spotted. Plates were incubated at 30°C for 18 hours, after which every plate was tested for the presence or absence of phage plaques; presence indicated bacterial susceptibility, whereby absence indicates resistance. In order to measure bacterial resistance, for every replicate the mean proportion of resistance was determined as the number of resistant bacterial populations over the total number of bacteria at each transfer. Particular attention was given for resistance against phage populations from two previous transfers (Past phages), phages of the same transfer (Contemporary phages) and phages from two transfers ahead in time (Future phages).. . 4 .

(5) OmpK amplification, sequencing and analysis OmpK gene of Vibrio harveyi, along with 4 bacterial populations that corresponded to transfers 1, 3, 7 and 10 of both evolving and coevolving interactions where only the phage V1P2 was used, were amplified using primers previously reported to amplify a complete ompK ORF of 730-820 bp in different Vibrio species (ompK-F CATATGCGTAAATCACTTTTA and ompK-R CTCGAGGAACTTGTAAGTTAC) [40]. Briefly, the amplification conditions were: 5 min at 94°C; 32 cycles of 60 s at 94°C, 40 s at 55°C and 60 s at 72°C; and a final extension at 72°C for 10 min. PCR products were purified and sequenced at MACROGEN Inc. (#60-24, Gasan-dong Geumchen-gu Seoul, Korea). Phylogenetic analysis of the translated protein sequence included a maximum likelihood tree with bootstrap iteration (1000) constructed in the CIPRES Gateway platform (http://www.phylo.org/portal2/), using as outgroup the OmpK sequence of Vibrio parahemolyticus (Accession Number: ADM88043). CRISPR/Cas approach The complex architecture of the CRISPR/Cas loci, lead us to design primers that annealed a consensus sequence of the CRISPR/Cas associated protein csy3 found in the proximity of a CRISPR structure of Vibrio harveyi ATCC BAA-1116 (Accession number: NC_009784) at the online CRISPR database (http://crispr.u-psud.fr/index.php) [50]. A single primer long pcr (SP-LPCR) was performed using both cas1 primers (cas1_F: TGTGTACCTTACGGAGCAGAGA, and cas1_R: AATTGGAGCGTTTGTTCCTAAA), in order to amplify from a known region to an unknown and obtain a longer sequence that, if present, could capture a CRISPR structure. Briefly the amplification conditions were: 3 min at 94°C; 10 cycles of 30 s at 94°C, 60 s at 43°C and 270 s at 72°C; 25 cycles of 30 s at 94°C, 60 s at 49°C and 270 s at 72°C; and a final extension at 72°C for 10 min. PCR products were purified and sequenced at Universidad de los Andes (Bogota, Colombia). Statistical analysis Co-evolutionary change suggests that, after several propagations, bacterial populations tend to be more resistant to phage populations they have already met [20, 25, 29, 51]. For instance, at a given transfer, contemporary and past phage populations should have less effect over the bacterial populations; given that coevolution is taking place, bacterial populations should be more capable to resist phages of previous transfers, or even contemporary phages, since it has become able to overcome the phage infectivity pressure [20, 25, 29, 51]. In contrast, when a given bacterial population is challenged against a phage population of transfers ahead in time, the level of resistance should be reduced since solely the phage population has evolved to increase infectivity [20, 25, 29, 51]. Given this, the mean proportion of resistance of past, contemporary and future phages at each transfer, were individually plotted where pairwise calculation of slopes between future and contemporary resistance and between contemporary and past resistance was performed. The slope at every transfer is an indicative of the level of coevolutionary change, and the tendency along transfers is an indicative of the level of directional selection; for example, if a single phenotype, such as bacterial resistance, is favored along time then directional selection is the mode with which natural selection causes genetic change to accumulate in that population [45, 52]. Different coevolutionary interactions can be interpreted as a result of slope evaluation [19, 23, 24]; for instance, if resistance to. . 5 .

(6) future phages is low with respect to contemporary and past phages, a negative slope should be observed indicating that coevolution is taking place. But, if a progressive augmentation of the resistance is observed from past to contemporary and to future phage populations, a positive slope should be seen instead; indicating that strong directional selection is acting during the coevolutionary interaction in a greater extent to favor bacterial resistance [19, 20, 23, 24]. A slope equal to 0 indicates that resistance or susceptibility is sustained through time. Bearing this in mind, and given the lack of independency among the data, a randomization test (n=18, m=100,000) for each transfer was performed using the R platform [53] considering as statistic the pairwise slope between the mean proportion of resistance of future and contemporary phage populations, and between contemporary and past phage populations at each transfer. The null hypothesis considered that the slope was “0”. Similarly, in order to evaluate differences between treatment with phage cocktail and solely with V1P2, in evolutionary and coevolutionary conditions, and in consideration of the lack of independency of the data of bacterial resistance to past, contemporary and future phage populations between transfers, a randomization test for each transfer was performed. As a statistic, the difference between the means of bacterial resistance, calculated as previously explained, for both treatments was considered. The null hypothesis contemplated that the difference was equal to “0”. Results Coevolutionary and evolutionary interactions with phage V1P2 In order to measure coevolutionary interactions in time, evaluation of resistance against past (phages from two previous transfers), contemporary (phages from the same transfer) and future (phages from two transfers ahead in time) phage populations was performed at each transfer. Following these interactions, evaluation of the slope pattern (either positive or negative, or with lack of tendency (Slope=0)) gives a direct evidence of coevolutionary change. Our data reflect no pattern in the slope (Slope=0) of mean bacterial resistance after the third transfer, when only phage V1P2 was used (Fig. 1a). The slope of the first three transfer’s indicate significant coevolutionary change (p<0.05) with maintenance of high bacterial resistance; after the first transfer, the pattern of transfers 2 and 3 display a progressive augmentation of bacterial resistance, particularly against contemporary phages (Fig. 1a and Fig. 2a). The lack of slope pattern after the fourth transfer (either negative or positive), along with the patterns of previous transfers indicates that strong directional selection is taking place, favoring in great extent bacterial populations, since it was maintained at high proportions (>80%). Additionally, resistance to ancestral phage V1P2 increased after the fourth transfer and was maintained at high levels (>75%) until the end of the experiment (Fig. 2a). During the experimental procedure, transfers 8 and 12 were lost due to different practical difficulties.. . 6 .

