• No se han encontrado resultados

Spexin in the European sea bass, Dicentrarchus labrax: Characterization, brain distribution, and interaction with Gnrh and Gnih neurons

N/A
N/A
Protected

Academic year: 2023

Share "Spexin in the European sea bass, Dicentrarchus labrax: Characterization, brain distribution, and interaction with Gnrh and Gnih neurons"

Copied!
22
0
0

Texto completo

(1)

DOI: 10.1002/cne.25428

R E S E A R C H A R T I C L E

Spexin in the European sea bass, Dicentrarchus labrax:

Characterization, brain distribution, and interaction with Gnrh and Gnih neurons

José A. Paullada-Salmerón

1,2,3

Bin Wang

1,4,5

José A. Muñoz-Cueto

1,2,3

1Department of Biology, Faculty of Marine and Environmental Sciences, University of Cádiz, Puerto Real, Cádiz, Spain

2Marine Research Institute (INMAR), Marine Campus of International Excellence (CEIMAR) and Agrifood Campus of International Excellence (ceiA3), Puerto Real, Cádiz, Spain

3European University of the Seas (SEA-EU), Cádiz, Spain

4Key Laboratory of Sustainable Development of Marine Fisheries, Ministry of Agriculture and Rural Affairs, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao, China

5Laboratory for Marine Fisheries and Food Production Processes, Pilot National Laboratory for Marine Science and Technology (Qingdao), Qingdao, China

Correspondence

José A. Paullada-Salmerón and José A.

Muñoz-Cueto, Department of Biology, Faculty of Marine and Environmental Sciences, University of Cádiz, Campus Río San Pedro, E-11510, Puerto Real, Cádiz, Spain.

Email:[email protected];

[email protected]

Funding information

China Scholarship Council, Grant/Award Number: 201903260004; Junta de Andalucía, Grant/Award Numbers: FEDER-UCA 18-107538, PAIDI2020 P18-RT-5152

Abstract

Spexin (Spx) is a recently characterized neuropeptide implicated in multiple physio- logical processes in vertebrates, including reproduction, food intake, and regulation of anxiety and stress. Two orthologs (Spx1 and Spx2) are present in some nonmam- malian vertebrates, including teleosts. However, information on the distribution of Spx in the brain and its interactions with other neuroendocrine systems in fish is still scarce. In this work, we cloned and sequenced the sea bass (Dicentrarchus labrax) Spx1, which included a 27 aa signal peptide and a mature peptide of 14 aa that is C-terminal amidated. spx1 transcripts were higher in the diencephalon/caudal pre- optic area/hypothalamus and medulla but were also detected in the olfactory bulbs, telencephalon/rostral preoptic area, optic tectum/tegmentum, cerebellum/pons, and pituitary. The immunohistochemical study revealed Spx1-immunoreactive (ir) cells in different nuclei of the preoptic area, habenula, prethalamus, mesencephalic tegmen- tum and in the proximal pars distalis (PPD) and pars intermedia of the pituitary. Spx1-ir fibers were widely distributed throughout the brain being particularly abundant in the midbrain and hindbrain, in close contact with tegmental gonadotropin-releasing hormone 2 (Gnrh2) cells and isthmic gonadotropin-inhibitory hormone (Gnih) cells of the secondary gustatory nucleus. Moreover, Gnih fibers were observed innervating Spx1-ir cells lying in several subdivisions of the magnocellular preoptic nucleus and in the lateral nucleus of the valvula, whereas ventrolateral prethalamic Spx1-ir cells received immunopositive Gnrh2 fibers. In the pituitary, Gnrh1-ir fibers were observed closely associated with Spx1-ir cells of the PPD. These results suggest that Spx1 could be involved in both reproductive and nonreproductive (i.e., food intake, behavior) functions in sea bass.

K E Y W O R D S

Gnih, Gnrh, immunohistochemistrym, reproduction, sea bass, spexin

This is an open access article under the terms of theCreative Commons Attribution-NonCommercialLicense, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.

© 2022 The Authors. The Journal of Comparative Neurology published by Wiley Periodicals LLC.

314 wileyonlinelibrary.com/journal/cne J Comp Neurol. 2023;531:314–335.

(2)

1 INTRODUCTION

Spexin (Spx), also named neuropeptide Q (NPQ), is a multifunctional neuropeptide consisting of 14 amino acids (aa) that are highly con- served across vertebrates (Lim et al., 2019). The mature peptide sequence, NWTPQAMLYLKGAQ-NH2, is flanked by RR/KR and GRR dibasic proteolytic cleavage sites, and it is identical in all tetrapods studied so far (Lv et al.,2019; Mirabeau et al.,2007; Sonmez et al., 2009), except in panda, dog, and cat with a substitution of Ala6to Ser6. In fish, Spx orthologs differ from mammalian and avian forms in only one amino acid, an Ala13to Thr13, a substitution that is present in all species investigated to date (Cohen et al.,2020; Lim et al.,2019; Ma et al.,2018). Recently, another paralogous form of Spx, called Spx2, has been identified in a few non-mammalian species (D. K. Kim et al.,2014), and hence the initial mature Spx was termed Spx1. It is worth mention- ing that two Spx1 paralogs, designated as Spx1a and Spx1b, were found in Nile tilapia, while Spx2 is absent in this species (Cohen et al.,2020).

The existence of Spx1 was confirmed, either by bioinformatic anal- ysis or cDNA sequencing, in the genome of several teleost species, including goldfish (Liu et al.,2013), zebrafish (E. Kim et al.,2019), Ya-fish (Wu et al., 2016), orange-spotted grouper (Li et al., 2016), Siberian sturgeon (Tian et al.,2020), half-smooth tongue sole (S. Wang et al.,2018), spotted scat (Deng et al.,2018), and Nile tilapia (Cohen et al.,2020). Based on studies performed in mammals, Spx1 has been involved in the reduction of food intake and the regulation of anxi- ety, stress, and social defeat through its central nervous system (CNS) actions (Lv et al., 2019), but it was also associated with obesity (Pruszynska-Oszmalek et al.,2020), glucose homeostasis (Kołodziejski et al.,2018), movement in gastro-intestinal tract (Lin et al.,2015), and cardiovascular functions (Toll et al.,2012). In all species studied so far, no Spx-specific receptor has been identified, being its actions medi- ated via the galanin (Gal) receptors GALR2 and GALR3 (D. K. Kim et al.,2014). In teleost, the few studies performed on Spx1 have mainly focused on reproduction and food intake (Cohen et al.,2020; Deng et al.,2018; Li et al.,2016; Ma et al.,2017; Tian et al.,2020; Wu et al.,2016; Zheng et al.,2017). For instance, it has been reported that intraperitoneal injection of Spx1 decreases the serum luteinizing hor- mone (Lh) levels (Liu et al.,2013) and appetite (Wong et al.,2013) in goldfish. In the half-smooth tongue sole, treatment with Spx downreg- ulated pituitary gh, fshβ, and gthα mRNA expression and upregulated the gnih and gnrh3 transcript levels in the hypothalamus (S. Wang et al., 2018). However, knockout of Spx1 did not affect the puberty onset and gamete maturation in zebrafish (Zheng et al.,2017). Interestingly, the knockout of Gnrh and kisspeptins in fish does not block reproduction either (Marvel et al.,2018; Trudeau,2018), suggesting the existence of a redundant reproductive regulatory system in this group of verte- brates. Most recently, it was demonstrated that Spx is also involved in the regulation of anxiety behavior and stress in fish (Jeong et al.,2019;

Lim et al.,2020).

Spx1 is mainly expressed in the brain, but it also localized in periph- eral tissues, including the stomach, pancreas, liver, ovary, testis, and

adrenal gland of rodents and humans (Gu et al., 2015; Porzionato et al.,2010; Sassek et al.,2019). In goldfish, spx1 mRNA was revealed in the telencephalon, hypothalamus, optic tectum, cerebellum, spinal cord, and pituitary (Wong et al.,2013), whereas the goldfish Spx1 immunoreactive (ir) cells were identified in the anterior hypothala- mus, ventromedial prethalamic nucleus (VM), and medial longitudinal fascicle (Liu et al., 2013). To date, only one study has elucidated the complete distribution of Spx (Spx1 and Spx2) neurons in fish. In zebrafish, spx1 mRNA was localized in the midbrain and hindbrain, whereas spx2 expression appeared restricted to the preoptic area (E. Kim et al.,2019). However, there are still notable gaps regard- ing the organization of Spx system in fish and its possible interaction with other neuroendocrine factors involved in the control of relevant physiological processes such as reproduction.

Reproduction is controlled by multiple stimulatory and inhibitory factors, in which gonadotropin-releasing hormone (GNRH/Gnrh), and more recently, gonadotropin-inhibitory hormone (GNIH/Gnih) systems play a central role. GNRH/Gnrh is well known in all vertebrates as one of the main cerebral factors controlling reproduction through its stimulatory actions on the synthesis and release of gonadotropins (Muñoz-Cueto et al.,2020; Zohar et al.,2010). On the other hand, GNIH/Gnih is a recently discovered neuropeptide (Tsutsui et al.,2000) that, in contrast to GNRH/Gnrh, is mainly recognized as an inhibitory neurohormone controlling the reproductive processes by acting on GNRH/Gnrh and gonadotropic cells (Muñoz-Cueto et al.,2017).

