Eucariotas. Slide 1 / 144. Slide 2 / 144. Slide 3 / 144. Enero Vocabulario

48  Download (0)

Full text

(1)

Este material está disponible gratuitamente en www.njctl.org y está pensado para el uso no comercial de estudiantes y profesores. No puede ser utilizado para cualquier propósito comercial sin el

consentimiento por escrito de sus propietarios. NJCTL mantiene su sitio web por la convicción de profesores que desean hacer disponible su trabajo para otros profesores, participar en una comunidad de aprendizaje profesional virtual, y /o permitir a padres, estudiantes y otras personas el acceso a los materiales de los cursos.

New Jersey Center for Teaching and Learning Iniciativa de Ciencia Progresiva

Click para ir al sitio web: www.njctl.org

Eucariotas

Enero 2014

www.njctl.org

Slide 2 / 144

Vocabulario

Haz clic en cada palabra a continuación para ir a la definición casquete 5´ uniones adherentes uniones alternativas unión celular vacuola central quitina cloroplasto cromatina

enzima modificadora de la cromatina vacuola contráctil citoesqueleto endocitosis sistema de endomembranas endosimbiosis eucariota exocitosis exon matriz extracelular vacuola alimentaria fungi unión en herradura glucoproteínas aparato de Golgi histonas enzima hidrolítica filamentos intermedios espacio intermembranoso intrón lumen lisosoma

Slide 3 / 144

(2)

Vocabulario

Haz clic en cada palabra a continuación para ir a la definición

matriz microfilamento microtúbulo mitocondria

procesamiento del ARNm envoltura nuclear poros nucleares nucleolo nucleosoma núcleo organela peroxisoma fagocitosis pinocitosis plasmodesmas cola poli A pre ARNm protista

endocitosis mediada por receptores empalme de ARN retículo endoplasmático rugoso retículo endoplasmático liso estroma unión estrecha factor de transcripción vesícula de transporte presión de turgencia

Eucariotas Temas de Unidad

·

La célula eucariota

·

El núcleo y la expresión génica

Click sobre el tema para ir a esta unidad

·

Otras organelas y estructuras celulares

·

El sistema de endomembranas

·

Conversión de energía en las organelas

Slide 5 / 144

La célula eucariota

Volver a la Tabla de Contenidos

Slide 6 / 144

(3)

Todas las células tienen 4 cosas en común.

· Están roedadas por una membrana plasmática (o membrana

celular).

· Contienen una sustancia semifluida llamada citosol/citoplasma. · Contienen estructuras llamadas cromosomas, que llevan los

genes de la célula.

· Tienen ribosomas, los cuales ensamblan los aminoácidos en las proteínas.

Todas las células

Hay 3 principales diferencias entre las células procariotas y eucariotas.

· Las células eucariotas son usualmente más grandes que las procariotas.

· Las células eucariotas tienen pequeños compartimentos llamadas organelas.

· La mayoría de los eucariotas (pero no todas) son organismos multicelulares.

Eucariotas vs. Procariotas

Slide 8 / 144

1 ¿Cual NO es una característica básica de todas las células?

A Todas las células están rodeadas por una membrana plasmática.

B Todas las células contienen una sustancia semi fluida llamada citoplasma.

C Todas las células contienen estructuras llamadas cromosomas,que están contenidas en el núcleo D Todas las células tienen

ribosomas.

Slide 9 / 144

(4)

Célula Animal (Eucariota)

Bacteria (Procariota)

Las células eucariotas son, en promedio, mucho más grandes que las células procariotas. El diámetro promedio de la mayoría de las células procariotas es entre 1 y 10μm.

Por el contrario, la mayoría de las células eucariotas tienen entre 5 a 100μm de diámetro.

Tamaño de la célula

Relación entre la Superficie y el Volumen

En el momento en que las células procariotas estaban evolucionando, había probablemente tamaños más diferentes de células. La eficiencia y la capacidad de sobrevivir depende de su relación entre la superficie y el volumen de una célula.

El volumen de la célula determina la cantidad de actividad química que se puede llevar a cabo por unidad de tiempo. La superficie de la célula determina la cantidad de sustancias que la célula puede tener en el medio ambiente y de la cantidad de residuos que puede liberar. A medida una célula crece en tamaño, su relación de superficie y volumen disminuye. Lleva a cabo las reacciones químicas más rápido, pero tiene más dificultades para obtener nutrientes y eliminar los residuos.

Slide 11 / 144

Sabemos que las células necesitan ser lo suficientemente pequeñas para que tengan una mayor superficie en relación al volumen, pero deben ser lo suficientemente grandes para llevar a cabo las reacciones químicas del metabolismo.

La más eficiente La menos eficiente

Cuanto más pequeña es la célula en volumen, mayor es su superficie comparada con su pequeño volumen interior.

Límites del tamaño de la célula

Cuanto más grande sea la célula, menor es su superficie comparada con su gran volumen interior.

Slide 12 / 144

(5)

Organelas

Para aumentar la eficiencia en la células más grandes, en los eucariotas

evolucionaron partes bacteriales conocidas como organelas

Las organelas subdividen la célula en compartimentos especializados.

Ellas tienen muchas funciones importantes en la célula. Algunas transportan residuos desde la membrana celular. Otros mantienen las moléculas necesarias para las reacciones químicas específicas situadas dentro de un determinado compartimiento, de manera que no necesitan difundirse largas distancias para ser útiles.

Las organelas que componen las células eucariotas son:

Organelas

· Núcleo · Lisosomas · Ribosomas · Peroxisomas · Mitocondria · Vacuolas

· Retículo endoplásmico liso · Retículo endoplásmico rugoso · Cloroplastos · Aparato de Golgi

Slide 14 / 144

Organismos Pluricelulares

Incluso con organelas, el tamaño de la célula se limita a

aproximadamente 1000μm3. Esto es por qué los organismos grandes deben consistir de muchas células pequeñas.

Slide 15 / 144

(6)

Diversdad de Eucariotas

Protistas: Las primeras células eucariotas. Los protistas son

eucariotas unicelulares. Van desde los protozoos hasta las algas.

Fungi: Estos organismos evolucionaron segundos en el tiempo

junto con las plantas. Los ejemplos incluyen los hongos, mohos y mildius.

Vegetales: Las plantas varían en el tipo de las primeras plantas

llamados musgos a las modernas plantas con flores.

Animales : Los animales fueron los últimos eucariotas en

evolucionar. Los animales van desde las esponjas antiguas y la hidra hasta los primates.