(7) Fig.1 a) Coevolutionary and b) Evolutionary change of CV1 with V1P2. At each transfer the mean bacterial resistance was evaluated against phage population from two previous transfers (P), contemporary transfers (C) and two transfers in the future (F). Coevolutionary change is observed by significant patterns in the slope formed between future and contemporary phage populations, and contemporary and past phage populations at each transfer. (*) Corresponds to a level of significance of p<0.05 for the lope pattern at each transfer.. Phage populations obtained from evolutionary interactions with phage V1P2 exhibit significant slope patterns (p<0.05) until the fifth transfer (Fig. 1b). Since the pattern in slopes elucidated at these transfers is positive, a progressive augmentation of bacterial resistance to evolving phages results from the effect of strong directional selection (Fig. 1b). After the sixth transfer, bacterial resistance is maintained (>80%), and no significant pattern in the slope of past, contemporary and future phages is observed (Fig. 1b and Fig. 2b). The accelerated increase in bacterial resistance observed (Fig. 1b), suggests that if solely the phage is allowed to evolve, molecular resistance is progressively enhanced among bacterial populations that temporarily coevolve (at least within the time of each transfer). Susceptibility to ancestral phage V1P2 is maintained through time (Fig. 2b), which allows considering that any change among bacterial populations that allows them to be resistant to evolving phages, do not confer resistance to ancestral (not evolved) phages.. . 7 .

(8) Fig. 2 Mean (± SE, n=6) bacterial resistance against phage population of two previous transfers (Violet), contemporary transfers (Orange) and two transfers in the future (Purple) phage during a) coevolutionary and b) evolutionary interactions. Additionally, the mean proportion of resistance against ancestral phage V1P2 (Green-blue) was evaluated for both conditions.. Coevolutionary and evolutionary change with phage cocktail Analysis of the cocktail data revealed important differences with treatments when only phage V1P2 is used (Fig. 3a and Fig. 3b). Two lines of evidence demonstrate that a phage cocktail diminishes the emergence of resistance of bacterial populations; first, in the coevolutionary interaction significant patterns (p<0.05) were observed in transfer 1, 3 and 5. Moreover, the negative slopes indicate that coevolution is taking place, and that in this case directional selection is substantially favoring the phage populations, since resistance to future phages is reduced with respect to contemporary phages (Fig. 3a). Additionally,. . 8 .

(9) when only the phage is allowed to evolve, no apparent pattern is observed throughout the transfers (Fig. 3b); except for the second one (p<0.05), in which mean resistance proportion is relatively increased (Fig. 1b and Fig. 3b). When the mean resistance of coevolutionary and evolutionary conditions in treatment with the phage cocktail is compared with the challenge with V1P2, clear difference is observed in most transfers (p<0.01); resistance to the phage cocktail is considerably reduced (Fig. 3a and 3b). Along experimentation, we were unable to isolate bacterial isolates from the sixth transfer.. Fig. 3 a) Coevolutionary and b) Evolutionary change of CV1 with a phage cocktail composed of V1P1, V1P2 and V1G. At each transfer the mean bacterial resistance was evaluated against phage population from two previous transfers (P), contemporary transfers (C) and two transfers in the future (F). Coevolutionary change is observed by significant patterns in the slope formed between future and contemporary phage populations, and contemporary and past phage populations at each transfer. (*) Corresponds to a level of significance of p<0.05 for the lope pattern at each transfer. (+) Indicates the significance level of the difference of mean resistance proportion between the phage cocktail treatment and the treatment with V1P2: p<0.05=(+), p<0.01=(++) and p<<0.001=(+++).. Throughout the transfers, resistance never reached more than 50% of the isolated bacterial populations when using the phage cocktail. Resistance to any of the ancestral phages in the cocktail, was also found to be reduced in comparison with the treatment that only considered V1P2 (Fig. 4a and 4b); in most of the transfers, for both evolutionary and coevolutionary interactions, resistance to ancestral phages and other temporary distinct phage populations never reached levels higher than 40-45%.. . 9 .