The European sea bass (Dicentrarchus labrax) represents one of the most important species for aquaculture in Europe, but it is also an inter- esting teleost model species for basic research (Sánchez-Vázquez &

Muñoz-Cueto,2014). Sea basses, like groupers and tilapia, are perco- morphs, a vast clade of recently evolved (65 mya) teleost fishes, which diverged from the ostariophysian lineage (including zebrafish and gold- fish) over 100 mya (Nelson et al.,2016). Although the European sea bass has been the subject of multiple studies that have provided fun- damental knowledge on reproductive neuroendocrinology, this species still presents several problems related to reproduction (e.g., advanced puberty) and sex ratios (higher proportion of males) under culture con- ditions (Carrillo et al.,2009; Paullada-Salmerón et al.,2017; Rodríguez et al.,2000). Because Spx has been involved in several physiological processes (i.e., reproduction, food intake, and stress), detailed infor- mation on the neuroanatomical organization of this neuroendocrine system and its possible interactions with other neuropeptides could provide relevant information to understand how these processes are controlled. Consequently, the main objective of this work was to obtain detailed information on the distribution and localization of the Spx system in the sea bass brain. To this purpose, we first identified and characterized the spx1 gene and analyzed its expression in the CNS of the European sea bass. Then, we mapped the Spx1 system using an antibody against mammalian SPX, and finally we determined its interaction with other reproductive-related neuroendocrine systems by using double immunohistochemistry and Gnih, and prepro-Gnrh1, -Gnrh2 and -Gnrh3 antisera.

(3)

TA B L E 1 Primer sequences used for sea bass spx1 cDNA cloning, RT-PCR and RT-qPCR expression analysis

Primer name Primer sequence (5′−3′) Purpose Amplicon size (bp) GenBank accession No.

spx1 F1 ATGAAAGGTTTGCGGACC ORF cloning

spx1 R1 TCAGAAATATTCTCTCTT

spx1 F2 AGGGACGCAGGTTCATCTCAGAG RT-qPCR 132 MW888328

spx1 R2 GCAGGAAGTTCAGCAGGACAGTG

l17 F CAGGAGTGGGTGACATGGTC 97 AF139590

l17 R GACTTCCGCTGCCGTATCAC

ORF, Open Reading Frame

2 MATERIAL AND METHODS

Sexually mature sea bass males were housed and bred in the fish facili- ties of the “Laboratorio de Cultivos Marinos,” at the University of Cádiz (Puerto Real, Spain). Fish were maintained under natural photoperiod and temperature conditions of 19± 1C, and fed with dry pellets using automatic feeders.

Fish were handled and sacrificed following the guidelines for experi- mental procedures of the Animal Welfare Committee of the University of Cádiz, according to the European Union (2010/63/UE) and the Spanish (RD53/2013) legislations and the Regional Government of Andalucía guidelines (reference no. 15/12/2020/143).

2.1 Molecular cloning of sea bass Spx precursor cDNA

The putative sea bass spexin 1 (spx1) gene sequence was identi- fied through TBLASTN search in the genome of this species using the orange-spotted grouper Spx1 (AML84198) as the query. Gene- specific primers (Table1) were designed, and cloning was performed as described previously (Paullada-Salmerón et al.,2016). Briefly, total RNA from the whole brain was isolated using the TRIsure™ reagent (Bioline, London, UK), and 5 μg of total RNA were used as a template for the first-strand cDNA synthesis using the iScript™ Advanced cDNA Synthesis Kit for quantitative Real-Time Polymerase Chain Reaction (RT-qPCR) (Bio-Rad, Richmond, CA) according to the manufacturer’s instructions. PCR amplification was performed using the Q5®High- Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA), and thermo cycling conditions were as follows: denaturation at 98C for 30 s, followed by 40 cycles of 98C for 10 s, 56C for 20 s, and 72C for 30 s and a final incubation for 10 min at 72C. PCR fragments of the expected size were extracted, purified with ISOLATE II PCR and Gel Kit (Bioline) and subcloned into the pSpark®II Blunt DNA cloning vector (Canvax Biotech, Córdoba, Spain). The vectors containing the amplified fragment were transformed into NEB®5-alpha Competent Escherichia coli (New England Biolabs) from which five positive clones were obtained and sequenced.

2.2 Sequence analysis

The identity of the complete cDNA sequence of sea bass spexin 1 was confirmed by BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi),

and the deduced amino acid sequence was obtained by the DNA- MAN 8 software (Lynnon Biosoft, San Ramon, CA). The signal pep- tide was predicted by the SignalP-5.0 Serve (http://www.cbs.dtu.dk/

services/SignalP/). Multiple amino acid sequence alignment of Spx precursors in various species was performed with Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/). Phylogenetic analysis of the Spx sequences was performed using Mega 6 software (Tamura et al.,2013) using the neighbour-joining method with 1000 bootstrap replicates.

2.3 Quantitative real-time PCR expression analysis

Three juvenile specimens were anesthetized and sacrificed by decapitation. Different parts of the brain (olfactory bulb, telen- cephalon/rostral preoptic area, diencephalon/caudal preoptic area/hypothalamus, optic tectum/tegmentum, cerebellum/pons, medulla) and pituitary were removed, frozen in liquid nitrogen and stored at−80C until use. Total RNA from these tissues was extracted using the TRIsure reagent as mentioned above and 1 μg was reverse transcribed using the PrimeScript™ RT reagent Kit with gDNA Eraser (Takara Bio, Kusatsu, Japan). Quantitative real-time PCR reactions were developed in the CFX96 Touch Real-Time PCR Detection Sys- tem (Bio-Rad) with a total of 20 μl volume containing 10 μl of 2× SsoAdvanced™ Universal SYBR® Green Supermix (Bio-Rad), 0.6 μl of forward and reverse primers (10 μM each, Table1), 1 μl of cDNA template and 7.8 μl of nuclease-free water under the following thermal cycling profiles: 95C for 30 s, and 40 cycles of 95C for 10 s, and 60C for 30 s. Sea bass l17 was selected as the housekeeping gene for data normalization (Paullada-Salmerón et al., 2016; Paullada-Salmerón, Cowan, Aliaga-Guerrero, Morano, et al.,2016) because its expression levels remained stable across various tissues. Each cDNA sample was analyzed in duplicate. Standard curves were generated for each gene with 10-fold serial dilutions of plasmids containing the amplified fragments, and all calibration curves exhibited slopes close to−3.32 and efficiencies around 100%. Melting curves were performed for each sample in order to confirm that a single product was amplified.

The PCR products were also visualized in a 1.5% agarose gel with the RedSafe™ Nucleic Acid Staining Solution (iNtRON Biotechnol- ogy, Houston, TX) and sequenced to verify the identity of amplified products. Relative gene expression levels were quantified with the comparative delta-delta CTmethod (Schmittgen & Livak,2008).

(4)

TA B L E 2 Primary antibodies used in this study

Antigen Immunogen Source, host species, RRID, reference Dilution

Spx1 Spexin/neuropeptide Q (human, rat, mouse, bovine) Phoenix Pharmaceuticals (USA); rabbit polyclonal; RRID:

AB_2923380

1:1500

Gnih2 Synthetic Lpxrfa-2 peptide of Dicentrarchus labrax NH2-SPNSTPNMPQRF-CONH2

University of Cadiz (Spain)-Agrisera, (Sweden); goat polyclonal;

RRID: AB_2923421; Paullada-Salmerón et al. (2016)

1:1500

Gap1 Purified recombinant gonadotropin-releasing hormone-associated peptide (Gap) 1 or recombinant seabream Gap form of D. labrax

Dr. Olivier Kah, CNRS (France)- CEGAV (France); guinea pig polyclonal; RRID: AB_2923418; González-Martínez et al. (2002)

1:1500

Gap2 Purified recombinant gonadotropin-releasing hormone (Gnrh)-associated peptide (Gap) 2 or recombinant chicken-II Gap form of D. labrax

Dr. Olivier Kah, CNRS (France)- CEGAV (France); guinea pig polyclonal; RRID: AB_2923419; González-Martínez et al. (2002)

1:1500

Gap3 Purified recombinant Gnrh-associated peptide (Gap) 3 or recombinant salmon Gap form of D. labrax

Dr. Olivier Kah, CNRS (France)- CEGAV (France); guinea pig polyclonal; RRID: AB_2923420; González-Martínez et al. (2002)

1:1500

RRID, Research Resource Identifier.