2 ¿Cuáles de las siguientes son células procariotas? A Plantas B Fungi C Bacteria D Animales

Slide 17 / 144

3 ¿Cómo resuelven los eucariotas el problema de la pequeña superficie en relación al volumen?

A permaneciendo del mismo tamaño que los procariotas B al convertirse en organismos multicelulares

C por compartimentar funciones en las organelas D no han resuelto el problema

Slide 18 / 144

(7)

4 Todos los eucariotas son pluricelulares

Verdadero

Falso

El Núcleo y la

Expresión Génica

Volver a la Tabla de Contenidos

Slide 20 / 144

Núcleo Gen Cromosoma Célula ADN

procariotas: pro: antes

karyon: kernel / semillas (núcleo)

El Núcleo

eucariota: eu: verdadero

karyon: kernel / semillas (núcleo))

Entonces: procariota = "antes del núcleo" y eucariota = "núcleo verdadero"

Lo que define a una célula eucariota es el núcleo. El núcleo de

la célula contiene el ADN y controla las actividades de la célula de dirigir la síntesis de proteínas a partir de ADN.

Slide 21 / 144

(8)

El núcleo de los átomos con protones y neutrones no es igual que el núcleo de las células.

El núcleo biológico está generalmente, pero no siempre, en el

centro de una célula y se refiere a veces como el "centro de control" de la célula.

El Núcleo Biológico

Núcleo Biológico

Dentro del Núcleo

El núcleo está rodeado por una estructura de doble membrana célular llamado la envoltura nuclear.

La envoltura nuclear tiene muchas aberturas llamadas poros nucleares. Los poros nucleares ayudan al núcleo a "comunicarse" con otras partes de la célula

Dentro del núcleo hay una región densa conocida como el nucleolo.

El nucléolo es donde se produce el ARNr y se ensamblan los ribosomas. Luego, salen a través de los poros nucleares

Slide 23 / 144

3 funciones principales del núcleo

1. Mantener y contener una copia de seguridad de todos los cromosomas (ADN) y transmitirlos a las células hijas en la división celular.

2. Ensamblar los ribosomas (específicamente en el nucleolo). 3. Copiar instrucciones del ADN al ARN (mediante la transcripción).

Slide 24 / 144

(9)

5 Las células que contienen un "núcleo verdadero" y otras organelas unidas a la membrana son _______________.

A archaea. B bacteria. C eucariotas. D procariotas.

6 ¿Dónde se encuentra el ADN de un eucariota ? A Núcleo B Nucleolo C Nucleoide D Mitocondria

Slide 26 / 144

7 ¿Cómo controla el núcleo las actividades de la célula? A Al producir ADN.

B Al dirigir la síntesis de proteínas

C Al permitir que salga el ADN del núcleo para producir proteínas.

D Mediante el envío de instrucciones a las mitocondrias.

Slide 27 / 144

(10)

Muchas células = Igual ADN

Todas las células en un eucariota multicelular contienen el mismo genoma. Cada célula tiene todos los genes necesarios para hacer todas las partes del organismo.

Las células se especializan por sólo expresar (activar) ciertos genes, una pequeña fracción de todos los genes en el genoma.

Estas células musculares y células cerebrales (neuronas) tienen el mismo ADN, pero están expresando genes diferentes, es por eso que su estructura y función son tan diferentes

Expresión Génica en Eucariotas

Panorama general

Transcripción Procesamiento de ARN

Traducción

Los eucariotas tienen cromosomas mucho más complejos que requieren múltiples niveles de regulación, incluyendo: · "desembalaje" de genes · factores de transcripción

· procesamiento del ARN

Slide 29 / 144

La transcripción y la traducción se produce tanto en eucariotas como en procariotas, pero hay pasos adicionales que ayudan a regular la expresión. Transcription Gen a. Doble cadena de ADN b. Sentidos de la cadena de ADN a. ARNm Transcripción Triplete Triplete Triplete

a. los genes son porciones de ADN que codifican para una proteína específica. b. los tripletes son secuencias de tres bases que cofican para secuencias de amino ácidos.

c. los codones de ARNm transcriptos son complementarios a los codones en los tripletes de ADN

Transcripción y Traducción

Slide 30 / 144

(11)

Expresión Génica en Procariotas

La expresión génica se regula con el uso de operones que activan y desactivan genes por intervalos dependiendo del entorno químico de la célula. Transcripción Traducción

8 Un triplete particular de bases en la cadena molde de ADN es la AGT. El codón correspondiente para el ARNm transcrito es

A AGT. B UGA. C TCA. D ACU. E UCA

Slide 32 / 144

9 Un codón

A consiste de dos nucleótidos.

B puede codificar para el mismo aminoácido como otro codón.

C se compone de regiones de aminoácidos discretos.

D cataliza la síntesis de ARN.

E se encuentra en todos los eucariotas, pero no en los procariotas.

Slide 33 / 144

(12)

10 Si el triplete CCC codifica para el aminoácido prolina en las bacterias, entonces, en las plantas el CCC debería codificar

A leucina. B valina. C cistina. D fenilalanina. E prolina.

Cromosomas

El ADN está configurado en

estructuras llamadas

cromosomas.

Recordemos que los procariotas tienen un cromosoma que es de cadena doble y circular.

El número de cromosomas que tiene un eucariota depende de la especie. Estos cromosomas se componen de un complejo de ADN fuertemente enrollado y proteínas asociadas llamadas

cromatina.

Especies Cromosomas N° de Helecho lengua de víbora 1440

Perro 78 Humano 46 Rata 42 Cerdo 38 Gato 38 Arroz 24 Moho mucilaginoso 12 Hormiga saltadora venenosa

2 para hembras, 1 para machos

2* *2 for females, 1 for

Fuente: : Wikipedia.com

Slide 35 / 144

Cromatina

El ADN está bien enrollado alrededor de proteínas llamadas

histonas, como un hilo

envuelto en un carrete. La combinación de ocho histonas y el ADN se llama nucleosoma

ADN enrollado alrededor de octámeros de histonas para formar nucleosomas

Nucleosomas compactados dentro de una fibra de cromatina

ADN

Slide 36 / 144

(13)

El rol de la cromatina en la expresión

génica

Cuando el ADN se empaqueta en la cromatina no es accesible a la ARN polimerasa entonces así no puede ocurrir la transcripción . El factor principal en la especialización de las células en organismos pluricelulares es que los genes son "desempaquetados" de la cromatina para estar expuestos a la ARN polimerasa.