(10) Fig. 4 Mean (± SE, n=6) bacterial resistance against past (Purple), contemporary (Green-blue) and future (Orange) phage populations from the cocktail treatment obtained during a) coevolutionary and b) evolutionary interactions. Additionally, the mean proportion of resistance against ancestral phages V1P1 (Green), V1P2 (Yellow) and V1G (Violet) was evaluated for both conditions.. OmpK receptor and CRISPR Phylogenetic analysis of OmpK of 4 bacterial isolates from transfers 1, 3, 7 and 10 reflected an initial separation from the ancestral CV1 in coevolutionary (80 bootstrap value) and, more drastically, in evolutionary interactions (99 bootstrap value) (Fig. 5 and Fig. 6). Suggesting that coevolutionary and evolutionary conditions drive significant change from the ancestral bacterium Vibrio harveyi CV1. Despite it, subsequent bootstrap node values suggest that no particular separation is significant enough (>75 bootstrap. . 10 .

(11) values over 1000 iterations) to consider that a major change in this gene could account for the observed tendency of bacterial populations in both treatments.. Fig. 5 Maximum likelihood tree, with bootstrap values of 1000 iterations shown at each node, of the OmpK protein rooted to Vibrio parahemolyticus. Protein sequences of OmpK of ancestral Vibrio harveyi (CV1) and 4 isolated bacterial populations from coevolutionary interactions from transfers 1, 3, 7 and 10 were analyzed; each branch corresponds to one of the four bacterial isolates from transfers 1, 3, 7 and 10.. Table. 1 Amino acid modification of the OmpK protein of Vibrio parahemolyticus, ancestral CV1 and isolates of different transfers under coevolutionary conditions. Bacteria Vibrio parahemolyticus Ancestral CV1 Transfer 10 Transfer 10a Transfer 3 Transfer 3b Transfer 7 Transfer 7c Transfer 3d a. Position 1-25. 146-168. MRKSLLALSLLAATSAPVLAADYSD. ASEVNSQKIGLGSDVMVPWLGK. NGVDSTGFGHYIAVTYKF. 260-278. MRKSLLALSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDLNWAGHYVAVTYKF. MRKSLLTLSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVTYRF. MRKSLLSFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVTYKF. MRKSLLSFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVTYKF. MRKSLFSFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVIYKF. MRKSLLYFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVTYKF. MRKSLLYFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVTYKF. MRKSLFSFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVTYSF. !. Transfer 10 corresponding to the fifth branch on Fig. 5 Transfer 3 corresponding to the seventh branch on Fig. 5 c Transfer 7 corresponding to the ninth branch on Fig. 5 d Transfer 3 corresponding to the tenth branch on Fig. 5 b. OmpK translated sequences from coevolutionary isolates of the most distant transfers (Fig. 5, yellow clade), exhibit amino acid modifications that most commonly altered the hydrophobic activity of the protein (Table.1). Replacement of the hydrophobic amino acids alanine or leucine with serine or threonine accounted a change from hydrophobic to polar characteristics. The remaining sequences where nearly identical to the ancestral CV1 and completely identical among each other (Fig. 5, red clade); amino acid modification, if any,. . 11 .

(12) represented a change to an amino acid with similar characteristics, for instance an asparagine for a serine (Polar), or a leucine for an isoleucine (Hidrophobic).. Fig. 6 Maximum likelihood tree, with bootstrap values of 1000 iterations shown at each node, of the OmpK protein rooted to Vibrio parahemolyticus. Protein sequences of OmpK of ancestral Vibrio harveyi (CV1) and 4 isolated bacterial populations from evolutionary interactions from transfers 1, 3, 7 and 10 were analyzed; each branch corresponds to one of the four bacterial isolates from transfers 1, 3, 7 and 10.. Moreover, isolates from the evolutionary control (Table. 2) exhibit the loss of a hydrophobic amino acid (tryonine), particularly at the end of the analyzed sequences, with the rare incorporation of an isoleucine. As coevolutionary in the coevolutionary tree, isolates grouped under the red clade (Fig. 6) displayed identical sequences among each other and with respect to the ancestral CV1. Finally, it is interesting to notice that at least three times more isolates from coevolutionary conditions, significantly diverged from the ancestral CV1 when compared to isolates from evolutionary conditions. Table. 2 Amino acid modification of the OmpK protein of Vibrio parahemolyticus, ancestral CV1 and isolates of different transfers under evolutionary conditions. Bacteria Vibrio parahemolyticus Ancestral CV1 Transfer 1 Transfer 1a Transfer 7 Transfer 7b a. Position 1-25. 146-168. 260-278. MRKSLLALSLLAATSAPVLAADYSD. ASEVNSQKIGLGSDVMVPWLGK. NGVDSTGFGHYIAVTYKF. MRKSLLALSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDLNWAGHYVAVTYKF. MRKSLLALSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVT-KF. MRKSLLALSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVIT-KF. MQGEKISFSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVT-KF. MRKSLLALSLLAATSAPVMAADYSD. STTVNNQKIGLGSDVMVPWLGK. DGVDSTGFGHYVAVT-KF. !. Transfer 1 corresponding to the fifth branch on Fig. 6 b Transfer 3 corresponding to the seventh branch on Fig. 6. SP-LPCR gave as a result several bands with different molecular weights (300bp>) (Fig. 7). Nevertheless, the small sequenced fragments presented no significant hit to either CRISPR associated proteins of any type or to a typical CRISPR arrangement. Additionally,. . 12 .