2.4 Spx1 immunoreactivity in sea bass brain

The fish (n = 3) were anesthetized in 2-phenoxyethanol (Schar- lab S.L., Barcelona, Spain) and perfused with 0.65% NaCl and 4%

paraformaldehyde, 0.2% picric acid in PBS buffer pH 7.5 at 4C. Tis- sues were collected, postfixed overnight at 4C, cryoprotected in 15%

sucrose solution, embedded in Tissue-Tek, and then cut transversally in 10-μm-thick serial coronal sections on a cryostat.

For the anatomical analysis of the Spx1 system in the sea bass brain, we used an immunofluorescence method as described in Paullada- Salmerón et al. (2016) with slight modifications and a sea bass brain atlas developed in our laboratory (Cerdá-Reverter et al., 2001a, 2001b,2008) with some changes in the nomenclature to adapt it to the current neuromeric/prosomeric models of brain organization (Puelles, 2019). Before immunostaining, the sections of the brain were washed and microwave-heated for 5 min at 800 W in antigen retrieval buffer pH 6.0 (sodium citrate buffer; 10 mM Sodium citrate, 0.05% Tween 20). After microwave treatment, the sections were rinsed twice in PBS and then saturated in PBS containing 0.5% bovine serum albumin for 30 min. Sections were incubated (1:1500 dilution) overnight with a primary antiserum against human, rat, mouse, and bovine Spx/NPQ obtained in the rabbit (Table2, Phoenix Pharmaceuticals, H-023-81, INC. Burlingame, CA) that shows 93% of identity with the mature peptide of sea bass Spx1. Subsequently, sections were washed in PBS three times and incubated at room temperature for 2 h with goat antirabbit Alexa Fluor 488 (1:500 dilution, Jackson ImmunoRe- search Laboratories, West Grove, PA) in a dark chamber. Finally, the slides were incubated in PBS with 4′, 6-diamidino-2-phenylindole (DAPI) for 10 min. To confirm the specificity of the immunostaining, controls were carried out by preabsorption of primary Spx anti- serum with synthetic sea bass Spx1 (NWTPQAMLYLKGTQ-NH2) and sea bass Spx2 (LNVHWGPQSMMYLKGKH-NH2) peptides and by omission of primary antiserum. The brain slides were cover- slipped with Vectashield mounting medium (Vector laboratories, Burlingame, CA), and images were acquired with an AxionCam 503 Color camera (Zeiss, Oberkochen, Germany) and processed using the ZEN software (Zeiss).

2.5 Double immunohistochemical detection of Spx1 with Gnih and Gnrh in sea bass brain

To examine the potential interactions of sea bass Spx1 neurons with Gnih and Gnrh (Gnrh1, Gnrh2, and Gnrh3) cells, fiber projections of Spx1, Gnih, and Gnrh neurons were analyzed in the brain of sea bass by double immunohistochemical methods. Following the proto- col described above, double immunohistochemistry of Spx1 with Gnih was performed by concomitantly incubating overnight coronal brain sections with the anti-Spx1 serum obtained in rabbit (1:1500 dilu- tion) and a specific sea bass anti-Gnih serum obtained in goat (Table2;

1:1500 dilution; Paullada-Salmerón et al.,2016). The day after, slides were rinsed and incubated with donkey antirabbit Alexa Fluor 488 (1:500 dilution, Jackson ImmunoResearch Laboratories) and bovine antigoat Alexa Fluor 594 (1:500 dilution, Jackson ImmunoResearch Laboratories). Anti-Gnrh-associated peptide (Gap) 1, -Gap2, and -Gap3 polyclonal antibodies obtained in guinea pig (Table2, 1:1500 dilution;

González-Martínez et al.,2002; Zmora et al.,2002) were also used in conjunction with Spx1 antiserum for double immunofluorescence.

Then, after overnight incubation with primary antisera, the slides were rinsed and incubated with goat anti-guinea pig Alexa Fluor 594 (1:500 dilution, Jackson ImmunoResearch Laboratories) and donkey antirab- bit Alexa Fluor 488 (1:500 dilution, Jackson ImmunoResearch Lab- oratories), coverslipped with Vectashield mounting medium (Vector laboratories), and observed under a photomicroscope of fluorescence as indicated above.

3 RESULTS

3.1 Molecular cloning of sea bass spx1 gene

The complete open reading frame of sea bass spx1 cDNA (Gen- Bank accession No. MW888328) was 363 bp in length encoding a 120 aa precursor (Figure1). The preprohormone of sea bass Spx1 included a signal peptide of 27 aa and a mature peptide of 14 aa (NWTPQAMLYLKGTQ), which exhibit the characteristic C-terminal

(5)

F I G U R E 1 Nucleotide and deduced amino acid sequences of sea bass spx1 cDNA. The start codon is boxed, and the stop codon is marked by an asterisk (*). The signal peptide is underlined with a broken line. The cleavage sites (RR and GRR) are depicted in bold, and the mature peptide is underlined with a solid line.

amidation processing signal motif (GRR). Multiple sequence align- ment revealed that sea bass Spx1 precursor had a higher identity with the counterparts of other fish and, in particular with those of other percomorph species (97.50% with large yellow croaker, 95.83%

with orange-spotted grouper, 95.76% with spotted scat and 92.50%

with Nile tilapia, Figure 2). However, the sequence identity was much lower when compared with SPX preprohormones of tetrapods (36.28%−54.39%). On the other hand, Spx1 mature peptide was highly conserved among species, except for the Thr substitution for Ala at position 13 in teleosts. The phylogenetic analysis showed that the vertebrate Spx sequences clustered into two distinct lineages, Spx1 and Spx2, with the sea bass Spx identified grouped with the Spx1 clade (Figure3).

3.2 Tissue expression of sea bass spx1 mRNA

As shown in Figure4, sea bass spx1 transcripts were ubiquitously detected in all tissues examined, being higher levels observed in dien- cephalon/caudal preoptic area/hypothalamus and medulla, compared to other neural tissues and pituitary.

3.3 Distribution of Spx1 immunoreactivity in sea bass brain and pituitary

To confirm the specificity of the immunostaining, controls were per- formed by incubating sea bass brain sections with the primary SPX antibody preabsorbed with synthetic sea bass Spx1 and Spx2 peptides (Figure5). The immunolabeling observed after the incubation with the primary SPX antiserum (Figure5a,b) was abolished when it was pre- absorbed with sea bass Spx1 peptide (Figure5c,d) but not after the preabsorption with sea bass Spx2 peptide (Figure5e,f).

The pattern of immunolabeling along the entire rostro-caudal extension of the sea bass brain was similar in all fish analyzed. Figure6 illustrates the localization of labeled cell bodies and fibers obtained in the immunohistochemical study of the sea bass Spx1 system. ir cell bodies were mainly detected in the preoptic area associated with the anteroventral (NPOav) and parvocellular (NPOpc) parts of the par- vocellular preoptic nucleus (Figures6g,hand7a), as well as with the magnocellular preoptic nucleus and its parvocellular (PMpc), magno- cellular (PMmc) and gigantocellular (PMgc) subdivisions (Figures6h–k, 7b,c, and 9a,b). The Spx1 cells of NPOav and NPOpc (rostral preop- tic area) were small to medium-sized and showed rounded and ovoid

(6)

F I G U R E 2 Multiple amino acid sequence alignments of SPX/Spx precursors in various vertebrate species. The mature peptide is indicated in bold, and the amino acid differences between tetrapods and teleosts are marked in red and in blue, respectively. Accession numbers of SPX/Spx precursor sequences used for these alignments are indicated in the legend of Figure3.

(7)

F I G U R E 3 Phylogenetic analysis of spexin (Spx) sequences in vertebrates. GenBank accession numbers of the sequences are as follows: large yellow croaker Spx (XM_010741751); spotted scat Spx (MH029551); European sea bass Spx (MW888328); orange-spotted grouper Spx (KU743243); Nile tilapia Spx (XM_005475105); half-smooth tongue sole Spx1 (MG775238), Spx2 (MH782165); medaka Spx1 (XM_023952112), Spx2 (KF601218); zebrafish Spx1 (XM_005164774), Spx2 (KF601217); goldfish Spx (JQ894857); grass carp Spx (KM189361); chicken SPX1 (XM_015290798), SPX2 (KF601213); rock pigeon SPX (XM_013368508); lizard SPX1 (XM_028746674, SPX2 (KF601212); cattle SPX (NM_001075407); horse SPX (XM_008526234); human SPX (NM_030572); golden hamster SPX (XM_005072992); rat SPX (NM_001083933);

clawed frog SPX2a (KF601214), SPX2b (KF601215); European perch Spx (XM_039810036); Arkansas darter Spx (XM_034878643); pikeperch Spx (XM_036003263).

(8)

F I G U R E 4 Expression profiles of spx1 mRNA in the central areas and pituitary of sea bass. Data were normalized using l17 as a housekeeping gene and are presented as mean± SEM (n = 3). OB:

olfactory bulbs; TEL/rPOA: telencephalon/rostral preoptic area;

DIE/cPOA/HYP: diencephalon/caudal preoptic area/hypothalamus;

OT/TEG: optic tectum/tegmentum; CER/PONS: cerebellum/pons;

MED: medulla; PIT: pituitary.

shapes (Figure7a). The Spx1-immunolabelled cells of the magnocellu- lar preotic nuclei (caudal preoptic area) lie slightly caudal and dorsal to Spx1 cells of NPOav and exhibited medium-sized (PMpc, PMmc, Figures7band9b) to large (PMgc, Figures7cand9a,b) cell bodies. Fur- thermore, conspicuous small and rounded Spx1-ir cells were found in the dorsal habenular nucleus (NHd, Figures6jand7d) of the thalamus.