Todas las secuencias de genes están expuestas a la ARN polimerasa

Algunos genes expuestos

Ningún gen expuesto ADN enrollado alrededor de octámeros de histonas para formar nucleosomas

Nucleosomas compactados dentro de una fibra de cromatina ADN

Enzimas modificadoras de la cromatina

Los genes que necesitan ser expresados se desenrollan de las histonas por enzimas modificadoras de cromatina con el fin de exponerse a sus secuencias de nucleótidos.

Los genes que son innecesarios para una célula en particular permanecerán empaquetados mientras que los más necesarios se descomprimirán.

Slide 38 / 144

11 En el cuerpo humano dos células no tienen exactamente el mismo ADN. Verdadero Falso

Slide 39 / 144

(14)

12 ¿Cuántas bobinas de ADN y proteínas crea un nucleosoma?

Transcripción

La transcripción del ADN en ARN se produce en el núcleo de la célula eucariota. La ARN polimerasa eucariótica necesita la ayuda de proteínas llamadas factores de transcripción para ayudar a regular cuando se

expresa un gen.

Si todos los factores de transcripción necesarios están presentes para un gen específico, entonces, el gen se puede expresar. Si falta alguno, la transcripción no se iniciará.

Puede haber miles de factores de transcripción en las células de un organismo, (3000) en los seres humanos. El tipo y el número de ellos presentes en el núcleo en un momento dado determinan qué genes se expresan.

Slide 41 / 144

Factores de Transcripción

Los factores de transcripción son proteínas que son capaces de unirse con el ADN. Cuando se unen a las zonas cerca de la región promotora del gen trabajan con la ARN polimerasa para iniciar la transcripción de ese gen.

Se producen en respuesta a señales desde el ambiente externo de la célula.

Estas proteínas hacen que la célula sea capaz de activar genes en respuesta a los estímulos externos. Esto es esencial para los eucariotas pluricelulares porque permite a las diferentes células del organismo comunicarse y responder a situaciones al mismo tiempo.

Slide 42 / 144

(15)

Señales externas

Receptor Vía metabólica que

produce un factor de transcripción específico en respuesta a la señal. El producto entra en el núcleo. Núcleo Señal externa activa la

proteína unida a la membrana (receptor) Señal Factor de Transcripción Célula

13 El primer paso en la expresión génica de los eucariotas es... A Transcripción

B Traducción

C Procesamiento del ARN D Desentrañar el gen

Slide 44 / 144

14 ¿Dónde ocurre la transcripción en células eucariotas? A núcleo B nucleoide C citoplasma D membrana celular

Slide 45 / 144

(16)

15 Una vez que el ADN se desenrolla de la cromatina, ¿cuál de los siguientes es necesario para comenzar la transcripción?

A ARN polimerasa B ribosoma C factores de transcripción D ambas A y C

16 Transcribe la siguiente secuencia de genes eucariotas: AACTGATTATGGGCT A AACTGATTATGGGCT B TTCACTAATACCCGA C UUGACUAAUACCCGA D UUCUGAUUAUGGGCU

Slide 47 / 144

Procesando el ARNm

Después de la transcripción, lo transcripto se conoce como pre-ARNm. Las enzimas en el núcleo modifican el pre-ARNm antes de que los mensajes genéticos se envíen al citoplasma. Esto se conoce

como procesamiento del mRNA.

Durante el procesamiento del mRNA, se alteran ambos extremos del pre-ARNm.

Algunas secuencias del interior del pre-ARNm pueden cortarse, y otras partes empalmarse.

Slide 48 / 144

(17)

Alteración de los extremos del ARNm

El extremo 5 'del pre-ARNm recibe una molécula conocida como un nucleótido (o 5') casquete.

Este casquete es una molécula de guanina modificada (la G en A, T, C, G) AUGCCCUUAGCC GAUGCCCUUAGCC pre-ARNm 5' casquete agregaddo

Alteración de los extremos del ARNm

El extremo 3 'del pre-ARNm crea una cola poli-A. Esta cola es una serie de nucleótidos de adenosina (A).

A A A A A A A A A A A A Moléculas de ARN formadas a partir de cadenas de nucleótidos

AUGCCCUUAGCC GAUGCCCUUAGCCAAAAAAAA pre-ARMm original cola añadida en el extremo 3'

Slide 50 / 144

Alteración de los extremos del ARNm

Las modificaciones de los extremos del pre-ARNm tienen varias funciones:

· Facilitan la exportación de ARNm desde el núcleo hasta el citoplasma.

· Protegen al ARNm de enzimas hidrolíticas una vez que está en el citoplasma.

· Ayudan a los ribosomas a unirse al ARNm para que puedan traducirse en una proteína.

Slide 51 / 144

(18)

Empalme del ARN

La mayoría de los genes eucariotas y sus transcripciones de ARN no codificante tienen largos tramos de nucleótidos que se encuentran entre las regiones de codificación. Estas regiones no codificantes se denominan secuencias intermedias, o intrones. Las otras regiones llamadas exones (porque se expresan con el

tiempo), suelen ser traducidos a secuencias de aminoácidos.

El empalme de ARN elimina intrones y une exones, creando una

molécula de ARNm con una secuencia de codificación continua.

Transcripción primaria intrones extirpados exones empalmados

17 ¿Cómo se llaman los segmentos codificantes de un segmento de ADN eucariota? A intrones B exones C codones D replicones

Slide 53 / 144

El procesamiento del ARNm

ARNm maduro ARN primario transcripto Genoma del ADN 7,700 pares de bases transcripción 1. adición del casquete 5 2. adición de la cola de la poli A Remoción de 5 intrones (empalme) Remoción de 2 intrones (empalme)

Este es un ejemplo de un pre-ARNm convirtiéndose en una transcripción final. Se exporta al citoplasma

Slide 54 / 144

(19)

Algunos genes pueden codificar en más de un tipo de polipéptido,

dependiendo de qué segmentos se tratan como exones durante el empalme de ARN.

El empalme alternativo permite que el número de proteínas

diferentes que un organismo pueda producir sea mucho mayor que su número de genes.

