• No se han encontrado resultados

Bacteria community dynamics during citric waste composting and vermicomposting adding NFB (nitrogen fixing bacteria) and PSB (phosphate solubilizing bacteria) by DGGE

N/A
N/A
Protected

Academic year: 2020

Share "Bacteria community dynamics during citric waste composting and vermicomposting adding NFB (nitrogen fixing bacteria) and PSB (phosphate solubilizing bacteria) by DGGE"

Copied!
14
0
0

Texto completo

(1)

1 Bacteria community dynamics during citric waste composting and vermicomposting adding NFB (Nitrogen fixing bacteria) and PSB (phosphate solubilizing bacteria) by DGGE.

Martinez Garcia Sergio Alejandro, Dussan Jenny. Abstract:

This study evaluated the bacteria community dinamycs and chemical properties of three compost systems adding nitrogen fixing bacteria, phosphate solubizing bacteria and earthworm, using citric waste; with the aim of relate the variables associated to bacterial community and nutrient accumulation dynamics. Denaturant gradient gel electrophoresis DGGE, measurement of total organic carbon, total nitrogen, total phosphorus, C/N ratio, ammonium content, nitrate content, orthophosphate content, germination percentage and Principal components analysis were used in this investigation. The results showed that the accumulation of nutrients at the end of process is lower than initial .Also the tendency of nutrient accumulation is similar among systems. The bacteria diversity changes among systems and during the composting period. PCA analysis showed the variable correlations for each systems and the effects of earthworm and NFB-PSB. This investigation allowed the approach to know how chemical properties of compost relate to the bacteria community dinamics.

Key words: Composting, vermicomposting, nitrogen fixing, phosphate solubilizing, DGGE, Bacteria diversity.

1. Introduction:

Composting is an effective method for recycling organic matter such as vegetal and animal wastes from agricultural and industrial processes; in to stabilized, sanitized and agriculture useful product (Zhao, 2013). Especially for treatment of vegetal residues is widely used vermicomposting. This is the process where is added earthworm to the biodegradation process, which is undoubtly the most useful technique because it has many advantages: degradation is enhanced and faster, minimize production of phytotoxic compounds, generates more homogenous products and also modify diversity of bacteria communities that cause increase nutrient content (Hill, 2012). Due to part of the gut earthworm microbiota is released in to compost. Most of these bacteria are NFB (nitrogen fixing bacteria) and PSB (Phosphorus solubizing bacteria).

(2)

2 Nitrogen fixing bacteria accomplish an important role during composting; they up take molecular nitrogen, which is fixed as ammonium and then nitrificant bacteria, transform it in nitrate, which is the nitrogen assimilable source. Phosphorus solubizing bacteria is important too, these allow the assimilation of non-available phosphorus sources for plants; the mains mechanisms are releasing organic acids, chelation and ion exchange. (Gupta, 2012)

Previous studies have focused on the effect of vermicomposting according to nutrient content and microbial profile community. Vermicomposting products are rich in diverse microbial communities such as PGPB (plant growth promoting bacteria), antifungal bacteria and enzyme producing bacteria (Kui, 2013).However few provides information about how in vermicomposting addition of NFB and PSB could affect the microbial community dynamics, degradation process and chemical properties of compost.

According the view above, the main objective of this study was investigate the dynamic of bacterial communities in compost and vermicompost systems adding NFB and PSB of citric wastes. For this was used PCR-DGGE and chemical analysis to describe the microbial communities.

2. Materials and methods:

2.1 Compost materials and systems set up:

The experiment consists in three compost systems by triplicate (table 1), citric waste was obtained from vegetal wastes from Universidad de los Andes, earthworm Eisenia foetida was obtained from a mature compost system performed in field and NFB/PSB strains were obtained from CIMIC (Centro de investigaciones microbiologicas) of Andes University Colombia. Bacteria strains include B.polimixa, B.firmus, B.radicicola, B.suptilis and Bacillus sp.

Compost systems was carried out in plastic trays (36cmX28cmX9cm) which were placed randomly in matrix arrangement (6X2) under shadow in Universidad de los Andes greenhouse. In each tray was disposed 3kg of soil and 1kg of citric waste. For system 2 was added 400g of earthworm, system 3 was inoculated 440ml of solid nutrient culture media with 109 UFC; this inoculum is composed of six strains in same proportion, and in system 4

was added 400g of earthworm and 440ml of bacteria as described below.