(13) we were unable to complete the stepping primer design process since bigger fragments (>2000pb) were not suitable for sequencing or internal primer design.. Fig. 7 SL-PCR of cas1 where lanes 1-2 (PF) corresponds to the PCR products using the forward primer and lanes 3-4 (PR) to reaction with the reverse primer. A 10,000 bp (10000-300 bp) molecular weight ladder was used in lane 1 (MW).. Discussion Bacteriophages are ubiquitous in different natural environments, being the marine ecosystem one of the most supportive scenarios for phage diversity [16, 18, 22, 54, 55]. The high abundance and diversity, accompanied with an extraordinary infection capacity, makes of phages one of the most active bacterial predators in such locations. [18, 22]. The dynamics of co-existence between phages and bacteria have implications in community and population structure and composition, genetic exchange at population level and biogeochemical processes; therefore significant trade-offs between being successful at competing for resources and avoiding predation are constantly taking place among bacteria [13, 45]. There is both theoretical and experimental evidence that consider different factors that determine the process of phage-host interactions, which by means of a coevolutionary arms race ultimately result in coexistence of the predator and its prey [13, 45, 56]. Different microbial organisms have been used as models to evaluate both ecological and genetic factors that govern the process of coevolution. For instance, Escherichia coli B and different T-series phages have been evaluated in continuous resource limited cultures, where coevolution showed to be limited to second or third trophic levels of resistant bacterial populations as well as infective phage populations [13, 56, 57]. The main ecological factor evaluated was the equilibrium between the number of prey populations, primary resources and predator populations; other factors such as the effect of competition and productivity in this type of community composition were studied [13, 56, 57]. Recently, Buckling & Rainey (2002), were able to obtain significant evidence of timelagged coevolution in the model of the plant colonizing bacterium Pseudomonas fluorescens SBW25 and its lytic phage SBW25Φ2. Here, several cycles of resistant and susceptible host populations were obtained followed by different infectious and noninfectious phage populations [20]. The results of this and subsequent studies, clearly reflected the importance of antagonistic coevolution in natural process in terms of coexistence, population differentiation and molecular evolution [19, 20, 23-26, 31].. . 13 .

(14) Our study was based on the experimental procedure of Buckling & Rainey (2002) where coevolution occurred in spatially structured and static microcosms. Nonetheless, particular differences were considered; first, our model was composed of Vibrio harveyi CV1 and its lytic phage V1P2, given our particular interest on the therapeutic and prophylactic use of this phage in an industrial process. Second, we considered two additional factors that allowed us to comprehend more rigorously the dynamics of coevolution and the natural emergence of resistance: An evolutionary control where the host was held constant, and only the phage was allowed to evolve was used. Furthermore, the evaluation of a phage cocktail under both evolutionary and coevolutionary conditions allowed us to gain more evidence of its effectiveness and consider its suitability for therapeutic use. Our findings in the treatment with V1P2 are different from previous evaluations of coevolution in bacteria and bacteriophages in at least two key aspects: no time-lagged coevolution was observed in coevolutionary interactions, where high levels of bacterial resistance were strongly driven and supported by directional selection. These results suggest that once resistance has emerged, phage V1P2 is unable to overcome the defense barrier, or at least not in a near future; in industrial scenarios one feature that advocates the usage of bacteriophages is that it represents a naturally evolving system, therefore rapid evolution of a counter-defense would be most desirable [3, 6, 11, 14, 46]. Previous reports show that directional selection progressively favors bacterial resistance, but our data clearly shows that the acquisition of resistance is rapidly gained and limits the amount of trophic levels with resistant bacterial populations and infectious phages; possibly due to strong directional selection that results in bacterial resistance that phage is not able to overcome, therefore limiting coevolution to a single trophic level. Among experiments where the host is not allowed to evolve, the most common observation is a reduction of host-fitness and an increment of parasite aggressiveness or infectivity [25, 57]. Most of these observations were evaluated on transfers of a parasite on different hosts, followed by the evaluation of differences in infectivity on the ancestral parasite; in our case, the transfers were done over the same host. Results of this study indicate that there is a progressive increase of bacterial resistance against contemporary and future transfers, probably due to an enhanced response to the growing aggressiveness of evolving phage populations. Upon the sixth transfer, no differences were observed on resistance against temporary distinct phage populations, which corroborates previous observations where once resistance is gained, the phage struggles to overcome the resistance and augment its infectiveness. It’s interesting to notice that susceptibility to the ancestral phage is maintained during evolutionary conditions, which indicates that, the resistance mechanisms that allows bacteria to resist the pressure of the evolving phage populations does not confer resistance to previous hosts. This could be explained upon the different molecular mechanisms a bacteria disposes; the evolutionary response, in terms of molecular machinery activation, when both are allowed to evolve could be different when the phage is evolving into a more aggressive form [45]. It is clear from our results, and from previous studies, that the dynamics of coevolution might be strictly dependent on the system being considered (i.e. Escherichia coli B and its T-series phages, Pseudomonas fluorescens SBW and its lytic phage SBW25Φ2 and, in our case, Vibrio harveyi and its lytic phage V1P2). This results very interesting in terms of the applicability in different industrial or medical scenarios; the specificity of the system allows to create strategies suited for particular pathogens in order to avoid a rapid emergence of resistance, or to boost the phage counter-defense response.. . 14 .