El empalme de ARN alternativo

El empalme de ARN alternativo

Secuencia de ADN

AAATTTCCCGGGAAATTTCCCGGG

Pre-ARNm

(Cap)-UUUAAAGGGCCCUUUAAAGGGCCC-(Tail)

Empalmes alternativos

(Casquete)-UUU AAA UUU AAA-(cola) ó (Casq)-GGC CCG GGC-(cola)

Polipéptido resultante (proteína)

Fen - Lis - Fen - Lis O Gli - Pro - Gli

El corte y el empalme alternativo puede cambiar dramáticamente la longitud y / o la secuencia de la cadena polipeptídica formada.

Slide 56 / 144

18 ¿Cuál de los siguientes ayuda a estabilizar el ARNm inhibiendo su degradación? A ARN polimerasa B ribosomas C casquete5' D cola poli-A E ambas C y D

Slide 57 / 144

(20)

19 Una unidad de transcripción que tiene 8000 nucleótidos de largo puede utilizar 1200 nucleótidos para hacer una proteína consistente en 400 aminoácidos. Esto se explica mejor por el hecho de que

A Muchos nucleótidos no codificantes están presentes en el ARNm.

B Hay redundancia y ambigüedad en el código genético. C Se necesitan muchos nucleótidos para codificar cada

aminoácido

D Los nucleótidos se desprenden y se pierden durante el proceso de transcripción.

20 Una vez transcripto, el pre-ARNm eucariota normalmente se somete a una alteración sustancial que incluye

A Eliminación de los intrones.

B Fusión en formas circulares conocidos como plásmidos

C Vinculación a las moléculas de histona.

D Unión con ribosomas.

E Fusión con otros ARNm recién transcriptos

Slide 59 / 144

21 Una mutación, ¿en cuál de las siguientes partes de un gen es probable que sea más perjudicial para una célula?

A Intrón B Exón

C Sería igualmente perjudicial.

Slide 60 / 144

(21)

22 El empalme de ARN alternativo

A Puede permitir la producción de proteínas de dramáticamente diferentes tamaños a partir de un único ARNm

B puede permitir la producción de proteínas de dramáticamente diferentes secuencias de aminoácidos a partir de un único ARNm.

C Ambos pueden ocurrir

Después de que la transcripción de ARNm ha finalizado y está completa y correcta, los poros de la envoltura nuclear permiten que pase al citoplasma donde puede ser traducido a proteínas por los ribosomas.

El poro nuclear es una estructura de proteína que controla el flujo de tráfico del núcleo. Cada poro nuclear se compone de cientos de proteínas individuales que aseguran sólo ARNm con los casquetes y las colas adecuadas para que puedean llegar hasta el citoplasma.

La entrada en el citoplasma

Slide 62 / 144

Las enzimas hidrolíticas en el citoplasma degradan la moléculas de ARNm. El tiempo que el ARNm sobrevive en el citoplasma se relaciona con la cantidad de proteína se hace de él. Más tiempo en el citoplasma significa más traducción por los ribosomas.

La longitud de la cola poli-A es uno de los muchos factores que determina el tiempo de supervivencia en el citoplasma. Cuanto más larga sea la cola, más larga es la supervivencia

Degradación del ARNm

Slide 63 / 144

(22)

23 ¿Cuál es la importancia de los poros nucleares?

A Permiten que el núcleo se comunique con otras partes de la célula B Permiten al ADN dejar el núcleo con el fin de dirigir la síntesis de proteínas. C Permiten al ARN dejar el núcleo con el fin de ser traducido en el citoplasma. D Permiten que las moléculas de ADN de cadena sencilla entren en el núcleo y se ensamblen para formar la doble

hélice.

Resumen de Expresión Génica

Regulación en eucariotas

· Los genes deben ser desempaquetados de la cromatina · Los factores de transcripción adecuadas deben estar

presentes

Ocurre la Transcripción

· Los casquetes y la cola deben ser añadidos al ARNm · El pre-ARNm debe ser editado (empalmada)

· Los poros nucleares permiten el paso al citoplasma · El ARNm entra en contacto con un ribosoma

Ocurre la traducción

· La proteína se utiliza dentro de la célula o se exporta al medio ambiente

Slide 65 / 144

El Sistema de

Endomembranas

Vover a la tabla de Contenidos

Slide 66 / 144

(23)

El sistema de Endomembranas

Varias organelas, algunas hechas en su mayoría por las membranas, forman una especie de cadena de montaje en la célula. Producen una proteína, entonces la procesan y envian a su destino final, ya sea dentro o fuera de la célula. Las organelas incluidas en este sistema incluyen el núcleo, el retículo endoplasmático rugoso y liso, el aparato de Golgi y los lisosomas

En conjunto, nos referimos a ellos como el sistema de endomembranas.

Nota: La membrana plasmática también se considera parte de este sistema

El sistema de Endomembranas

Retículo endoplasmático rugoso

Núcleo

Envoltura nuclear Poro nuclear Ribosomas Retículo endoplasmático liso Vesícula secretora Lisosoma Membrana plasmática Aparato de Golgi

Slide 68 / 144

Retículo Endoplasmático

envoltura nuclear Núcleo Retículo endoplasmático rugoso

Retículo endoplasmático liso

Ribosomas

Cuando el ARN sale del núcleo, entra en el retículo endoplasmático (RE). Esta organela es una serie de sacos y túbulos unidas a la membrana. Se continua con la membrana externa de la envoltura nuclear (retículo viene de la palabra latina para pequeña red).

Hay dos tipos de retículo endoplásmico: rugoso y liso.

Slide 69 / 144

(24)

Retículo Endoplasmático Rugoso

El Retículo Endoplasmático rugoso tiene ribosomas adosados a su membrana (por lo tanto un aspecto rugoso). Estos ribosomas sintetizan proteínas que se utilizarán en la membrana plasmática, secretado fuera de la célula o enviado a otra organela llamada lisosoma.

A medida que las proteínas son producidas por los ribosomas, entran en el lumen (apertura) del retículo endoplasmático, donde se doblan y se procesan.

Ribosomas

subunidades largas subunidades pequeñas Recordemos que los

ribosoma son de ARNr y proteínas. Aquí es donde se produce la traducción. Los ribosomas están formados por dos subunidades, una pequeña y una grande. Cada subunidad se compone de proteínas y ARNr. Las dos subunidades se unen cuando deben fabricarse las proteínas .

Slide 71 / 144

Ribosomas

Recuerda que los ribosomas hacen enlaces peptídicos entre los aminoácidos, en la traducción.

Las instrucciones para hacer ribosomas están en el ADN. Desde el ADN, se hace ARNr. Una parte del ARNr es estructural y otra parte del ARNr posee el código del ADN para fabricar las proteínas ribosomales del ARNm.