During all process every 4 days each compost system was moisten with 50ml of water and soil was turned over for mixing and oxygenating compost.

(3)

3 Table 1. Shows the compounds of each compost system, the X represent the presence of each feature.

Control System 1 System 2 System 3

Soil X X X X

Citric waste X X X X

Earthworm X X

Bacteria l X X

2.2 Inoculum preparation:

Each strain was inoculated in tubes with 10ml nutrient broth and incubated for 48h at 30 C. Then using a cotton swap each culture was inoculated massively in metallic tray with 440ml of SPC agar. Trays were incubated during 48h at 30 C; after incubation agar of each one was divided in six pieces, which were placed in a plastic recipient for having six pieces of each strain that were mixed and added to system 2 and 3.

2.3 Compost system sampling:

During compost process were taken composed samples of 75 g randomly (25g per reply) from each system in five points: day 0, 13, 27, 48 and 62. Samples were used for downstream process and determinations bellow.

2.4 Monitoring cultivable bacteria:

From composed sample was used 50g , which were dissolved in 50ml of distillate water and shook during 1h by 160rpm at room temperature. After the soil settled was taken 100ul of suspension for doing serial dilutions until 10−5; each dilution were inoculated in SPC by duplicated and incubated for 24h at 30 C.

2.5 Chemical analysis:

Measurements of nutrient content and pH were conducted with a 1:100 solution of compost extract with distilled water with a ratio 1:1 (w/v) (10g of soil and 10ml of distilled water)on days 0,13,27,48 and 62. Determination of nitrate, phosphate and ammonium were performed using Phosphate test ®, Nitrate test ® and Ammonium test® by Merk employing Spectroquant Photometer NOVA 60 A. Using Ph Metro, Accument Basic AB15/15+ pH was determined. Total organic carbon was determined using MT-PRE-073 method, total nitrogen was determined by Kjeldahl method and total phosphorus was determined using MT-PRE-038 and SM 4500-P C method.

(4)

4 2.7 Germination essay:

A modification of Zucconi test were performed in days 13, 27, 48 and 62. Extracts of compost samples were prepared using distilled water with a ratio if 1:10 (w/v) which were shook by 1h at 160rpm and then centrifuged for 10 min at 4000rpm. For each compost system five petri plastic plates with double layer of absorbent paper and 10 seeds of lettuce inside them where dropped with 5ml of extract; control was dropped with 5ml of distilled water. After 5 days of incubation at 22 C with photoperiod, was counted the number of germinated seeds for calculating Germination percentage.

2.8 Microbial community analysis using PCR-DGGE:

DNA extraction was performed on days 0,13,27,48 and 62 with the kit PowerSoil® DNA Isolation Kit by MO BIO laboratories. PCR protocol was conducted using primers 975R

(5´CGAATTAAACCACATGCTC 3´) AND GC-352F

(5´CCCGCGCCCGCGCCCGGCCCGCCGCCCCCGCCCCCCTACGGGAGGCAGCAGT 3´) for amplification of V3V5 16s region.

DGGE was based on BioRad® protocol, with modification in Acrylamide, bis-acrylamide, formamid and urea solutions preparation.

2.9 Microbial statistical analysis: diversity and

The diversity index was used to quantitatively analyze the diversity of the microbial community in the compost, and was calculated using the Shannon diversity index: H´=- PilnPi=- (Ni/N)ln(Ni/N), where H´ represents the shannon-weaver index; Ni represents the number of i individuals; and N is the total quantity of DGGE bands (N= Ni). The correlation of viarables() was performed by a PCA (principal components analysis) using the software R project.

3. Results and discussion:

3.1 Compost chemical properties:

According to the accumulation of total organic carbon was higher at the last day of composting process. However, there was more content of total carbon in control system and the lower in system 1 because the inoculum of earthworm reduced organic carbon due to it was used for energetic demand and augmentation of biomass.