Ventrally to these Spx1-immunopositive habenular cells and dorso- laterally to the most caudal Spx1-ir cells of PMgc were located the Spx1-ir cells of the ventrolateral prethalamic nucleus (VL, Figures6j, 7e, and9d). Spx1 immunoreactivity was not restricted to the preop- tic area and diencephalon, and some Spx1-ir cells were observed in the central zone of the caudal tegmentum, associated with the medial part of the perilemniscular nucleus (PLm, Figures6nand7f), and, further caudally, in the central part of the semicircular torus (TSc, Figures6o and7g) and the central part of the lateral nucleus of the valvula (NLVc, Figures6o, 7h, and9f). These mesencephalic Spx1 ir cells were small in size and bipolar or ovoid in shape. Finally, a high number of positive immunostained cells was found in the proximal pars distalis (PPD) and pars intermedia (PI) of the pituitary gland of sea bass (Figures6kand7i).

In addition to these perikarya, Spx1-ir fibers were profusely dis- tributed in different areas of the sea bass brain, being more abundant in the mesencephalon, intermediate in the diencephalon, preoptic area, hypothalamus, and rhombencephalon and much lower in the olfactory bulbs, dorsal telencephalon, and cerebellum, where almost no fibers were observed (Figure6). Only a few varicose ir fibers could be traced innervating the olfactory internal cellular layer (Figure6b,c) and ter- minal nerve (Figure6c), as well as in the subdivisions 2, 3, and 4 of the medial part of the dorsal telencephalon (Figures6d,eand8a). The Spx innervation was more prominent in the ventral telencephalon, in particular, in the ventral (Vv), supracommissural (Vs), postcommis- sural (Vp), and intermediate (Vi, Figures6d–fand8b) nuclei. Spx1-ir fibers were also detected bordering the periventricular regions of the preoptic area and, particularly, in the NPOav and NPOpc subdi-

visions of the parvocellular preoptic nucleus; the PMpc, PMmc, and PMgc parts of the magnocellular preoptic nucleus; and in the ante- rior periventricular nucleus (NAPv, Figures6g–i, 7a–c, and8c,d). Some of them were also observed entering the rostral preglomerular nuclei region and the ventral habenula, where ir-fibers were very scarce (Figure6j). In the hypothalamus, Spx-ir fibers running ventro-caudally were found near the medial, lateral, and inferior subdivisions of the lateral tuberal nucleus, the suprachiasmatic nucleus, and the anterior tuberal nucleus, but also in the anterior (NPGa) and lateral preglomeru- lar nuclei (Figures6j–mand8d). Although scarce, ir fibers also reached the dorsal (PPd) and ventral (PPv) subdivisions of the periventricular pretectal nucleus (Figures6k,land 8e), the prethalamus and thala- mus (Figures6j–l, 7e, and8f) as well as the ventral subdivision of the nucleus of the lateral recess (Figure8g). Further caudal, Spx1-ir fibers were much more evident in the dorsal tegmental region of the mesencephalon, in the proximity of the nucleus of the medial longi- tudinal fascicle, rostrally (Figures5a,e, 6l,m, and9e) and, especially, the central (TSc), lateral, and ventral subdivisions of the semicircu- lar torus, the central part of the NLVc and the medial part of the PLm, further caudally (Figures6m–o, 7f–h, and8h,i). In the optic tec- tum, numerous ir fibers were detected only in the deep white zone (Figures5b,fand6k–p). A few fibers were also present in the gran- ular layer of the valvula of the cerebellum (Figures 6m–p). In the hindbrain, Spx1-ir fibers were detected in the secondary gustatory nucleus (NGS), the superior reticular nucleus, the superior nucleus of the raphe (SR) and bordering the motor trigeminal nucleus (Figures6p, 8j, and9f). A few Spx1-ir fibers also reached the facial and vagal lobes, the facial and vagal visceromotor columns, and the inferior olivary nucleus (Figure6q,r). No Spx1-ir fibers were observed in the pituitary (Figures6k,land7i).

3.4 Interaction of Spx1 with Gnih and Gnrh systems in sea bass brain and pituitary

Double immunostaining revealed the presence of Gnih ir fibers in close contact with Spx1 cells in both the magnocellular and gigantocellular subdivisions of the magnocellular preoptic nucleus (Figure9a,b) and, more caudally, in the central part of the lateral nucleus of the valvula (Figure9c). Moreover, Spx1 cells from the ventrolateral prethalamic nucleus received a conspicuous Gnrh2 innervation (Figure9d). In addi- tion, Spx1-ir fibers were observed in contact with Gnrh2 neurons of the dorsal tegmentum (Figure9e) and with Gnih neurons of the NGS (Figure9f). No apparent connection of Spx1 with Gnrh1 and Gnrh3 neurons was detected in the brain of sea bass. However, in the pituitary, Gnrh1-ir fibers profusely innervate the PPD, where abundant Spx1-ir cells were also present (Figure10a–c).

4 DISCUSSION

Spx is a highly conserved neuropeptide that has pleiotropic functions in vertebrates (Lim et al.,2019; Ma et al.,2018). In the current study, we

(9)

F I G U R E 5 Specificity of the SPX1 antibody in the brain of sea bass. (a)

Spx1-immunoreactive (ir) fibers in the central pretectal nucleus (NPC) and tegmentum (TEG).

(b) Spx1-ir fibers in the deep white zone (DWZ) of the optic tectum. (c, d) Serial sections at the same level as (a) and (b) incubated with the primary SPX1 antiserum preabsorbed with sea bass Spx1 peptide. (e) Section from the central pretectal nucleus (NPC) and the dorsal tegmentum (TEG) incubated with the primary SPX1 antiserum preabsorbed with sea bass Spx2 peptide. (f) Section from the DWZ of the optic tectum incubated with the primary SPX1 antiserum preabsorbed with sea bass Spx2 peptide. Scale bars represent 50 μm in (e) and (f) and 100 μm in (a-d). Blue DAPI color has been shifted toward magenta in order to increase contrast with the green fibers. Other abbreviations: CZ, central zone of the optic tectum.

(10)
(11)
(12)

F I G U R E 6 Schematic representation of ir Spx1 cells (dots) and fibers (lines) on representative transverse sections taken from sea bass brain atlas (Cerda-Reverter et al.,2001a, 2001b,2008). (a) Level of the transverse sections of the sea bass brain represented in drawings (b) to (r).

Abbreviations: A, anterior thalamic nucleus; AP, accessory pretectal nucleus; C, caudal nucleus of the octavolateral area; CCe, corpus of the cerebellum; CM, mammillary body; CP, central posterior thalamic nucleus; CZ, central zone of the optic tectum; DAO, dorsal accessory optic nucleus; Dc1, subdivision 1 of the central part of the dorsal telencephalon; Dc2, subdivision 2 of the central part of the dorsal telencephalon; Dd, dorsal part of the dorsal telencephalon; Dld, dorsolateral part of the dorsal telencephalon; Dlp, posterior division of the lateral part of the dorsal telencephalon; Dlv1, subdivision 1 of the ventrolateral part of the dorsal telencephalon; Dlv2, subdivision 2 of the ventrolateral part of the dorsal telencephalon; Dm1, subdivision 1of the medial part of the dorsal telencephalon; Dm2, subdivision 2 of the medial part of the dorsal

telencephalon; Dm3, subdivision 3 of the medial part of the dorsal telencephalon; Dm4, subdivision 4 of the medial part of the dorsal