DNA ARNm Proteína transcripción traducción

Slide 72 / 144

(25)

24 ¿Dónde se fabrican las subunidades ribosomales en la célula? A Citoplasma B Núcleo C Nucleolo D En la membrana plasmática

25 ¿De qué consiste un ribosoma? A Proteínas y ADN B Proteínas y ARNr C Solo proteínas D Solo ADN

Slide 74 / 144

26 Enumera todas las partes del sistema de endomembranas. A Retículo endoplasmático rugoso y liso, Aparato de Golgi, lisosomas B Núcleo, retículo endoplasmático rugoso y liso, Apaarato de Golgi, lisosomas C núcleo, retículo endoplasmático rugoso y liso, Apararto de Golgi D Núcleo, retículo endoplasmático rugoso y liso, Apararto de Golgi, lisosomas, membrana plasmática

Slide 75 / 144

(26)

27 ¿Cuál de los siguientes está involucrado en la producción de proteínas?

A Retículo endoplasmático liso B Ribosomas C ADN D Membrana nuclear

Retículo Endoplasmático Liso

Este tipo de RE se llama liso, ya que carece de ribosomas en su superficie. (se ve liso en comparación con Re rugoso)

Hay una variedad de funciones de esta organela, que incluyen: · fabricar lípidos.

· procesar ciertos medicamentos y venenos absorbidos por la célula.

· almacenar los iones de calcio (por ejemplo, en las células musculares).

Nota: El hígado es un órgano que desintoxica las sustancias que se ponen en el cuerpo. Por lo tanto, las células hepáticas tienen enormes cantidades de RE liso.

Slide 77 / 144

Transporte de Proteínas

Una vez que se procesan las proteínas, a veces están ligados a ellas cadenas cortas de azúcares , que son conocidas como

glucoproteínas. Estas glucoproteínas sirven como "códigos

postales" que le dirán la proteína a dónde irá.

Cuando la molécula está lista para ser exportado fuera del RE, se empaqueta en una vesícula de transporte. Esta vesícula

está hecha de membranas del propio RE La vesícula de transporte se desplaza a otra orgnela conocida como el aparato de Golgi.

Slide 78 / 144

(27)

28 El sistema de endomembranas sirve para

A Transportar productos de las células a lugares dentro y fuera de la célula

B Ensamblar ADN

C Dar instrucciones a otras organelas D Crear vías para que viajen las organelas

29 ¿Qué determina si clasificamos el retículo endoplásmico como liso o rugoso?

A La presencia o ausencia de poros nucleares

B La presencia o ausencia de material genético C La presencia o ausencia de ribosomas D La presencia o ausencia de ADN

Slide 80 / 144

30 ¿En qué lugar de la célula se fabrican los lípidos?

A Núcleo B Ribosomas

C Retículo endoplasmático rugoso D Retículo endoplasmático liso

Slide 81 / 144

(28)

Aparato de Golgi

La principal función de esta organela es terminar, clasificar y enviar los productos de las células. Funciona como el departamento postal de la célula.

Estructuralmente, el aparato de Golgi está formado por bolsas aplanadoas apiladas ( parece una pila de pan de pita). Vesículas recientemente formadas Cisterna Vesícula de transporte entrante Cara cis Vesícula de transporte entrante Vesícula de transporte saliente

El aparato de Golgi se encuentra cerca de la membrana celular. El Golgi trabaja en estrecha colaboración con el RE de la célula. Recibe y modifica las sustancias fabricadas por el RE. Una vez que las sustancias se modifican, son enviadas a otras zonas de la célula.

Una diferencia clave entre el aparato de Golgi y el retículo endoplasmático es que las bolsas que comprenden el aparato de Golgi no están interconectadas.

Aparato de Golgi

Slide 83 / 144

El Aparato de Golgi y el RE

El Aparato de Golgi recibe vesículas de transporte que brotan fuera del RE y contienen proteínas. Toma las sustancias contenidas en estas vesículas y las modifica químicamente para marcarlas y clasificarlas en diferentes lotes en función de su destino.

Los productos terminados se envasan en nuevas vesículas de transporte que luego se moverán a los lisosomas, o se insertan en la membrana plasmática o son eliminadas de la célula si la proteína es una proteína secretora

Slide 84 / 144

(29)

31 Una diferencia entre el aparato de Golgi y el RE es que A El RE toma las vesículas del aparato de Golgi paral

transporte

B Las bolsas que hacen el aparato de Golgi no están interconectadas

C El aparato de Golgi tiene ribosomas, el RE no

D No hay ninguna diferencia, son parte de la misma organela

32 ¿Qué organela recibe y modifica las sustancias desde el retículo endoplásmico? A Nucleo B Ribosomas C Lisosomas D Aparato de Golgi

Slide 86 / 144

Lisosomas

Algunas proteínas del aparato de Golgi se transportan a los lisosomas. Como su nombre indica, un lisosoma es una organela que descompone otras sustancias.

(lisis: causar la destrucción) "alimento" Membrana plasmática Lisosoma Digestión Vacuola alimentaria Lisosoma engulliendo una organella dañada Aparato de Golgi RE rugoso inmersión de la partícula Vesícula transportadora ) conteniendo enzimas hidrolíticas inactivas) Se componen de enzimas hidrolíticas encerradas dentro de una membrana. Las enzimas hidrolíticas descomponen los polímeros en monómeros a través de la hidrólisis

Slide 87 / 144

(30)

Lisosomas

Los lisosomas pueden fusionarse con organelas que contienen alimentos llamadas vacuolas y luego las enzimas digieren la comida, liberando nutrientes en la célula. Los protistas hacen esto.

Las proteínas dañadas o que no sean necesarias pueden llegar a ser encerradas dentro de una vesícula

membranosa que luego se fusiona con un lisosoma. Las moléculas orgánicas en el proceso de

descomposición son recicladas y reutilizadas por la célula.

Un peroxisoma es un tipo específico de lisosoma que se forma y se descompone en peróxido de hidrógeno (H2O2), que es tóxico para las células.

En todas las células, se forma peróxido de hidrógeno constantemente (a partir de la combinación de hidrógeno y oxígeno como productos secundarios del metabolismo) y tiene que ser desglosado rápidamente.

Nota importante:

Los peroxisomas no son parte del sistema de endomembranas.