The total nitrogen content augmented at the last day in all compost system but it did not increase as expected. In average there was an augmentation of 0,2% of total nitrogen in all compost system Fig1. As known organic matter decomposition produces ammonium and

(5)

5 the NFB inoculum through nitrogen, fixing would increase the total amount of total nitrogen. Whether the nitrogen fixing was going on and the decomposition or organic matter was evident, maybe other factors in composting piles are influencing in the nitrogen metabolism. Probably the compost pile size was not big enough for ensure all processes would go properly, in other studies with bigger piles were able to get a higher accumulation of total organic matter (Hongtao, 2013).

Fig1. Total carbon, nitrogen and phosphorus for each compost system and C/N ratio before biodegradation process and last day.

Phosphorus accumulation presented a low percentage at the last day in all compost systems; this result was according to the expected. Because this element is the lest abundant in soils in comparison to nitrogen and carbon; and PSB which were added to system 2 and 3 only transformed the phosphorus into orthophosphate which is assimilable

0,00 0,20 0,40 0,60 0,80 1,00

Control System 1 System 2 Systema 3

Dr y ba se pe rcen tag e

Total nitrogen

Day 0 Day 62

0,00 20,00 40,00 60,00 80,00 100,00

Control System 1 System 2 System 3

Dr y ba se pe rcen tag e

C/N Ratio

Day 0 Day 62

0,00 20,00 40,00 60,00 80,00 100,00

Control System 1 System 2 System 3

Dr y ba se pe rcen tag e

Total carbon

Day 1 Day 62

0,00 0,10 0,20 0,30 0,40

Control System 1 System 2 System 3

Dr y ba se pe rcen tag e

Total phosphorus

(6)

6 by plants. Thus, the organic matter added to be composted was the source of the low phosphorus accumulated.

The C/N ratio of all compost systems was lower than expected. When the compost is mature the relation between organic carbon and total nitrogen has to be around 25:1 (Kui, 2013), but in the fig1 show that is around 40:1 and 70:1. This is consequence of the low accumulation of total nitrogen presented above.

Fig2. Ammonium, nitrate, o-phosphate concentration and pH for each compost system at day 0, 13, 26, 48 and 62

(7)

7 According to the ammonium concentration through the composting time; as shown in fig2. In all compost systems during the first 13 days increased ammonium concentration. It was higher in system 2 and 3; in system 2 were inoculated NFB and in system 3 were NFB and earthworm. Thus in system 3 there is an accumulative effect from bacteria and earthworm associated respectively to the fixed nitrogen in ammonium form and the enhanced biodegradation by worms. However, after the 13 day in all compost systems the ammonium concentration decreased even the amount of ammonium was lower than the initial presenting in average the same concentration. Thus, the pattern or behavior of ammonium concentration after the 13 day is similar in all compost systems.

The nitrate concentration during the degradation process does not present an apparent tendency, commonly in all systems there is an increasing in the concentration at day 13 but no as high as in ammonium fig2. After 13 day the system control, 1 and 3 present a tendency to decrease the concentration while the system 2 presents a higher concentration almost 2 fold than the other systems at the day 28. The system 2 only have the NFB inoculum thus the fixed nitrogen in form of ammonium was transformed into nitrate by nitrificant bacteria which are in the inoculum and in soil which allow the accumulation of nitrate. In the other systems (control, 1 and 3) is low the concentration probably because of in system control there is not inoculum and in system 1 and 3 there are earthworm therefore worm intestinal microbiota could affect the nitrification process or compete with the inoculum bacteria .

Fig3. Percentage of germinated seeds for each compost system at days 13, 26, 48 and 62. The purple slope correspond to the distilled water control.

(8)

8 According to the orthophosphate, content fig2 shows that in all compost systems there is a tendency to increase the concentration until day 28. During this period system, 2 and 3 had the highest accumulation because these systems have PSB inoculum then there is transformation of no assimilable phosphorus into orthophosphate. However after day 28 in all systems was decreased the concentration even to values lower than the initial. This could happen due to after this period there was not organic matter aviable to be decomposed by bacteria then it was not possible release organic acids to keep transformed the orthophosphate. The pH during all process was stable around a value of 6.

In general for ammonium, nitrate and orthophosphate content there is a tendency of increase the concentration at the beginning of the process but decreased at the end of it. This kind of behavior could be explained according to the size of the composting pile because in small piles is not possible that the termophilic phase takes place then the all typical processes of composting are not occurring properly affecting the nutrient accumulation (Castillo, 2013).