telencephalon; DON, descending octaval nucleus; DP, dorsal posterior thalamic nucleus; Dp, posterior part of the dorsal telencephalon; DT, dorsal tegmental nucleus; DWZ, deep white zone of the optic tectum; E, entopeduncular nucleus; ECL, external cellular layer of the olfactory bulb; EW, Edinger-Westphal nucleus; FR, fasciculus retroflexus; G, granular layer of the cerebellum; GL, glomerular layer of the olfactory bulb; HaCo, habenular commissure; HCo, horizontal commissure; ICL, internal cellular layer of the olfactory bulb; IO, olive inferior; IR, inferior nucleus of the raphe; IV, fourth ventricle; LC, nucleus of the locus coeruleus; LI, inferior lobes of the hypothalamus; LSO, lateral septal organ; LT, lateral thalamic nucleus; M, molecular layer of the cerebellum; MaOT, marginal optic tract; MON, medial octavolateral nucleus; NAPv, anterior periventricular nucleus; NAT, anterior tuberal nucleus; NC, cortical nucleus; NCLI, central nucleus of the inferior lobe; NCW, nucleus of the commissure of Wallenberg; NDLIc, caudal part of the diffuse nucleus of the inferior lobe; NDLII, lateral part of the diffuse nucleus of the inferior lobe; NDLIm, medial part of the diffuse nucleus of the inferior lobe; nFR, nucleus of the fasciculus retroflexus; NGa, anterior part of the glomerular nucleus; NGp, posterior part of the glomerular nucleus; NGS, secondary gustatory nucleus; NGT, tertiary gustatory nucleus; NHd, dorsal habenular nucleus; NHv, ventral habenular nucleus; nIII, oculomotor nerve nucleus; NLTd, dorsal part of the lateral tuberal nucleus; NLTi, lateral tuberal nucleus inferior part; NLTl, lateral part of the lateral tuberal nucleus; NLTm, medial part of the lateral tuberal nucleus; NLTv, ventral part of the lateral tuberal nucleus; NLVa, anterior part of the lateral nucleus of the valvula; NLVc, central part of the lateral nucleus of the valvula; nMLF, nucleus of the medial longitudinal fascicle; NMLI, medial nucleus of the inferior lobe; NP, paracommissural nucleus; NPC, central pretectal nucleus; NPGa, anterior preglomerular nucleus; NPGc, commissural preglomerular nucleus; NPGl, lateral preglomerular nucleus; NPGm, medial preglomerular nucleus; NPOav, anteroventral part of the parvocellular preoptic nucleus, NPOpc, parvocellular part of the parvocellular preoptic nucleus; NPPv, posterior periventricular nucleus; NPT, posterior tuberal nucleus; nPVO, nucleus of the paraventricular organ; NR, nucleus ruber; NRLl, lateral part of the nucleus of the lateral recess; NRP, nucleus of the posterior recess; NSC, suprachiasmatic nucleus; NSV, nucleus of the vascular sac; NT, nucleus taenia; NTe, nucleus of the prethalamic eminence; nTPI, nucleus of the pretecto-isthmic tract; OLN, olfactory nerve fibers; OT, optic tectum; P, pituitary; PCo, posterior commissure; PE, preeminential nucleus; PG, periventricular granular cell mass of the caudal lobe; PGD, dorsal periglomerular nucleus; PGZ, periventricular gray zone of the optic tectum; PLm, medial part of the perilemniscular nucleus; PMgc, gigantocellular part of the magnocellular preoptic nucleus; PMmc, magnocellular part of the magnocellular preoptic nucleus; PMpc,

parvocellular part of the magnocellular preoptic nucleus; PO, posterior octaval nucleus; POA, preoptic area; PPd, dorsal periventricular pretectal nucleus; PPv, ventral periventricular pretectal nucleus; PSm, magnocellular superficial pretectal nucleus; PSp, parvocellular superficial pretectal nucleus; PVO, paraventricular organ; RI, inferior reticular nucleus; RL, lateral reticular nucleus; RM, medial reticular nucleus; RS, superior reticular nucleus; SCO, subcommissural organ; SOF, secondary olfactory fibers; SR, superior nucleus of the raphe; SV, vascular sac; SWGZ, superficial white and gray zone of the optic tectum; Tel, telencephalon; TLa, nucleus of the lateral torus; TLo, longitudinal torus; TN, terminal nerve; TNgc, terminal nerve ganglion cells; TPp, periventricular nucleus of the posterior tuberculum; TSc, central part of the semicircular torus; TSI, lateral part of the semicircular torus; TSv, ventral part of the semicircular torus; V, descending trigeminal tract; VAO, ventral accesory optic nucleus; Vc, central nucleus of the ventral telencephalon; VCe, valvula of the cerebellum; Vd, dorsal nucleus of the ventral telencephalon; Vl, lateral nucleus of the ventral telencephalon; VL, ventrolateral prethalamic nucleus; VLo, facial-vagal lobe; VM, ventromedial prethalamic nucleus; VOT, ventral optic tract; Vp, postcommissural nucleus of the ventral telencephalon; Vs, supracommissural nucleus of the ventral telencephalon; VT, ventral tegmental nucleus; Vv, ventral nucleus of the ventral telencephalon; Xm, facial-vagal visceromotor column.

reported the identification of the spx1 gene in sea bass, its expression patterns in CNS, as well as the precise immunohistochemical local- ization and its interactions with Gnih and Gnrh neurons in the brain and pituitary gland of this species. The mature peptide of sea bass Spx1 is a tetradecapeptide that was flanked by two dibasic cleavage sites. Although one or two amino acid substitutions occurred among vertebrate species, the mature peptide of Spx1 is well-conserved, sug- gesting that this neuropeptide may play an important physiological role during evolution (Ma et al.,2018). Phylogenetic and identity analyses indicated that the sea bass Spx1 sequence fell into the vertebrates’

Spx1 clade, sharing the highest identity (69%–97%) with teleosts coun- terparts and being distantly related to the Spx2 branch. We also obtained a partial Open Reading Frame (ORF) sequence of Spx2 in sea bass (unpublished data), with a mature peptide containing 17 amino acids as those identified in medaka (D. K. Kim et al.,2014) and half-smooth tongue sole (B. Wang et al.,2020).

Previous studies have reported the ubiquitous expression of spx1 mRNA in different brain areas of tetrapods and fish. In mammals, SPX1 was expressed in the olfactory bulbs, cerebral cortex, cerebel- lum, hypothalamus, and pituitary (Tian et al.,2020; Wong et al.,2021;

Zhuang et al.,2020), whereas in teleosts, particularly in goldfish, spx1 is expressed mainly in the optic tectum, hypothalamus, and the brainstem but also in the olfactory bulbs, telencephalon, cerebellum, spinal cord, and pituitary (Liu et al.,2013; Wong et al.,2013). Similarly, sea bass spx1 gene was primarily expressed in the diencephalon/caudal preoptic area/hypothalamus and medulla and to a lower extent in the olfactory bulbs, telencephalon/rostral preoptic area, optic tectum/tegmentum, cerebellum/pons and pituitary. Using in situ hybridization, spx1 was localized in the midbrain and hindbrain of zebrafish (E. Kim et al.,2019).

Furthermore, spx1a was detected at high levels in the midbrain, while spx1b was expressed mainly in the forebrain of tilapia (Cohen et al., 2020).

(13)

F I G U R E 7 Distribution of ir Spx1 cells in the brain of sea bass. (a-c) Spx1 cells in the preoptic area. (a) Spx1 cells in the anteroventral part of the parvocellular preoptic nucleus (NPOav). (b) Spx1 cells in the parvocellular (PMpc) and magnocellular (PMmc) parts of the magnocellular preoptic nucleus. (c) Spx1 cells in the gigantocellular part of the magnocellular preoptic nucleus (PMgc). (d) Spx1 cells in the dorsal habenular nucleus (NHd)

(Continues)

(14)

F I G U R E 7 (Continued)

of the thalamus. (e) Spx1 cells in the ventrolateral prethalamic nucleus (VL). (f) Spx1 cells in the medial part of the perilemniscular nucleus (PLm). (g) Spx1 cells in the central part of the semicircular torus (TSc). (h) Spx1 cells in the central part of the lateral nucleus of the valvula (NLVc). (i) Spx1 cells in the proximal pars distalis (PPD) and pars intermedia (PI) of the pituitary. White arrowheads point out Spx1-ir cells. Scale bars represent 20 μm in (a), (g) and insets of panels (e), (f), and (h), 50 μm in (b), (c), (d), (e), (f) and (h), and 0.2 mm in (i). Blue DAPI color has been shifted toward magenta in order to increase contrast with the green fibers. Other abbreviations: I, intermediate prethalamic nucleus; NHv, ventral habenular nucleus; NLVa, anterior part of the lateral nucleus of the valvula; VM, ventromedial prethalamic nucleus.