Peroxisomas

Slide 89 / 144

33 ¿Qué organela contiene enzimas hidrolíticas que degradan otras sustancias? A Retículo Endoplasmático B Aparato de Golgi C Lisosomas D Vacuolas

Slide 90 / 144

(31)

34 ¿Cuál NO es una función de los lisosomas?

A ayudar a la célula en la creación de ribosomas

B fusionándose con vacuolas para digerir los alimentos

C descomponiendo los polímeros en monómeros D reciclando partes desgastadas de la célula

Bicapa fosfolipídica Fosfolípidos Carbohidratos Glucoproteínas Proteína globular Proteína canal Colesterol Glucolípidos Proteína de superficie Proteína globular (integral)

Filamento del citoesqueleto Proteína periférica Proteína de alfa-hélice (proteína integral)

Recuerda la membrana plasmática es una bicapa fosfolípidica con proteínas y otras moléculas intercaladas

Membrana Plasmática

Algunas proteínas del aparato de Golgi se incrustan en la membrana. Otros son transportadas a través de la membrana para el medio ambiente externo.

Slide 92 / 144

Membrana Plasmática

· Permeabilidad Selectiva · Protección · Apoyo Estructural

Las 3 principales funciones de la membrana plasmática:

Slide 93 / 144

(32)

El transporte pasivo es

el movimiento de sustancias a partir de una zona de alta

concentración a un área de baja concentración y sin el requisito de un aporte de energía. Los tipos incluyen difusión, ósmosis y difusión facilitada.

Transporte de Membrana - Revisión

El transporte activo es el movimiento de sustancias a partir de

una zona de baja concentración a un área de alta concentración y requiere un aporte de energía

Transporte

pasivo Transporte Activo

(REQUIERE ENERGÍA)

35 ¿Cuál de las siguientes afirmaciones sobre el papel de los fosfolípidos en la formación de las membranas es la correcta?

A Son completamente insolubles en agua B Forman una sola hoja en el agua

C Forman una estructura en la que la porción hidrófoba se enfrenta hacia afuera

D Forman una estructura selectivamente permeable

Slide 95 / 144

36 El transporte activo mueve moléculas

A a favor de su gradiente de concentración sin el uso de energía

B a favor de su gradiente de concentración utilizando energía

C en contra de su gradiente de concentración sin el uso de energía

D en contra de su gradiente de concentración utilizando energía

Slide 96 / 144

(33)

37 ¿Cuál de los siguientes procesos incluye todos los demás?

A transporte pasivo B difusión facilitada

C difusión de un soluto a través de una membrana D ósmosis

Muchas proteínas producidas por la célula son demasiado grandes para pasar a través de la membrana, incluso utilizando un portador de proteínas o proteínas integrales. ¿Cómo salen estas macromoléculas de la célula?

Cuando la sustancia necesita otras maneras de entrar o salir de una célula, entrarán y saldrán por la fusión con la membrana celular.

Las Macromolécules y la

Membrana Plasmática

Proteínas integrales (monotópicas) Proteínas integrales (transmembrana) Proteínas periféricas

Existen varias funciones especiales de la membrana tal como que las sustancias más grandes entren y salgan de la célula.

Proteínas periféricas

Slide 98 / 144

Para excretar una macromolécula a partir de la célula, las vesículas que encierran las proteínas se fusionan con la membrana plasmática y las vesículas a continuación, se abren y vierten su contenido fuera de la célula. Este proceso se conoce como exocitosis. La vesícula se convertirá en parte de la membrana celular.

Exocytosis

Así es como las proteínas secretoras salen de la célula desde el aparato de Golgi . Esto es cierto para la insulina en el páncreas. Vesícula secretora Materiales para secreción Membrana plasmática Citoplasma Fluído extracelular

Exocitosis

Slide 99 / 144

(34)

La insulina es una hormona de proteína producida por ciertas células del páncreas que permite a las células obtener glucosa (azúcar) en la sangre.

La insulina es una proteína secretora hecha en el RE rugoso. Específicamente, se secreta fuera de las células del páncreas en el torrente sanguíneo.

Insulina - Una proteína secretora

Lo opuesto de la exocitosis es la endocitosis.

En este proceso, la célula absorbe macromoléculas u otras partículas mediante la formación de vesículas o vacuolas de su membrana plasmática.

Endocitosis

fluído extracelular citoplasma Vesícula

Así es como muchos protistas ingieren partículas de alimentos

Slide 101 / 144

3 tipos de endocitosis

Fagocitosis Pinocitosis Endocitosis mediada

por receptores Vesícula Citoplasma Fagosoma (vesícula alimentaria) Pseudópodo Cubierta proteínica Vesícula cubierta Hoyo revestido Sólido Membrana plasmática

Slide 102 / 144

(35)

Fagocitosis Es para tomar en partículas sólidas. ("fago" significa

comer)

Pinocitosis Es para tomar en líquidos. Sin embargo lo que la

célula quiere no es el propio líquido, pero las sustancias que se disuelven en el líquido. ("pino" significa beber)

Endocitosis mediada por receptor requiere la ayuda de una

capa de proteína y receptor en la membrana para atravesarla.

3 Tipos de Endocitosis

38 El proceso por el cual una célula ingiere grandes partículas sólidas, por lo tanto, se conoce como "comer célula".

A Pinocitosis B Fagocitosis C Exocitosis D Osmoregulación

Slide 104 / 144

39 Vesículas recubiertas de proteínas se mueven a través de la membrana plasmática a través de este proceso

A Fagocitosis B Transporte Activo

C Endocitosis mediada por receptor D Pinocitosis

Slide 105 / 144

(36)

40 Después de que una vesícula vacía su contenido fuera de una célula, la vesícula se convierte en parte de

A Aparato de Golgi B La membrana plasmática C Otra vesícula D El fluido extracelular

Conversión de

Energía en las

Organelas

Volver a la Tabla de Contenidos

Slide 107 / 144

Conversión de Energía en las Organelas

Los cloroplastos residen en las células vegetales y algunos

protistas y convierten la radiación solar en energía almacenada en la célula para su uso posterior.

Las mitocondrias residen en todas las células eucariotas y

convierten la energía química de la glucosa en ATP. Curiosamente, ambas cloroplastos y mitocondrias tienen su propio ADN, separada de la que se encuentra en el núcleo de la célula. También tienen una doble membrana celular.