(15) In consideration of this, the evaluation of a phage cocktail is noteworthy since it has been used in different industrial contexts as a strategy to enhance the effectiveness of phages as biocontrol agents [21, 47-49]. Different studies have evaluated the effectiveness of phage cocktails in laboratory conditions and as a general result, the use of the cocktail reduces in a greater extent bacterial titers in comparison to treatments with one phage only [21, 47-49, 58]. This study is the first one, to our knowledge, to consider the effect of a phage cocktail in evolutionary and coevolutionary conditions. The results obtained, clearly demonstrate that a phage cocktail alters the coevolutionary process of the interaction; overall, susceptibility to contemporary and future transfers is greater than to past phage populations in the coevolutionary interaction, while in evolutionary conditions no difference was generally observed for temporary distinct phage populations. Additionally, the mean proportion of resistance in the phage cocktail treatment is dramatically reduced when compared to treatment with V1P2, which is in agreement with previous observations [21, 47-49, 58]; in this case resistance never reached 50% of the isolated populations. This condition was observed in both evolutionary and coevolutionary interactions, suggesting that upon interaction with different phages, the development of resistance is not sufficient to overcome the pressure exerted by the three phages. This result is most significant in shrimp hatcheries since larvae development represents the most susceptible point of the process to bacterial infection [1, 5, 9]; a phage cocktail is capable to reduce and delay the emergence of resistance during this time (5 transfers), therefore supporting the use of it as an strategy to control disease in industrial processes. It is important to consider that there are several ways in which multiple phages can interact within each other during an infectious process. Initially, they can simply compete for host resources (receptors), which could result in inhibition or with a decrease of each other’s fitness [33, 36, 45]. But sometimes, infection with one phage might enhance susceptibility to a second or third phage, facilitating the infectious process [33, 36, 45]. Since low bacterial resistance proportion was observed in our treatment with the phage cocktail, a process of facilitation might have taken place during evolutionary and coevolutionary interactions. The marine environment is a dynamic scenario where multiple variables act along several natural processes and interactions [54, 59]. For instance, phage abundance is subjected to the synchronization of bacterial mortality, viral production and decay; UV irradiation is the most common factor affecting phage decay [22, 38]. Even though hatchery systems are controlled environments, these factors are determinant when bacterial infection presents and bacteriophages are used as control agents; hatchery systems are open spaces that present a great exposure to UV irradiation. Additionally, salted water is constantly cycled, therefore altering both phage and bacterial numbers [2, 3, 6, 7]. These variables play important roles when phage therapy is considered as a biocontrol strategy; despite the fact that there is no knowledge on how this variables could affect the use of bacteriophages in hatchery systems, there is important evidence that support their use [2, 3, 6]: Survival rates are mainly increased when phages are present. Consequently, knowledge of the coevolutionary process that the phage-bacteria interaction undertake, along with consideration of other variables (UV irradiation or water cycling), might elucidate the dynamics of bacterial resistance and phage infectivity in hatchery systems. Different molecular mechanisms could account for the observed data. Most of the resistance mechanisms consider the mutation or lost of the receptor that initiate the lytic process of the phage [13, 36, 45]. Trough these, bacteriophages are not allowed to adhere the bacterial surface and “walk” over it until an insertion point is reached. Commonly, these. . 15 .

(16) variations in the surface represent a fitness cost that might result in reduced metabolic activity [25, 36, 60]. In the case of the phage cocktail treatment, it is less likely to modify three different receptors with low metabolic costs than to modify just one; therefore the cost of resistance is higher than the cost of remaining at low titers to avoid predation in a static microcosm, where a spatial refuge could be established [20, 23, 24]. It is interesting from our data, that even though there is no evidence that could correlate the direct participation of the OmpK as a phage receptor, significant modifications are undertaken by this protein during coevolutionary and evolutionary conditions. The role of this protein is not clear, but recent studies show that it is important in osmotic regulation [37, 39]; as was shown by our data, which presented amino acid modifications that could alter the proteins response to osmotic changes (Hydrophobic amino acids where replaced for polar amino acids). It is important to consider that there are other Omp proteins that might serve similar functions, thus allowing us to speculate that the accumulation of mutations alter each protein function, possibly in an orchestrated mater when osmotic pressure is present. Still, more evidence on the implication of this protein in the interaction of phage-bacteria is needed, as well as more insights on OmpK function. Even though functional analysis that demonstrate that the variations on the OmpK protein are significant enough to alter their function, it is most interesting to notice that the great variability on this protein could account for an accelerated molecular evolution under coevolutionary interactions. Recent studies, suggest that coevolutionary interactions accelerate molecular evolution of both the phage and the host, when compared to evolutionary conditions [13, 26, 31]. Another common mechanisms among vibrios, is the well-known restriction modification system (RM) [22, 38]. In vibrios, RM mechanisms are common among different species, which is notable since they are usually species or strain specific [22, 38, 61]. These molecular mechanisms could explain the rapid emergence of resistance in our model, but more evidence of what kind of receptor and description of the restriction modification machinery present in Vibrio harveyi CV1 is needed. Despite the fact that we were unable to determine the presence of a CRISPR structure, we consider that this mechanism could account most precisely for the behavior of Vibrio harveyi CV1 in evolutionary and coevolutionary conditions; since evidence presumably suggest that an innate mechanism of defense is present. The rapid acquisition of resistance and the maintenance of it throughout time let us consider that such mechanism could be present. Over the past years, an increasing understanding of the CRISPR/Cas maturation and effector process has developed [43, 62-64]. It is worth mentioning that recent observations suggest that the fragment that is incorporated it is not randomly taken; most presumably, a directed selection takes place [60-62]. If acquisition of a fragment that is less prompt to mutation takes place, the innate mechanism would be most effective and lasting; this could be reflected from our data, but stronger efforts are needed in order to determine the presence of CRISPR structures. Woolhouse et al. (2002) differentiates the molecular mechanisms that drive coevolution [45]. Selective sweeps occur when new alleles appear as a result of mutation and fixate into the population; directional selection acts on both populations, meaning that at any given point polymorphisms might be in either, both or neither population [45]. This dynamic process suits a coevolutionary arms race. On the other hand, when a process of dynamic polymorphism takes place both populations are polymorphic at any stage of the. . 16 .