This study brings new information on the distribution of ir Spx1 cells and fibers in the brain and pituitary of a teleost species, using a mammalian antibody directed against a SPX peptide that share 93%

of identity with the mature Spx1 peptide of sea bass. We report here the presence of Spx1-ir cells in different cell masses of the preoptic area (anteroventral and parvocellular parts of the parvocellular pre- optic nucleus; parvocellular, magnocellular and gigantocellular parts of the magnocellular preoptic nucleus), thalamic habenula (NHd), pretha- lamus (VL), mesencephalic tegmentum (PLm, semicircular torus, lateral nucleus of the valvula), and pituitary gland (PPD and PI). To date, there is little information available in the literature on the pattern of distribu- tion of Spx1 cells in non-mammalian species. In fish, Spx1 ir cells have been reported in the anterior hypothalamus, VM, and medial longitu- dinal fascicle of the goldfish brain (Liu et al.,2013). In tilapia, the in situ hybridization analysis also revealed the presence of Spx cells in the ventromedial nucleus of the semicircular torus and in all subdivi- sions of the dorsal telencephalon (Lim et al.,2020). In the current study, immunostaining showed Spx1-ir cells in different nuclei of the preop- tic area, which along with the hypothalamus, is known for being an important source of hypophysiotropic neurons and is associated with the control of reproductive processes (Anglade et al.,1993; González- Martínez et al.,2001; González-Martínez, Zmora, Saligaut, et al.,2002;

González-Martínez, Zmora, Sarasquete, et al.,2002; Weitekamp et al., 2017). The role of Spx1 cells in the regulation of reproduction has been recently reported in teleosts. These cells exert an inhibitory effect on the synthesis and release of Lh and Fsh (Cohen et al.,2020; Liu et al.,2013; S. Wang et al.,2018) but also decrease the expression of growth hormones both in vivo and in vitro in the grouper and tongue sole (Li et al.,2016; S. Wang et al.,2018). The NPOav and/or NPOpc nuclei also exhibit Gnrh1 (González-Martínez, Zmora, Saligaut, et al., 2002), dopamine (Batten et al.,1993) and neuropeptide Y (Cerdá- Reverter et al.,2000) cells in sea bass. All these neuroendocrine factors are well known as involved in the control of reproduction in fish via their action on gonadotropin cells (Dufour et al.,2010; Zohar et al., 2010). In addition, Npy is implicated in the regulation of food intake and energy metabolism as a powerful orexigenic neuropeptide (Volkoff et al.,2005), but it also acts on anxiety in vertebrates, including fish (Kawabe et al.,2021; Sajdyk et al.,2004; Shiozaki et al.,2020). Interest- ingly, in species such as goldfish (Wong et al.,2013), zebrafish (Zheng et al.,2017), Ya-fish (Wu et al.,2016), and orange-spotted grouper (Li et al.,2016), Spx1 might play an active role in the regulation of food consumption and feeding behavior via its central actions to regulate orexigenic and anorexigenic signals in different brain areas. On the other hand, previous studies have reported that the magnocellular pre- optic nuclei are associated with different physiologic processes such as

stress response, feeding, and reproductive-social behavior (Bond et al., 2007; Jadhao & Meyer,2000; Olivereau & Olivereau,1990; Partridge et al.,2016; Prasada Rao et al.,1996). The magnocellular preoptic area has been described as one of the Gal synthesis sites and a target for kisspeptin in fish (Escobar et al.,2013; Jadhao & Meyer,2000; Mills et al.,2021; Moons et al.,1991). Spx1, which exerted its actions via Gal receptors, could be interacting with Gal and kisspeptins in the regula- tion of metabolism and reproductive processes in teleost fish. Whether these Spx1 cells are playing a role in controlling these functions in sea bass, as reported in other fish, should be elucidated in future research.

As already observed in zebrafish (E. Kim et al.,2019), the NHd of sea bass exhibited a prominent population of Spx1-ir cells. The habe- nula is located in the thalamus (Puelles,2019) and is characterized by connecting the forebrain with the midbrain/hindbrain via the fasci- culus retroflexus (Aizawa et al.,2011). In fish, the habenular structure consists of two separate regions, the dorsal habenula and the ventral habenula. According to recent studies in zebrafish, the dorsal habe- nula would be homologous to the mammalian medial habenula and projects mainly into the interpeduncular nucleus (IPN), in which Gal receptors (GALR2a and GALR2b) were also observed (E. Kim et al., 2019), whereas the ventral habenula is homologous to the mammalian lateral habenula, which projects to the raphe nucleus (Amo et al.,2010;

Hendricks & Jesuthasan,2007). In the present work, scattered Spx1-ir fibers were observed in the raphe region, but we could not localize the fibers of these neurons within the IPN of sea bass. Transgenic zebrafish overexpressing Spx1 in the dorsal habenula seems to reduce anxiety behavior through its interaction with GALR2a/GALR2b present in IPN and the modulation of the serotoninergic system in the raphe nuclei (Jeong et al.,2019). Further studies appear therefore necessary to elucidate the putative role of these habenular Spx1 cells in sea bass.

Moreover, we observed scattered Spx1-ir cells in the prethalamus (VL). The presence of Spx1 cells in the prethalamus/thalamus has only been reported previously in goldfish (Liu et al.,2013), but its precise functions remain unknown. In this last species, Spx1-ir cells were also reported in the tegmental region of the medial longitudinal fascicle (Liu et al.,2013), but similar Spx1-ir neurons were neither observed in sea bass (present study) nor in tilapia (Lim et al.,2020). In sea bass, the prethalamus (former ventral thalamus in our neuroanatomical atlas) is divided into four nuclei: the nucleus of the prethalamic eminence, the VM, the VL, and the intermediate prethalamic nucleus (Cerdá-Reverter et al.,2001b). In other teleost species, the VL receives retinal and tec- tal inputs of ventromedial prethalamic cells (Arenzana et al.,2006;

Northcutt & Wullimann,1988) and projects to the optic tectum and the corpus of the cerebellum (CCe; Striedter,1990). The optic tectum also presents abundant ir Spx1 fibers in sea bass, suggesting that the

(15)

F I G U R E 8 Distribution of ir Spx1 fibers in the sea bass brain. (a) Spx1 fibers in the subdivision 4 of the medial part of the dorsal telencephalon (Dm4). (b) Spx1 fibers in the ventral nucleus of the ventral telencephalon (Vv). (c) Spx1 fibers in the rostral preoptic area (POA). (d) Spx1 fibers in

(Continues)

(16)

F I G U R E 8 (Continued)

the anterior periventricular nucleus (NAPv) and the suprachiasmatic nucleus (NSC) of the caudal preoptic area. (e) Spx1 fibers in the dorsal (PPd) and ventral (PPv) periventricular pretectal nuclei. (f) Spx1 innervation of the dorsal posterior thalamic nucleus (Dp). (g) Spx1 fibers in the ventral part of the nucleus of the lateral recess (NRLv). (h) Spx1 fibers in the lateral (TSI), the central (TSc) and ventral (TSv) parts of the semicircular torus.

(i) Spx1 fibers in the TSc and the medial part of the perilemniscular nucleus (PLm). (j) Spx1 fibers in the secondary gustatory nucleus (NGS) and the superior nucleus of the raphe (SR). White arrowheads point out Spx1-ir fibers. Scale bars represent 50 μm in (a), (b), (c), (d), (e), (f), (g), and (i) and 100 μm in (h) and (j). Blue DAPI color has been shifted toward magenta in order to increase contrast with the green fibers. Other abbreviations: FR, fasciculus retroflexus;IV, fourth ventricle.

ventrolateral prethalamic Spx1 cells could be the source of this inner- vation. In contrast, almost no Spx1 innervation was detected in the CCe in our species.

Spx1-ir cells were also identified in the tegmental NLVc, PLm and semicircular torus (TSc) of sea bass. In some teleosts, the lateral nucleus of the valvula receives projections from the magnocellular part of the superficial pretectal nucleus, VM, inferior lobe, and sen- sory trigeminal nucleus (Ito & Yoshimoto,1990; Ito et al.,1986; Xue et al.,2006) and is a source of afferent projections to the inferior lobe, longitudinal torus, and cerebellum (Ito & Yoshimoto,1990; Wullimann

& Glenn Northcutt,1989; Wullimann & Northcutt,1988; Xue et al., 2004; Yang et al.,2004). In turn, the PLm and the TSc are both auditory structures in fish that send projections to the anterior preglomeru- lar nucleus (NPGa; Yamamoto & Ito,2005a), a glomerular cell mass from the migrated region of the posterior tuberculum that has been involved in the relay of gustatory, acoustic, and electrosensory lateral line information (Rink & Wullimann,1998; Striedter,1991; Yamamoto

& Ito,2005a). The Spx1-ir fibers present in the anterior preglomeru- lar nucleus of sea bass could have an origin in these tegmental Spx1 cell masses and suggest a role of this neuropeptide in the modulation of sensory information in this species.

Finally, numerous Spx1-ir cells were found in the PPD and PI of the pituitary, which in fish contain abundant Lh-secreting cells and express Gnrh receptors (González-Martínez et al.,2004; Levavi-Sivan et al.,2010; Shimizu et al.,2003). This result is in line with the previ- ous identification of spx1 mRNA expression in the pituitary of goldfish (Wong et al.,2013), Ya-fish (Wu et al.,2016), spotted scat (Deng et al., 2018), and half-smooth tongue sole (S. Wang et al.,2018). The pres- ence of Galr1a, Galr1b, Galr2a, and Galr2b has been characterized in the pituitary of sea bass, with the first two receptors exhibiting signifi- cant changes in expression along the reproductive cycle (Martins et al., 2021). Interestingly, Gal stimulates pituitary gonadotropins release in vitro and gonadotropins release induced by Gal varies across the repro- ductive cycle (Pinto et al.,2017), actions that are probably mediated by galanin receptors present in gonadotropic cells. Considering that Spx acts on the same receptors as Gal, and that we did not observe any Spx1 fibers entering into the pituitary of this species, these results suggest that Spx1 produced in the PPD and PI may act on gonadotropic cells of sea bass in a paracrine or autocrine manner rather than in a neu- roendocrine way, to modulate Lh and/or Fsh synthesis and secretion.

