• No se han encontrado resultados

Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer.

N/A
N/A
Protected

Academic year: 2022

Share "Cell extracts and western blotting Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer."

Copied!
6
0
0

Texto completo

(1)

Cell extracts and western blotting

Cells were washed with ice-cold phosphate-buffered saline (PBS) and lysed with lysis buffer.1 Total cell extracts were separated by SDS-PAGE and transferred to nitrocellulose membranes, which were then incubated with primary antibodies as follows: anti-NFATc1 [7A6, Alexis Biochemicals ], NFATc3 [M75, Santa Cruz], Cox-2 [Alexis Biochemicals], PTB-associated splicing factor (PSF) (Sigma-Aldrich), α-tubulin (Sigma-Aldrich), myc (9E10), and NFATc2 antiserum 672.2 Membrane-bound antibody was detected with enhanced chemiluminescence (ECL) detection reagent (GE Healthcare Lifesciences).

RNA isolation and real-time PCR

Total RNA was extracted with Tripure (Roche), and 2 µg were reverse transcribed to cDNA with MMLV-RT (Invitrogen). Real-time PCR was carried out on 100 ng cDNA, using TaqMan probes (Applied Biosystems). PCR reactions were run in triplicate in an ABI Prism 7900 Sequence Detection System (Applied Biosystems). The Taqman probes used were COX2 (cat

#Hs00153133_m1), IL2 (cat #Hs00174117_m1) RCAN1.4 (custom assay hDSCR1.4-E4_5 cat#4331348), IL8 (cat# Hs00174103_m1), VEGF (cat#Hs00173626_m1), TGFB1 cat#

(Hs99999918_m1), ADAMTS1 (cat# Hs00199608_m1), KDR (cat# Hs00911700_m1). The following Taqman probes were used as endogenous controls: HMBS (cat#Hs00609293_g1), TBP (cat #Hs99999910_m1), TFRC (cat #4333770F) and 18S rRNA (cat#4319413E). Relative

quantification was calculated according to the manifacturer’s instructions. The results summarized in Table I were obtained using the Human Immune panel Taqman Low Density Array (Applied Biosystems).

Chromatin immunoprecipitation (ChIP)

Jurkat cells (40 × 106) were stimulated with 20 ng/ml PMA plus 1 μM calcium ionophore A23187 and 0.3 mM CaCl2 for 30 min, then fixed with 1% formaldehyde for 5 min at room temperature. Fixation was quenched by adding 0.125 M glycine and incubating for 10 min. Cells were washed three times with cold PBS and lysed in buffer 1 (50 mM Tris HCl pH 8, 2 mM EDTA, 0.1% NP40, and protein inhibitors) for 5 min at 4°C. Nuclear pellets were then lysed in buffer 2 (50 mM Tris HCl pH8, 5 mM EDTA, 1% SDS), and sonicated with a Bioruptor Sonicator (Diagenode). Chromatin was diluted 1:10 in 50 mM Tris HCl pH8, 5 mM EDTA, 0.5% NP40, 200 nM NaCl, and was pre-cleared by adding protein A or G sepharose beads (GE Healthcare Lifesciences) preblocked with sonicated salmon sperm DNA and BSA (30 min at 4°C); 1% of the sample was saved for use as an input control. For immunoprecipitation, fresh blocked beads were incubated overnight at 4°C with 6 μg rabbit IgG (Thermo Scientific PA1- 27414), anti–acetyl-histone H3 (Millipore), anti IgG1 (ebiosciences 16–4714), anti NFATc1 7A6 (Santa Cruz sc-7294) or anti NFATc3 F1 (Santa Cruz sc-8405). Sample extracts were added and incubation continued for 30 min. Beads were washed six times with washing buffer (20 mM Tris HCl pH8, 2 mM EDTA, 0.1% SDS, 1% NP40, and 500 nM NaCl) and eluted with 300 μl elution buffer (10 mM Tris HCl pH 7.5, 2 mM EDTA, 2% SDS). Reverse crosslinking was performed by incubation with 200 nM NaCl for 4 h at 65°C. After proteinase K treatment (Sigma-Aldrich p4850; 1 h at 50°C), DNA was extracted with phenol/chloroform, precipitated and resuspended in 50 µl water. One tenth of the final volume was analyzed by Syber Green real time PCR (AB).

The primers used were as follows :

hCox2 promoter fw (5′–3′): GAGGGAGGGATCAGACAGGAGAG hCox2 promoter rv (5′–3′): GACTGAAAACCAAGCCCATGTGACG

(2)

hIL2 promoter fw (5′–3′): CTGAGTTACTTTTGTATCCCCACCC hIL2 promoter rv (5′–3′): CATTGTGGCAGGAGTTGAGGTTAC Neg fw (5′–3′): ATGGTTGCCACTGGGGATCT

Neg rv (5′–3′): TGCCAAAGCCTAGGGGAAGA

Data are represented as the percentage enrichment over the input DNA and normalized to values obtained with IgG control antibodies.