Slide 108 / 144

(37)

cloroplasto eucariota

Membrana externa

Membrana interna Tilacoide

Cloroplastos

Estas organelas convierten la energía solar en energía química mediante la fotosíntesis. Los cloroplastos se dividen en tres grandes compartimentos mediante membranas internas · Tilacoides · Estroma · Espacio intermembranoso Estroma

Tilacoides

En los procariotas, los tilacoides son áreas altamente plegadas de las membranas .

En las eucariotas, se apilan en los cloroplastos. El fluido fuera de estas pilas de tilacoides se denomina estroma, que es donde se

lleva a cabo el ciclo de Calvin Recuerda que durante la fotosíntesis tienen lugar en el tilacoide las reacciones dependientes de la luz.

cloroplasto eucariota

Membrana externa

Membrana interna Tilacoide

Slide 110 / 144

Mitocondria

Las mitocondrias se refieren a veces como las "potencias" de la célula. Convierten la energía química (glucosa) en una forma más útil y regenerativa de energía química (ATP).

Las mitocondrias también se dividen como el cloroplasto. Sólo que tienen dos compartimentos en lugar de tres en el cloroplasto. · Matriz

· espacio intermembranoso

Espacio intermembrana Partículas de ATP sintasa Matriz Ribosomas Gránulos Membrana interna Membrana externa ADN Cresta

Slide 111 / 144

(38)

Recuerda que la respiración celular debe tener lugar cerca de una membrana de manera que pueda construir un gradiente de protones en un "espacio intermembrana" separado del resto de la célula. Por lo tanto, la membrana separaría el volumen interior, con un déficit de protones, del exterior, con un exceso. En los procariotas, el "espacio intermembranoso" está entre la membrana celular y la pared celular.

En eucariotas, esta membrana es el espacio intermembranoso de las mitocondrias entre la membrana interna y la membrana externa.

Mitocondria y Respiración

Las mitocondrias y los cloroplastos son diferentes de otras organelas eucariotas porque tienen su propio ADN, sus propios ribosomas, y tienen una doble membrana celular.

En 1970, Lynn Margulis publicó la "Teoría de la endosimbiosis" para explicar estos hechos. La teoría dice que las mitocondrias y los cloroplastos fueron una vez procariotas de vida libre que fueron tomados (o "comidos") por otro procariota.

La mitocondria era una bacteria que podría hacer su propio ATP. El cloroplasto era un bacteria que podría realizar la fotosíntesis.

La Evolución de Eucariotas

endo: dentro sim: juntos bio: vida sis: condición endosimbiosis = viviendo juntos, dentro de

Slide 113 / 144

Cuando llegaron tomados por otro procariota, arrastraron la membrana celular de un procariota alrededor de ellos, por lo que se formó una membrana celular doble. Esto ahora le permite al "nuevo" eucariota hacer su propio ATP o ser capaz de hacer la fotosíntesis y producir su propio alimento. De este modo evolucionaron los eucariotas.

Nota: El núcleo y flagelos también podrían tener las mismas raíces posibles aunque no están tan fuertemente apoyados con pruebas como las mitocondrias y los cloroplastos.

Teoría Endosimbiótica

Slide 114 / 144

(39)

La evidencia de la simbiosis

Tanto las mitocondrias como los cloroplastos tienen su propia maquinaria de síntesis de proteínas, y esto se asemeja más a las bacterias que a la encontrada en el citoplasma de los eucariotas.

Tanto las mitocondrias como los cloroplastos pueden surgir sólo de mitocondrias y cloroplastos pre-existentes. No pueden formarse en una célula que no cuenta con ellos.

Tanto las mitocondrias como los cloroplastos tienen su propio ADN y se asemejan al ADN bacterial y no al ADN encontrado en el núcleo. Tanto el genoma de los cloroplastos como el mitocondrial consisten de una única molécula circular de ADN, justamente como en los procariotas.

Dado que el ADN mitocondrial no está en el núcleo de la célula, sólo se transmitirá a través de la madre al niño, los animales, incluido tú, heredan tus mitocondrias solamente de su madre . Esto se debe a que el óvulo de nuestra madre contenía sus organelas. (Los espermatozoides del padre sólo contiene los cromosomas, ninguno de sus organelas generalmente). Todos nuestras organelas las hemos heredado de nuestras madres. El ADN mitocondrial es una manera de rastrear la herencia materna a través de una familia o a través de una especie. La "Eva Mitocondrial" es la primera hembra humana que dio origen a todos los seres humanos. En teoría, podemos rastrear todos los seres humanos de vuelta a ella a través de nuestro ADN mitocondrial.

La Eva mitocondrial

Slide 116 / 144

41 ¿Qué organela convierte la energía de los alimentos en energía química, que la célula puede utilizar?

A Núcleo B Cloroplasto C Mitocondria D Golgi

Slide 117 / 144

(40)

42 ¿Qué organela convierte la energía solar en energía química en las plantas y otros organismos fotosintéticos?

A Nucleo B Cloroplasto C Mitocondria D Golgi

43 ¿Cuál de los siguientes no es cierto de las mitocondrias y los cloroplastos?

A Están presentes en todas las células eucariotas B Tienen su propio ADN

C Tienen sus propios ribosomas

D Están rodeados por una doble membrana

Slide 119 / 144

44¿Cuál de los siguientes NO proporciona evidencia de la teoría de la endosimbiosis?

A Las mitocondrias y los cloroplastos ambos tienen su propio ADN.

B Las mitocondrias y cloroplastos tanto provienen de mitocondrias y cloroplastos pre-existentes.

C El ADN de las mitocondrias y cloroplastos se parece al ADN encontrado en los núcleos. D El ADN de las mitocondrias y cloroplastos se asemeja al de las bacterias

Slide 120 / 144

(41)

Otras organelas

y

estructura celular

Volver a la Tabla de Contenidos

Vacuolas

Las vacuolas son sacos membranosos y vienen en diferentes formas y tamaños y tienen una variedad de funciones Vacuola Central CÉLULA VEGETAL PROTISTA cilia Poro alimentario Vacuola alimentaria Vacuola contráctil Macronúcleo Micronúcleo Poro anal

Slide 122 / 144

Vacuolas Centrales

Las vacuolas centrales en las plantas almacenan agua. La

absorción de agua hace una célula vegetal más turgente, o haciendo más presión en el interior - lo que conduce a resistencia y rigidez.

Las vacuolas centrales que están llenas se harán cargo de la mayor parte del citoplasma y empujan literalmente las organelas hacia los lados de la célula También pueden almacenar los productos químicos esenciales, pigmentos y productos de desecho.