However, the release of Spx1 into the pituitary bloodstream cannot be discarded because, at least in zebrafish, a dual mode of gonadotrope regulation by Gnrh3 that combines both neuroglandular and neurovas- cular components has been reported (Golan et al.,2015). In turn, the

presence of immunopositive Gnrh1-ir fibers entering into the PPD and contacting with Spx1-ir cells revealed in the present study, together with the abundant expression of Gnrh receptors in the PPD of this species (González-Martı ´nez et al.,2004) suggest that Spx activity could be regulated by Gnrh1 at the pituitary level in sea bass. Future studies should be directed to characterize the effects of Spx1 on gonadotropin synthesis and secretion, as well as the regulation of Spx system by Gnrh1 in sea bass.

In the present study, Spx fibers were widely distributed in the mid- brain and hindbrain of sea bass, being this innervation much scarcer in the forebrain. Nevertheless, positive Spx1-ir fibers were detected in the internal cellular layer and terminal nerve region of the olfac- tory bulbs, but also in the ventral telencephalic area, the preoptic area, and the lateral tuberal nucleus of the hypothalamus, which also exhibit in sea bass Gnrh1, Gnrh3, and/or Gnih cells (González-Martínez et al.,2002; Paullada-Salmerón et al.,2016). Although recent reports are suggesting that Spx1 could have a potential role in fish reproduc- tion (Cohen et al.,2020; Liu et al.,2013; S. Wang et al.,2018), we did not observe any direct association between Spx1 with the hypophys- iotropic Gnrh forms (i.e., Gnrh1 and Gnrh3) in the brain of sea bass.

These observations would indicate that Spx1 could act directly at the pituitary level on gonadotropic cells rather than at the brain level, to control the reproduction of this species. Interestingly, spx1 tran- script levels were lower in goldfish and orange-spotted grouper brains during the breeding season (Li et al.,2016; Liu et al.,2013). It should be noted that the animals used in the present study were mature males at the beginning of the reproductive season, and therefore it is possible that the absence of fibers in the hypophysis, or in association with the hypophysiotropic Gnrh cells, maybe due to the physiological condition of the animals. Hence, additional studies in other stages of the repro- ductive cycle appear necessary to elucidate seasonal plastic changes of Spx system in sea bass.

In the preoptic area, double immunofluorescence labeling showed a close association of Gnih fibers with Spx1 cells. In a previous study, we reported the inhibitory role of Gnih in the reproductive axis of sea bass by acting at both brain and pituitary levels. Indeed, the central admin- istration of Gnih down-regulated the mRNA expression of gnrh1 and gnrh2 as well as the mRNA and plasma levels of Lh (Paullada-Salmerón et al.,2016). In the hypothalamus of the half-smooth tongue sole, intraperitoneal injection of Spx1 increased the abundance of gnrh3 and gnih but decreased the transcript levels of fshβ and gthα (S. Wang et al.,2018). Similarly, treatment with Spx (Spx1a and Spx1b) decreased plasma levels of Lh and Fsh in Nile tilapia (Cohen et al.,2020). These results could indicate that the inhibitory effects of Spx may be exerted

(17)

F I G U R E 9 Double immunolabeling revealing the interactions of Spx1 with Gnih and Gnrh2 cells in the sea bass brain. (a) Gnih-ir fibers in proximity (arrowhead) to Spx1 cells of the gigantocellular part of the magnocellular preoptic nucleus (PMgc). (b) Gnih-ir fibers in proximity to Spx1 cells of PMgc and the magnocellular (PMmc, arrowheads) part of the magnocellular preoptic nucleus. (c) Gnih-ir fibers innervating Spx1 cells in the central part of the lateral nucleus of the valvula (NLVc, arrowheads). (d). Gnrh2-ir fibers reaching Spx1 cells (arrowhead) in the ventrolateral prethalamic nucleus (VL). (e) Spx1-ir fibers in close association with Gnrh2 neurons (arrowhead) in the nucleus of the medial longitudinal fascicle (nMLF). (f) Spx1-ir fibers innervating Gnih cells (arrowheads) in the secondary gustatory nucleus (NGS). White arrowheads in (a), (c), and (d) point out Spx1-ir cells magnified in insets. Scale bars represent 10 μm in insets of panels (a), (c), and (d), 20 μm in (b), (c), and (f) and 50 μm in (a), (d), and (e)

directly on pituitary cells, as indicated above, or may involve indirect actions on Gnrh and Gnih system.

Moreover, we also identified Spx1-ir axons in the dorsal tegmen- tum, close to the nucleus of the medial longitudinal fascicle. In sea bass, this region is characterized by the presence of both Gnrh2 and Gnih cells that profusely innervate sensory-motor areas and the spinal cord (González-Martínez, Zmora, Saligaut, et al.,2002; et al.,2016).

There are also evidence that such cells might be implicated in the mod- ulation of sexual behavior or locomotor activity and are sensitive to sexual steroids (Maney et al.,1997; Muske,1993; Paullada-Salmerón et al.,2016). These Spx1-ir fibers were occasionally observed contact-

ing Gnrh2 neurons and close to Gnih cells. We also noted the presence of immunopositive Gnrh2 fibers near the Spx1 cells of the VL, sug- gesting that Spx1 and Gnrh2 systems are bidirectionally connected.

So far, there is no information about the possible role of Spx in the control of sexual behavior and locomotor activity in fish. Whether the presence of Spx1-ir fibers in the dorsal tegmental area of sea bass could support a role of Spx1 neurons on these behaviors via both Gnrh2 and Gnih systems will require further investigation in the future.

In addition, we identified Spx1-ir fibers innervating Gnih cells of the NGS. In fish, the NGS mainly receives efferent projections from the facial (LVII), glossopharyngeal (LIX), and vagal (LX) lobes of the medulla

(18)

F I G U R E 1 0 Double immunolabeling revealing the interactions of Spx1 cells with Gnrh1 fibers in the sea bass pituitary. (a)

(Continues)

F I G U R E 1 0 (Continued)

Spx1-immunoreative cells in the proximal pars distalis (PPD) and pars intermedia (PI) of the pituitary receiving abundant Gnrh2 projections.

(b), (c) Details of Gnrh1-ir fibers innervating Spx1 cells in the PPD (white arrowheads). Scale bars represent 0.2 mm in (a) and 10 μm in (b) and (c)

(Kato et al.,2012; Wullimann,1988; Yáñez et al.,2017). Although no labeled Spx1 cells were observed in these nuclei of sea bass rhomben- cephalon, we detected high levels of Spx1 mRNA in the medulla by qPCR. This controversy could be the result of differences in the sensitivity of techniques used (higher sensitivity of qPCR vs. immuno- histochemistry) or the uncoupling of transcription and translation as a consequence of the existence of daily rhythms in spx1 mRNA expres- sion and Spx1 protein synthesis with different acrophases. Further studies should address this apparent controversy by using qPCR and in situ hybridization and immunohistochemistry with specific riboprobes and antibodies against sea bass Spx1, with a chronobiological approach.

On the other hand, we also observed some positive Gnih-ir fibers in contact with Spx1 neurons in the central part of the NLVc. In some teleosts, the lateral valvular nucleus (NLV) seems to shuttle visual and somatosensory information to the cerebellum via the pretecto-NLV- cerebellar pathway (Ito & Yoshimoto,1990; Ito et al.,1986; Yang et al., 2004). This nucleus, together with the medial region of the nucleus of the lateral torus, the inferior lobe, and the tertiary gustatory nucleus, receives efferent projections from the NGS (Kato et al.,2012; Wulli- mann & Northcutt,1988; Yamamoto & Ito,2005b; Yáñez et al.,2017).

In a previous immunohistochemical study performed on sea bass, we localized a prominent population of Gnih cells in the NGS (Paullada- Salmerón et al.,2016). The presence of Gnih-ir fibers in the NLV suggests that Gnih-ir cells from the NGS could represent one of the sources of this Gnih innervation on NLV Spx cells.

In summary, the present study provides novel information on the expression and distribution of the Spx1 system in the CNS and pituitary of sea bass, as well as on its interaction with Gnih and Gnrh systems.

Spx1-ir cells identified in different preoptic, diencephalic, and mesen- cephalic cell masses are the source of a profuse innervation that mainly reach the midbrain and hindbrain, suggesting that this neuropeptide could play a relevant role in sensory-motor functions in sea bass. The absence of Spx1-ir fibers but the presence of abundant Spx1-ir cells in the PPD and PI of the sea bass pituitary, where gonadotropic cells are also located, suggest a potential role (autocrine, paracrine and/or vascular) of Spx in the reproductive process of sea bass. More in-depth functional studies appear necessary to understand the interaction of Spx with Gnih and Gnrh systems and its putative role on reproduc- tive and nonreproductive (e.g., food intake, sexual and motor behavior, stress, etc.) functions in sea bass, in particular, and in fish.

AU T H O R C O N T R I B U T I O N S

All authors had full access to all the data in the study and take responsi- bility for the integrity of the data and the accuracy of the data analysis.