REFERENCES

1. Salvado MD, Alfranca A, Escolano A, Haeggstrom JZ, Redondo JM. COX-2 limits prostanoid production in activated HUVECs and is a source of PGH2 for transcellular metabolism to PGE2 by tumor cells. Arterioscler Thromb Vasc Biol. 2009;29:1131–1137.

2. Rodriguez A, Roy J, Martinez-Martinez S, et al. A conserved docking surface on calcineurin mediates interaction with substrates and immunosuppressants. Mol Cell. 2009;33:616–626.

(3)

Figure S1. Infection and NFAT silencing of Jurkat cells

(A) Flow cytometry plots showing GFP expression in Jurkat cells infected with NFAT and control shRNAs (48 h post infection). (B) Quantification of NFATc1 and NFATc3 expression in KDSc, KD-c1 and KD-c3 Jurkat cells. The graphs show mean band intensities ± SD from four western blots. (C) Expression of exogenous NFATc1, NFATc3 and NFATc3R in KDSc and KD- c3 HEK cells transfected with pcDNA3.1 empty vector (−), pcDNA3.1NFATc1α-myc (c1), pcDNA3.1NFATc3-myc (c3) and pcDNA3.1NFATc3R-myc (c3R). The over-expressed proteins were detected with anti-myc antibody (9E10). Tubulin was monitored as a loading control.

(4)

Figure S2. NFAT silencing in blast cells and role of Cox2 in primary T cell activation (A) The flow cytometry plot shows GFP expression in infected blast cells (48 h post infection).

Western blots show NFATc1 and NFATc3 silencing in infected blast cells. PSF expression was monitored as a loading control. Charts show band-intensity quantification of NFATc1 and c3 relative to PSF expression. (B) Proliferation of primary CD4+ and CD8+ T cells in response to stimulation with anti-CD3 plus anti-CD28 (2 µg/ml each) for 6 days. Cells were pre-treated as indicated with Etoricoxib (10 µM). Assays were performed as in Fig 3 E. (C) Kinetics of cytokine secretion by primary CD4+ and CD8+ T cells in response to anti-CD3 plus anti-CD28 stimulation. Cells were pre-treated with Etoricoxib as indicated. The data reported correspond to supernatants of the experiment showed in B. The results were confirmed in three independent experiments.

(5)

Figure S3. Infection and NFAT knockdown in endothelial cells

The flow cytometry plot shows GFP expression in infected HUVEC (48 h post infection).

Western blots show NFATc1 and NFATc3 silencing in infected HUVEC. PSF was monitored as loading control. Charts show band-intensity quantification of NFATc1 and c3 relative to PSF expression.

(6)

Figure S4. Additional targets of NFATc3 and effect of Etoricoxib and NFATc1 knockdown on endothelial migration.

(A) Knockdown of NFATc3 inhibits endothelial cell migration at a similar potency to the Cox-2 inhibitor Etoricoxib. HUVEC were infected with KDSc or KD-c3, and where indicated KDSc HUVEC were treated for 30 min with 10 μM Etoricoxib. Cells were analyzed by in vitro scratch wound healing assay performed as in (Fig 5A), and the migrated area was measured 14 h after stimulation with VEGF. (B) qPCR analysis of mRNA expression of target genes (Rcan1.4; Il8;

Adamts1; Vegf; Tgfβ; Kdr) in KDSc and KD-c3 HUVEC stimulated with VEGF for 2h. (C) Wound healing assay performed as in Fig 5B, comparing KDSc and KD-c1 HUVEC. All graphs are means± SD of three separate experiments. ns=not significant; **p<0.01, and ***p< 0.001 vs.

KDSc in all cases.

Referencias

Documento similar

CROSSTALK BETWEEN INNATE AND ADAPTIVE IMMUNITY IN TELEOST FISH: THE ROLE OF DENDRITIC CELLS AND B CELL

Figure 1: Doxorubicin activates the NF-кB and enhances the expression of migration, cell adhesion and metastasis related NF-кB target genes in MDA-MB-231 breast cancer cells..

Importantly, silencing of endogenous HIF2 a resulted in a marked repression of mTORC1 activity and SLC7A5 expression in 786-O VHL-deficient cells when cells were cultured

SECTION 3 - The role of RINGO proteins in the brain 123 RingoA mRNA is expressed in neural stem cells and proliferating progenitor cells 123 Analysis of neural stem cells

Because immune cells in the nasal mucosa can control and regulate viral infections via killing infected res- piratory epithelial cells, low numbers of NK and or T cells in

± SEM, n=6) of healthy cells. C) Control and SCaMC-1-KD COS-7 and 143B cells are equally sensitive to 1 μM staurosporine induced cell death. Cells were treated with the drug for 0,

Late-G 1 PI3K inhibition reduced cell cycle entry in control cells and to a lesser extent in cells over- expressing WT c-Myc; c-Myc T58A expression, however, largely restored cell

Splicing in SDG24 resulted in different spatial expression patterns, being the SDG24.1 specifically expressed in root cells, and to the nucleus of the central cell in the mature