Slide 123 / 144

(42)

El aumento de la presión de turgencia proviene de la vacuola central, llena con agua. Esta presiona hacia afuera de la membrana celular que luego presiona hacia fuera de la pared celular

Presión de turgencia

La célula de la planta no va a explotar o perder su forma, como lo haría una célula animal en un ambiente hipotónico.

Cuando la presión de turgencia disminuye la célula está flácida y lánguida. Esto se asocia con marchitas, lechuga blanda, así también como flores mustias.

Vacuolas Contráctiles

Las vacuolas contráctiles se pueden encontrar en ciertos protistas unicelulares. Estos actúan como una bomba para expulsar el exceso de agua de la célula. Esto es especialmente útil para aquellos organismos que viven en un ambiente de agua dulce para evitar que la célula explote

Slide 125 / 144

Las vacuolas alimentarias

Las vacuolas alimentarias se encuentran principalmente en los protistas. Los protistas ingieren partículas de alimentos. Las partículas luego se fusionan con un lisosoma. El lisosoma contiene enzimas hidrolíticas que degradan los alimentos.

Paramecio teñido alimentándose mostrando vacuolas.

Slide 126 / 144

(43)

45 Una organela encontrada en células de plantas que almacena agua, así como otras sustancias importantes se denomina ___________. A Lisosoma B Vacuola Contráctil C Vacuola Central D Aparato de Golgi

46Las vacuolas alimentarias se encuentran principalmente en cual los organismos?

A Plantas B Animales C Protistas D Bacterias

Slide 128 / 144

Citoesqueleto

El citoesqueleto es una red de fibras en el citoplasma. Tres tipos de fibras colectivamente forman el citoesqueleto: · Microfilamentos · Filamentos intermedios · Microtubulos membrana plamática mitocondria retículo endoplasmático vesícula filamentos intermediarios microtúbulos microfilamentos

Estas fibras proporcionan un soporte estructural y también están implicados en diversos tipos de movimiento de las células y la motilidad.

Slide 129 / 144

(44)

47 Las células pueden ser descriptas como teniendo un citoesqueleto de las estructuras internas que contribuyen a la forma, la organización, y el movimiento de la célula. Todos los siguientes son parte del citoesqueleto, excepto

A la envoltura nuclear B microtúbulos. C microfilamentos. D filamentos intermedios.

48 ¿Cuál de los siguientes no es una función conocida del citoesqueleto?

A mantener un límite crítico en el tamaño de la célula

B proporcionar soporte mecánico a la célula C mantener la forma característica de la célula

D mantener las mitocondrias y otras organelas en su lugar dentro del citosol

Slide 131 / 144

Pared Celular

La pared celular es una capa externa además de la membrana plasmática, que se encuentra en hongos, algas, y células vegetales.

La composición de la pared celular varía entre las especies e incluso entre las células en el mismo individuo. Todas las paredes de las células tienen fibras de hidratos de carbono embebidas en una matriz rígida de proteínas y otros hidratos de carbono.

Las paredes de las células vegetales se hacen del polisacárido celulosa . Las paredes

celulares de los hongos están hechos del polisacárido quitina.

Slide 132 / 144

(45)

Matriz Extracelular

Las células de muchos animales multicelulares se rodean por una

matriz extracelular (MEC). La

MEC proporciona soporte

estructural a las células, además de proporcionar otras funciones tales como el anclaje, la curación celular, la separación de los tejidos entre sí y la regulación de la comunicación celular.

La MEC se compone principalmente de una malla entrelazada de proteínas e hidratos de carbono.

Superficies celulares y uniones

Las superficies celulares protegen, apoyan y unen a las células. Las células interactúan con su entorno y entre sí a través de sus superficies. Las células necesitan pasar el agua, nutrientes, hormonas, y muchas, muchas más sustancias entre sí. Las células adyacentes se comunican y pasan sustancias entre sí a través de las uniones celulares

Las células animales y vegetales tienen diferentes tipos de uniones celulares. Esto es principalmente porque las plantas tienen paredes celulares y las células animales no las tienen.

Slide 134 / 144

Plasmodesmos Pared celular Citoplasma Vacuola

Las células vegetales se apoyan en las paredes celulares rígidas hechas en gran parte de celulosa. Se conectan por plasmodesmos que son canales que les permitan compartir el agua, los alimentos y los mensajes químicos.

Uniones celular en las plantas

Slide 135 / 144

(46)

Las uniones estrechas Uniones adherentes Uniones de hendidura (Gap)

Uniones celulares en los animales

tight junctionUniones estrechas

Uniones estrechas

Uniones estrechas

Las uniones estrechas pueden unir las células juntas en láminas a prueba de fugas

Ejemplo: las células del revestimiento del estómago o cualquier revestimiento epitelial donde no sería bueno la fuga de sustancias .

Slide 137 / 144

Uniones adherentes

Membrana plasmática Actina Catenina Filamentos de actina a- adenina Vinculina

Las uniones adherentes sujetan las células juntas en láminas fuertes. Son algo a prueba de fugas. Ejemplo: La actina se mantiene unida en el músculo

Slide 138 / 144

(47)

Uniones de Comunicación (Gap)

Cerrado Abierto Membrana plasmática Espacio intercelular Canal hidrofílico Espacio de 2-4 nm

Las uniones Gap

permiten el flujo de sustancias de célula a célula. Son totalmente permeables. Son el equivalente al plasmodesmas en las plantas.

Ejemplo: importante en el desarrollo embrionario. Los nutrientes como los azúcares, aminoácidos, iones y otras moléculas pasan a travésde la unión.

49 ¿Qué tipo de unión se encuentra en las células vegetales? A Unión Gap B Plasmodesmos C Uniones estrechas D Uniones adherentes

Slide 140 / 144

50 ¿Qué tipo de unión permite el intercambio de materiales entre las células animales? A Unión Gap B Plasmodesmos C Unión estrecha D Unión adherente

Slide 141 / 144

(48)

Organelas de las células

vegetales vs. animales

Organelas en células animales y vegetales

Pared celular cloroplastos vacuola central membrana plasmática mitocondria

Solo

animales

Solo

vegetales

Ambas

RE rugoso RE liso lisosomas aparato de golgi ribosomas núcleo

Slide 143 / 144

51Las vacuolas alimentarias se encuentran principalmente en ¿cuáles organismos? A Plantas B Animales C Protistas D Bacterias

Slide 144 / 144

Figure

Updating...

References

Related subjects :