José A. Paullada-Salmerón helped design the study, performed exper- iments, analyzed the data, and wrote the first draft of the article. Bin

(19)

Wang helped in the molecular cloning and qPCR expression analysis of Spexin 1. José A. Muñoz-Cueto conceived the concept of this study and contributed to the experimental design, and analysis of data. All authors were involved in revisions of the draft article and agreed to the final content of the article.

AC K N O W L E D G M E N T S

We would like to thank Mariano José García de Lara and the staff from the “Planta de Cultivos Marinos” (University of Cádiz), for the care and housing of experimental animals. We also thank Natalia U. Herrero Romero for her assistance with English editing of this manuscript.

C O N F L I C T O F I N T E R E S T

The authors declare no conflicts of interest.

DATA AVA I L A B I L I T Y S TAT E M E N T

The data that support the findings of this study are available from the corresponding author upon reasonable request.

O RC I D

José A. Paullada-Salmerón https://orcid.org/0000-0002-8211-4209 José A. Muñoz-Cueto https://orcid.org/0000-0002-8597-5506

P E E R R E V I E W

The peer review history for this article is available athttps://publons.

com/publon/10.1002/cne.25428.

R E F E R E N C E S

Aizawa, H., Amo, R., & Okamoto, H. (2011). Phylogeny and ontogeny of the habenular structure. Frontiers in Neuroscience, 5, 1–7.https://doi.org/10.

3389/fnins.2011.00138

Amo, R., Aizawa, H., Takahoko, M., Kobayashi, M., Takahashi, R., Aoki, T., &

Okamoto, H. (2010). Identification of the zebrafish ventral habenula as a homolog of the mammalian lateral habenula. Journal of Neuroscience, 30, 1566–1574.https://doi.org/10.1523/JNEUROSCI.3690-09.2010 Anglade, I., Zandbergen, T., & Kah, O. (1993). Origin of the pituitary inner-

vation in the goldfish. Cell and Tissue Research, 273, 345–355.https://doi.

org/10.1007/BF00312837

Arenzana, F. J., Arévalo, R., Sánchez-González, R., Clemente, D., Aijón, J., &

Porteros, A. (2006). Tyrosine hydroxylase immunoreactivity in the devel- oping visual pathway of the zebrafish. Anatomy and Embryology, 211, 323–334.https://doi.org/10.1007/s00429-006-0084-2

Batten, T. F. C., Berry, P. A., Maqbool, A., Moons, L., & Vandesande, F. (1993).

Immunolocalization of catecholamine enzymes, serotonin, dopamine and L-dopa in the brain of Dicentrarchus labrax (teleostei). Brain Research Bulletin, 31, 233–252.https://doi.org/10.1016/0361-9230(93)90214-V Bond, H., Warne, J. M., & Balment, R. J. (2007). Effect of acute restraint on hypothalamic pro-vasotocin mRNA expression in flounder, Platichthys flesus. General and Comparative Endocrinology, 153, 221–227.https://doi.

org/10.1016/j.ygcen.2007.03.014

Carrillo, M., Zanuy, S., Felip, A., Bayarri, M. J., Molés, G., & Gómez, A. (2009).

Hormonal and environmental control of puberty in perciform fish: The case of sea bass. Annals of the New York Academy of Sciences, 1163, 49–59.

https://doi.org/10.1111/j.1749-6632.2008.03645.x

Cerdá-Reverter, J. M., Anglade, I., Martínez-Rodríguez, G., Mazurais, D., Muñoz-Cueto, J. A., Carrillo, M., Kah, O., & Zanuy, S. (2000). Character- ization of neuropeptide Y expression in the brain of a perciform fish, the sea bass (Dicentrarchus labrax). Journal of Chemical Neuroanatomy, 19, 197–210.https://doi.org/10.1016/s0891-0618(00)00063-6

Cerdá-Reverter, J. M., Muriach, B., Zanuy, S., & Muñoz-Cueto, J. A. (2008). A cytoarchitectonic study of the brain of a perciform species, the sea bass (Dicentrarchus labrax): The midbrain and hindbrain. Acta Histochemica, 110, 433–450.https://doi.org/10.1016/j.acthis.2008.01.001

Cerdá-Reverter, J. M., Zanuy, S., & Muñoz-Cueto, J. A. (2001a). Cytoar- chitectonic study of the brain of a perciform species, the sea bass (Dicentrarchus labrax). I. The telencephalon. Journal of Morphology, 247, 217–28.https://doi.org/10.1002/1097-4687(200103)247:3⟨217::AID- JMOR1013⟩3.0.CO;2-U

Cerdá-Reverter, J. M., Zanuy, S., & Muñóz-Cueto, J. A. (2001b).

Cytoarchitectonic study of the brain of a perciform species, the sea bass (Dicentrarchus labrax). II. The diencephalon. Jour- nal of Morphology, 247, 229–251. https://doi.org/10.1002/1097- 4687(200103)247:3⟨229::AID-JMOR1014⟩3.0.CO;2-K

Cohen, Y., Hausken, K., Bonfil, Y., Gutnick, M., & Levavi-Sivan, B. (2020).

Spexin and a novel cichlid-specific spexin paralog both inhibit fsh and lh through a specific galanin receptor (galr2b) in tilapia. Front Endocrinol (Lausanne), 11, 1–14.https://doi.org/10.3389/fendo.2020.00071 Deng, S. P., Chen, H. P., Zhai, Y., Jia, L. Y., Liu, J. Y., Wang, M., Jiang, D. N.,

Wu, T. L., Zhu, C. H., & Li, G. L. (2018). Molecular cloning, characterization and expression analysis of spexin in spotted scat (Scatophagus argus). Gen- eral and Comparative Endocrinology, 266, 60–66.https://doi.org/10.1016/

j.ygcen.2018.04.018

Dufour, S., Sebert, M.-E., Weltzien, F.-A., Rousseau, K., & Pasqualini, C.

(2010). Neuroendocrine control by dopamine of teleost reproduction.

Journal of Fish Biology, 76, 129–160.https://doi.org/10.1111/j.1095- 8649.2009.02499.x

Escobar, S., Servili, A., Espigares, F., Gueguen, M.-M., Brocal, I., Felip, A., Gómez, A., Carrillo, M., Zanuy, S., & Kah, O. (2013). Expression of kisspeptins and kiss receptors suggests a large range of functions for kisspeptin systems in the brain of the European sea bass. Plos One, 8, e70177.https://doi.org/10.1371/journal.pone.0070177

Golan, M., Zollinger, E., Zohar, Y., & Levavi-Sivan, B. (2015). Architecture of GnRH-gonadotrope-vasculature reveals a dual mode of gonadotropin regulation in fish. Endocrinology, 156, 4163–4173.https://doi.org/10.

1210/en.2015-1150

González-Martínez, D., Madigou, T., Zmora, N., Anglade, I., Zanuy, S., Zohar, Y., Elizur, A., Muñoz-Cueto, J. A., & Kah, O. (2001). Differential expression of three different prepro-GnRH (gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). Journal of Comparative Neurology, 429, 144–

155. https://doi.org/10.1002/1096-9861(20000101)429:1⟨144::AID- CNE11⟩3.0.CO;2-B

González-Martínez, D., Zmora, N., Mañanos, E., Saligaut, D., Zanuy, S., Zohar, Y., Elizur, A., Kah, O., & Muñoz-Cueto, J. A. (2002). Immunohistochemical localization of three different prepro-GnRHs in the brain and pituitary of the European sea bass (Dicentrarchus labrax) using antibodies to the cor- responding GnRH-associated peptides. Journal of Comparative Neurology, 446, 95–113.https://doi.org/10.1002/cne.10190

González-Martínez, D., Zmora, N., Zanuy, S., Sarasquete, C., Elizur, A., Kah, O., & Muñoz-Cueto, J. A. (2002). Developmental expression of three different prepro-GnRH (gonadotrophin-releasing hormone) messengers in the brain of the European sea bass (Dicentrarchus labrax). Journal of Chemical Neuroanatomy, 23, 255–67.https://doi.org/10.1016/s0891- 0618(02)00004-2

González-Martı ´nez, D., Zmora, N., Saligaut, D., Zanuy, S., Elizur, A., Kah, O., &

Muñoz-Cueto, J. A. (2004). New insights in developmental origins of dif- ferent GnRH (gonadotrophin-releasing hormone) systems in perciform fish: an immunohistochemical study in the European sea bass (Dicentrar- chus labrax). Journal of Chemical Neuroanatomy, 28, 1–15.https://doi.org/

10.1016/j.jchemneu.2004.05.001

Gu, L., Ma, Y., Gu, M., Zhang, Y., Yan, S., Li, N., Wang, Y., Ding, X., Yin, J., Fan, N., & Peng, Y. (2015). Spexin peptide is expressed in human endocrine and epithelial tissues and reduced after glucose load in type 2 diabetes.

Peptides, 71, 232–239.https://doi.org/10.1016/j.peptides.2015.07.018

Referencias

Documento similar