(17) coevolutionary process, hence no directional selection takes place and a “Red queen” process is most likely [45]. Taking this into account, and considering only the binary trait of susceptibility/infectivity, we can hypothesize that our data is supportive of a coevolutionary arms race where directional selection has accumulated enough polymorphisms in the bacterial population. Even though this hypothesis is of great interest, still molecular evidence is needed from both bacterial and phage populations. Conclusions Different conclusions can be drawn from our study. First, the dynamic process of coevolution is greatly orchestrated by the genetic and molecular background of the host and the genetic malleability of its phage; interactions seem to be specific of a particular bacterial species and its associated bacteriophage. Second, the utilization of a phage cocktail in industry represents an important strategy to avoid the emergence of resistance and maintain susceptibility for periods long enough for the context of a shrimp hatchery system; resistance was mostly below 40% of bacterial isolates. Still, consideration of other variables and evaluation of both the phage cocktail and independent phages is needed under small scale and field conditions. Further evaluations of the molecular determinants that drive these interactions are needed, not only to determine the mechanisms of resistance, but also to further understand the molecular basis of the coevolutionary process of phage-bacteria interactions; perhaps, through the complete sequencing of the phages and their host. Despite it, it was observed from variations in the ompK gene that coevolutionary interactions might accelerate molecular evolution; still further functional analysis are needed to consider if those variations represented a significant change in the host viability or fitness. Acknowledgements We would like to give special thanks to Ceniacua and the Facultad de Ciencias of Universidad de los Andes Bogota, Colombia, for their contributions to this study. References. 1. 2. 3. 4. . . Bostock, J., et al., Aquaculture: global status and trends. Philosophical Transactions of the Royal Society B: Biological Sciences, 2010. 365(1554): p. 2897-‐2912. Defoirdt, T., et al., Alternatives to antibiotics to control bacterial infections: luminescent vibriosis in aquaculture as an example. Trends in Biotechnology, 2007. 25(10): p. 472-‐479. Defoirdt, T., P. Sorgeloos, and P. Bossier, Alternatives to antibiotics for the control of bacterial disease in aquaculture. Current Opinion in Microbiology, 2011. In Press, Corrected Proof. Geovanny D, G., J. Balcázar, and S. Ma, Probiotics as control agents in aquaculture. Journal of Ocean University of China (English Edition), 2007. 6(1): p. 76-‐79. . 17 .