According to the Zucconi test results there was no production of phytotoxic compounds during the process and for neither compost system. This because the purple slope fig3 shows the germination percentage using distilled water. Using this control as the percentage of germinated seeds in absence of any phytotoxic compound. Then as shown, all systems had a germination percentage higher than 70% close to the distilled water control slope (Miyuki, 2005).

3.2 Compost bacteria diversity and cultivable bacteria abundance:

The abundance of cultivable bacteria during process for compost system control and 1 present a tendency which describes that during the 0 to 30 days there is an increasing of UFC/g, but after this period the cultivable bacteria title decreased. This tendency associated to the amount of organic matter. However, for system 2 and 3 there is not an apparent tendency. These systems have in common the inoculum of PSB and NFB, thus is possible that affects the bacterial communities during the process related to the bacteria abundance.

The DGGE bands fig4 show the band pattern of V3-V5 16s region of each strain used in the inoculum of system 2 and 3. The pattern is similar among strains and present many bands because all strains belong to Bacillus sp and this genera presents more than 13 copies of 16s gene.

(9)

9 Fig4. Cultivable bacteria title for each compost system at days 0, 13, 26,48 and 62.

Fig5. DGGE of each compost system with a denaturing gradient from 35% to 70%. The lanes labeled 2A,4A,2B,6,11,7B1,7B2 and 8A2 correspond to the all strains used in systems 2 and 3. Mix lane is the mixture of all strains. Lanes labeled 1-5 are the five days of sampling(day 0,13,26,48 and 62) .Red arrows indicate the conserved bands or OTU (operational taxonomic units) during the biodegradation process.

According to the bacteria community dynamics associated to the OTU (operational taxonomic units) during decomposing process. DGGE shows fig5 that for all systems there is the tendency to increase the OTU number between the days 13 and 26. This period corresponds to the higher degradation activity and organic matter amount. After this period, the OTU number decreased until reach the initial number. It is important to note

(10)

10 that the strains used in the inoculum were not identified and monitored during the process in each system DGGE, because the number of 16s gene copies complicated the comparison between the added bacteria and the native soil bacteria. Thus it was not possible stablish how the community varies or changed.

The diversity Shannon index fig6 shows that all systems tend to iniciate with low diversity index and and finish the process with a lower index than initial. Between the period of 13 and 48 days the diversity varies among systems and during the period without a clear tendency. This result is expected because each system have different conditions and factors that could affect in the bacteria diversity which let stablish how vary the bacteria community dynamic in terms of diversity. It is important to note that the system 1 had a high Shannon index at 13 day. This can be associated to the intestinal microbiota that was secreted by worms during the first composting days where there was more organic matter available(cita). For system 3 which had earthworm too, but the diversity was reduced due to the high abundance from the inoculum bacteria (Kui, 2013).

Fig6. Shannon index for each compost system at days 0,13,26,48 and 62.

3.3 Correlation among chemical proprieties and bacteria diversity variables during composting:

(11)

11 The correlation of variables measured in each system related to diversity and chemical properties is shown in the ggplot fig7.

Fig7. PCA performed for each compost system correlating the variables: Diversity(bacteria diversity), Ammonium(ammonium content), Nitrate(nitrate content),O_phosphate

(orthophosphate content)),pH and C_bacteria(cultivable bacteria content).

The PCA for control shows there is a positive correlation among all variables except for pH which did not have changes during the process. Also present a grouping among nutrient variables (ammonium, nitrate and orthophosphate content) and bacteria diversity and cultivable bacteria were grouped. Then in a compost system with only soil and organic

(12)

12 waste there is synergy among nutrient accumulation and variables related to bacteria diversity and abundance describing how is the dynamic of this compost system.

For system 1 there is a positive correlation among ammonium content, cultivable bacteria title and bacteria diversity in contrast with nitrate that have a negative correlation with these variables. Commonly for system 3 cultivable bacteria, bacteria diversity and ammonium content also have a positive correlation meaning that these variables have a synergic dynamic in both systems. Particularly system 1 and 3 were inoculated with earthworm therefore the presence of these organism could be causing the synergy of variables mentioned above. Finally for system 2 there is not a clear tendency related to the correlation and grouping of variables but the figure shows a low positive correlation between ammonium content and cultivable bacteria title and pH and bacteria diversity have a negative correlation with variables above.

4. Conclusions:

In conclusion during the composting process were not produced phytotoxic compounds for neither compost system. For the first 30 days of process for all systems the nutrients tend to increase but decrease after this period. The pH remained stable for every system and during compost period.

The bacteria diversity varied through the composting period and is different for each system but at day 0 and 62 the diversity is low. The worm addition and NFB-PSB had an effect over the bacteria diversity dynamic and nutrient content because is evident for system 1 and 3 the positive correlation and grouping variables different for each one in contrast with the control system.

(13)

13 5. References:

Blanka, M. (7 de Augost de 2014). Sciencedirect. Obtenido de Sciencedirect: http://ac.els-

cdn.com.ezproxy.uniandes.edu.co:8080/S0304389414006803/1-s2.0-

S0304389414006803-main.pdf?_tid=de4c2116-a05d-11e4-874f-00000aab0f02&acdnat=1421728755_55e79d829d0697e90047813a428e6e31 Castillo, J. M. (20 de July de 2013). Sciencedirect . Obtenido de Sciencedirect :

http://ac.els- cdn.com.ezproxy.uniandes.edu.co:8080/S0960852413011619/1-s2.0-

S0960852413011619-main.pdf?_tid=5d5713e0-a05d-11e4-b549-00000aacb361&acdnat=1421728538_c069d58f49540e08f0bbb1198b37414e Dogan, K. (24 de October de 2012). Sciencedirect . Obtenido de Sciencedirect :

http://ac.els- cdn.com.ezproxy.uniandes.edu.co:8080/S096483051200282X/1-s2.0-

S096483051200282X-main.pdf?_tid=df4d1f6c-a05c-11e4-9f20-00000aab0f26&acdnat=1421728327_2df8734b4222ea8bc301da0d0f0ff725 Gomez-Brandon, M. (31 de December de 2009). Sciencedirect. Obtenido de Sciencedirect:

http://ac.els-cdn.com.ezproxy.uniandes.edu.co:8080/S0929139310000041/1-s2.0-

S0929139310000041-main.pdf?_tid=c5e9d1a2-a05f-11e4-9f20-00000aab0f26&acdnat=1421729573_504f9c46c3e9fee8f29ac0dc2f982cac

Gupta, M. (17 de February de 2012). Science DIrect. Obtenido de Science DIrect: http://ac.els-

cdn.com.ezproxy.uniandes.edu.co:8080/S0944501312000201/1-s2.0-

S0944501312000201-main.pdf?_tid=81499766-4921-11e4-88fb-00000aab0f6b&acdnat=1412137078_1aa6453483df21fcd9591e707d40f9bd Hill, G. B. (28 de April de 2012). Science Direct. Obtenido de Science Direct:

http://ac.els- cdn.com.ezproxy.uniandes.edu.co:8080/S0956053X12001924/1-s2.0-

S0956053X12001924-main.pdf?_tid=3b25fafc-4923-11e4-b254-00000aab0f01&acdnat=1412137819_743082be037f7168c08f73dcd0cf596d

Hongtao, L. (16 de Janauary de 2013). Sciencedirect . Obtenido de Sciencedirect : http://ac.els-

cdn.com.ezproxy.uniandes.edu.co:8080/S0960852413001004/1-s2.0-

S0960852413001004-main.pdf?_tid=3cba713c-a05c-11e4-874f-00000aab0f02&acdnat=1421728054_310f5a6b2c03c2fae3d0b6c2afc24b95 Kui, H. (15 de June de 2013). Science direct. Obtenido de Science direct:

http://ac.els- cdn.com.ezproxy.uniandes.edu.co:8080/S0960852413015861/1-s2.0-

(14)

14 Miyuki, C. (9 de November de 2005). Sciencedirect . Obtenido de Sciencedirect :

http://ac.els- cdn.com.ezproxy.uniandes.edu.co:8080/S0960852405004682/1-s2.0-

S0960852405004682-main.pdf?_tid=8a15a1a0-a060-11e4-acac-00000aab0f01&acdnat=1421729902_c59b6655d8eb344b16f9ae091c43f196 Zhao, H.-y. (12 de June de 2013). Science dircect. Obtenido de Science dircect:

http://ac.els- cdn.com.ezproxy.uniandes.edu.co:8080/S2095311913604888/1-s2.0-

Referencias

Documento similar