(18) 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. . . Chrisolite, B., et al., Distribution of luminescent Vibrio harveyi and their bacteriophages in a commercial shrimp hatchery in South India. Aquaculture, 2008. 275(1-‐4): p. 13-‐19. Indrani, K., et al., Biocontrol of pathogens in shrimp hatcheries using bacteriophages. Aquaculture, 2007. 268(1-‐4): p. 288. Otta and Karunasagar, Bacteriological study of shrimp, Penaeus monodon Fabricius, hatcheries in India. Journal of Applied Ichthyology, 2001. 17(2): p. 59-‐63. Vinod, M.G., et al., Isolation of Vibrio harveyi bacteriophage with a potential for biocontrol of luminous vibriosis in hatchery environments. Aquaculture, 2006. 255(1-‐4): p. 117. Comeau, A.M. and C.A. Suttle, Distribution, genetic richness and phage sensitivity of Vibrio spp. from coastal British Columbia. Environmental Microbiology, 2007. 9(7): p. 1790-‐1800. Crothers-‐Stomps, C., et al., Isolation of lytic bacteriophage against Vibrio harveyi. Journal of Applied Microbiology, 2010. 108(5): p. 1744-‐1750. Alexander, S., Phage therapy: an attractive option for dealing with antibiotic-‐ resistant bacterial infections. Drug Discovery Today, 2005. 10(12): p. 807-‐809. Austin, B., A.C. Pride, and G.A. Rhodie, Association of a bacteriophage with virulence in Vibrio harveyi. Journal of Fish Diseases, 2003. 26(1): p. 55-‐58. Bohannan, B.J.M. and R.E. Lenski, Linking genetic change to community evolution: insights from studies of bacteria and bacteriophage. Ecology Letters, 2000. 3(4): p. 362-‐377. Hanlon, G.W., Bacteriophages: an appraisal of their role in the treatment of bacterial infections. International Journal of Antimicrobial Agents, 2007. 30(2): p. 118-‐128. Vidgen, M., et al., Changes to the phenotypic profile of Vibrio harveyi when infected with the Vibrio harveyi myovirus-‐like (VHML) bacteriophage. Journal of Applied Microbiology, 2006. 100(3): p. 481-‐487. Breitbart, M., et al., Genomic analysis of uncultured marine viral communities. Proceedings of the National Academy of Sciences, 2002. 99(22): p. 14250-‐ 14255. Edwards, R.A. and F. Rohwer, Viral metagenomics. Nat Rev Micro, 2005. 3(6): p. 504-‐510. Hambly, E. and C.A. Suttle, The viriosphere, diversity, and genetic exchange within phage communities. Current Opinion in Microbiology, 2005. 8(4): p. 444-‐ 450. Brockhurst, M.A., et al., Population mixing accelerates coevolution. Ecology Letters, 2003. 6(11): p. 975-‐979. Buckling, A. and P.B. Rainey, Antagonistic coevolution between a bacterium and a bacteriophage. Proceedings of the Royal Society of London. Series B: Biological Sciences, 2002. 269(1494): p. 931-‐936. Mathur, M.D., Vidhani, S., & Mehndiratta, P. L. , Bacteriophage therapy: an alternative to conventional antibiotics The Journal Of The Association Of Physicians Of India 2003. 51: p. 593-‐596. 18 .

(19) 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. . . Weinbauer, M.G., Ecology of prokaryotic viruses. FEMS Microbiology Reviews, 2004. 28(2): p. 127-‐181. Buckling, A. and D.J. Hodgson, Short-‐term rates of parasite evolution predict the evolution of host diversity. Journal of Evolutionary Biology, 2007. 20(5): p. 1682-‐1688. Buckling, A., et al., Antagonistic coevolution with parasites increases the cost of host deleterious mutations. Proceedings of the Royal Society B: Biological Sciences, 2006. 273(1582): p. 45-‐49. Poullain, V., et al., THE EVOLUTION OF SPECIFICITY IN EVOLVING AND COEVOLVING ANTAGONISTIC INTERACTIONS BETWEEN A BACTERIA AND ITS PHAGE. Evolution, 2008. 62(1): p. 1. Scanlan, et al., Genetic basis of infectivity evolution in a bacteriophage. Molecular Ecology, 2011. 20(5): p. 981. Thompson, J.N., Coevolution: The Geographic Mosaic of Coevolutionary Arms Races. Current biology : CB, 2005. 15(24): p. R992-‐R994. Andersson, A.F. and J.F. Banfield, Virus Population Dynamics and Acquired Virus Resistance in Natural Microbial Communities. Science, 2008. 320(5879): p. 1047-‐1050. Brockhurst, M.A., et al., Experimental coevolution with bacteria and phage: The Pseudomonas fluorescens-‐-‐[Phi]2 model system. Infection, Genetics and Evolution, 2007. 7(4): p. 547-‐552. Prosser, J.I., et al., The role of ecological theory in microbial ecology. Nature Reviews. Microbiology, 2007. 5(5): p. 384-‐92. Paterson, S., et al., Antagonistic coevolution accelerates molecular evolution. Nature, 2010. 464(7286): p. 275-‐278. Bull, J.a.M., J, Predicting evolution from genomics: experimental evolution of bacteriophage T7. Heredity, 2008. 100: p. 453-‐463. Jessup, C.M. and S.E. Forde, Ecology and evolution in microbial systems: the generation and maintenance of diversity in phage-‐host interactions. Research in Microbiology, 2008. 159(5): p. 382-‐389. Deveau, H.l.n., J.E. Garneau, and S. Moineau, CRISPR/Cas System and Its Role in Phage-‐Bacteria Interactions. Annual Review of Microbiology, 2010. 64(1): p. 475-‐493. Gottesman, S., Microbiology: Dicing defence in bacteria. Nature, 2011. 471(7340): p. 588-‐589. Labrie, et al., Bacteriophage resistance mechanisms. Nature Reviews. Microbiology, 2010. 8(5): p. 317. Inoue, T., S. Matsuzaki, and S. Tanaka, A 26-‐kDa outer membrane protein, OmpK, common to Vibrio species is the receptor for a broad-‐host-‐range vibriophage, KVP40. FEMS Microbiology Letters, 1995. 125(1): p. 101-‐105. Wommack, K.E. and R.R. Colwell, Virioplankton: Viruses in Aquatic Ecosystems. Microbiol. Mol. Biol. Rev., 2000. 64(1): p. 69-‐114. Hong, H., et al., The Outer Membrane Protein OmpW Forms an Eight-‐stranded Œ≤-‐Barrel with a Hydrophobic Channel. Journal of Biological Chemistry, 2006. 281(11): p. 7568-‐7577. 19 .

(20) 40. 41. 42. 43. 44. 45. 46. 47. . 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. . Li, Y.-‐D., et al., Cloning, Expression, and Genus-‐Specificity Analysis of 28-‐kDa OmpK from Vibrio alginolyticus. Journal of Food Science, 2010. 75(4): p. M198-‐ M203. Horvath, P. and R. Barrangou, CRISPR/Cas, the Immune System of Bacteria and Archaea. Science, 2010. 327(5962): p. 167-‐170. Karginov, F.V. and G.J. Hannon, The CRISPR System: Small RNA-‐Guided Defense in Bacteria and Archaea. Molecular Cell, 2010. 37(1): p. 7-‐19. Lintner, N.G., et al., The Structure of the CRISPR-‐Associated Protein Csa3 Provides Insight into the Regulation of the CRISPR/Cas System. Journal of Molecular Biology, 2011. 405(4): p. 939-‐955. Weld, R.J., C. Butts, and J.A. Heinemann, Models of phage growth and their applicability to phage therapy. Journal of Theoretical Biology, 2004. 227(1): p. 1-‐11. Woolhouse, M.E.J., et al., Biological and biomedical implications of the co-‐ evolution of pathogens and their hosts. Nature Genetics, 2002. 32(4): p. 569-‐77. Cairns, B.J. and R.J.H. Payne, Bacteriophage Therapy and the Mutant Selection Window. Antimicrobial agents and chemotherapy, 2008. 52(12): p. 4344-‐4350. Oliveira, A., R. Sereno, and J. Azeredo, In vivo efficiency evaluation of a phage cocktail in controlling severe colibacillosis in confined conditions and experimental poultry houses. Veterinary Microbiology, 2010. 146(3‚Äì4): p. 303-‐308. Tanji, Y., et al., Therapeutic use of phage cocktail for controlling Escherichia coli O157:H7 in gastrointestinal tract of mice. Journal of Bioscience and Bioengineering, 2005. 100(3): p. 280-‐287. Turki, Y., et al., Evaluation of a cocktail of three bacteriophages for the biocontrol of Salmonella of wastewater. Food Research International, 2012. 45(2): p. 1099-‐1105. Pourcel, C., The CRISPRdb databse and tool to identify clustered regularly interspaced short palindromic repeats, 2007, BMC Bioinformatics. p. 172. Hall, A., P. Scanlan, and A. Buckling, Bacteria-‐Phage Coevolution and the Emergence of Generalist Pathogens. The American Naturalist, 2011. 177(1): p. 44. Kreitman, M., METHODS TO DETECT SELECTION IN POPULATIONS WITH APPLICATIONS TO THE HUMAN. Annual Review of Genomics and Human Genetics, 2000. 1(1): p. 539-‐559. Team}, R.D.C., R: A language and environment for statistical computing. , 2011, {R Foundation for Statistical Computing}: Vienna, Austria. Jed, A.F., Marine viruses and their biogeochemical and ecological effects. Nature, 1999. 399(6736): p. 541. Shapiro, O.H. and A. Kushmaro, Bacteriophage ecology in environmental biotechnology processes. Current Opinion in Biotechnology, 2011. In Press, Corrected Proof. Vamosi, S., On the role of enemies in divergence and diversification of prey: review and synthesis. Can. J.Zool., 2005. 83: p. 894-‐909. Ebert, D., Experimental evolution of parasites. Science, 1998. 282: p. 1432-‐1435. 20 .

(21) 58. 59. 60. 61. 62. 63. . 64. . . O'Flynn, G., et al., Evaluation of a Cocktail of Three Bacteriophages for Biocontrol of Escherichia coli O157:H7. Applied and Environmental Microbiology, 2004. 70(6): p. 3417-‐3424. Bohannan, B.J.M. and R.E. Lenski, The Relative Importance of Comptition and Predation Varies with Productivity in a Model Community. The American Naturalist, 2000. 156(4): p. 320-‐340. Duffy, S., P.E. Turner, and C.L. Burch, Pleiotropic Costs of Niche Expansion in the RNA Bacteriophage Œ¶6. Genetics, 2006. 172(2): p. 751-‐757. Kobayashi, I., et al., Shaping the genome ‚Äì restriction‚Äìmodification systems as mobile genetic elements. Current Opinion in Genetics & Development, 1999. 9(6): p. 649-‐656. Brouns, S.J.J., et al., Small CRISPR RNAs Guide Antiviral Defense in Prokaryotes. Science, 2008. 321(5891): p. 960-‐964. Chakraborty, S., et al., Comparative network clustering of direct repeats (DRs) and cas genes confirms the possibility of the horizontal transfer of CRISPR locus among bacteria. Molecular Phylogenetics and Evolution, 2010. 56(3): p. 878-‐ 887. Deltcheva, E., et al., CRISPR RNA maturation by trans-‐encoded small RNA and host factor RNase III. Nature, 2011. 471(7340): p. 602-‐607. . 21 .

(22)

(23)

(24)

(25)

(26)