16S rDNA

Top PDF 16S rDNA:

Communities of Actynomicetes fungy in three vegetation types of the Colombian Amazon: abundance, morphotypes and the 16s rDNA gene

Communities of Actynomicetes fungy in three vegetation types of the Colombian Amazon: abundance, morphotypes and the 16s rDNA gene

Abstract: Communities of Actynomicetes fungy in three vegetation types of the Colombian Amazon: abundance, morphotypes and the 16s rDNA gene. Among soil microorganisms, Actinomycetes play an important role in the sustainability of natural and agricultural systems: decomposition of organic matter; deg- radation of recalcitrant compounds like lignin; nitrogen fixation; degradation of agricultural chemicals and biological control in plants and animals. We evaluated their diversity in soils under three different vegetation covers (pasture, tropical primary forest and stubble) at two depths in the Southern Colombian Amazon border. We collected five replicates per vegetation type (in each, three samples at 0-20cm and three at 20-30cm; for a total of 30 samples). Abundance and phenotypic diversity were determined by plate counting. Genomic DNA was extracted from the isolates: the 16s rDNA gene was amplified with specific primers, and its genetic diversity was estimated by means of an amplified restriction analysis (ARDRA). Actynomicetes abundance varied with vegetation and depth, possibly reflecting presence of earthworms, macro-fauna and physico-chemical character- istics associated to fertility, as well as organic matter, total bases, and optimal capacity to cationic interchange. Primary forests had the highest diversity. Sixteen morpho-types (six genera) were identified; Streptomyces was the most abundant everywhere. The heterogeneity of ARDRA patterns prevented species identification because of the intra-species variability in sequences of 16s rDNA operons. This community is a biological indicator of landscape alteration and could include new bio-active compounds of pharmaceutical interest. Rev. Biol. Trop. 57 (4): 1119-1139. Epub 2009 December 01.

22 Lee mas

Amplified 16S Ribosomal DNA Restriction Analysis for Identification of Avibacterium paragallinarum

Amplified 16S Ribosomal DNA Restriction Analysis for Identification of Avibacterium paragallinarum

Restriction enzyme analysis. Approximately 1 m g of amplified DNA was digested with 4 U of DdeI, RsaI, and EcoRI (Invitrogen Life Tech- nologies) in a volume of 25 m l at the optimal conditions as described by the manufacturer. The Web cutter program (http://Tools.NEB.com// NEBcutter2/index.PHP; New England Biolabs, Ipswich, MA) was used to select endonucleases with the highest number of cutting points inside the 16S rDNA. The DdeI and RsaI enzymes were selected because they had several cutting points in 16S ribosomal DNA, gave unique restriction patterns for each species, and demonstrate DNA fragments greater than 100 bp, which allows for easier visualization and interpretation. The EcoRI enzyme was also used because there was one cutting point in the A. paragallinarum 16S rDNA and none in O. rhinotracheale.

5 Lee mas

Estructura genético-poblacional de Argopecten purpuratus (Lamarck 1819) “concha de abanico” de la Macroregión Norte-Centro del mar

Estructura genético-poblacional de Argopecten purpuratus (Lamarck 1819) “concha de abanico” de la Macroregión Norte-Centro del mar

Argopecten purpuratus “Concha de abanico” es un molusco bivalvo de la familia de los Pectínidos, con gran importancia para el Perú, debido a que posee el más alto nivel de exportación en cuanto a producción acuícola se refiere. Sin embargo, a pesar de su gran importancia, existen muy pocos estudios sobre la genética poblacional de esta especie en el litoral peruano. Por esta razón, el objetivo de este trabajo de investigación, fue estudiar la estructura genético poblacional de esta especie en la Macroregión Norte-Centro del mar peruano, empleando el gen mitocondrial 16S rDNA. Para ello, 127 organismos fueron extraídos mediante buceo autónomo de ocho localidades (entre bahías e islas) de la zona de estudio y, una región parcial de 679pb del gen 16S rDNA se logró secuenciar exitosamente. En total, se detectaron 34 sitios de variación nucleotídica con predominancia de transiciones, así como 34 haplotipos. Cuatro haplotipos fueron comunes para todas las poblaciones. Así mismo, se determinaron los índices de diversidad genética tales como diversidad nucleotídica y haplotípica, con valores de 0.0032 y 0.8069 en la población general respectivamente, indicando indicios de un proceso de expansión poblacional. Además, se generó un minimum spanning network, el cual presentó una estructura tipo estrella, típico de especies con baja estructura poblacional. Estos resultados se corroboraron con un análisis de varianza molecular (AMOVA), así como de índice de fijación F ST , indicando que los niveles

69 Lee mas

Diversidad genética y filogenia de bacterias pertenecientes al género Bacillus, tolerantes a cromo, asociadas al mezquite (Prosopis Laevigata)

Diversidad genética y filogenia de bacterias pertenecientes al género Bacillus, tolerantes a cromo, asociadas al mezquite (Prosopis Laevigata)

En la actualidad el estudio de la secuencia del gen 16S rDNA y las características fenotípicas no son suficientes para diferenciar las bacterias dentro de este género debido a su alta conservación. Para determinar las afiliaciones taxonómicas de las especies se han utilizado técnicas moleculares para evaluar la diversidad bacteriana basándose en la identificación del genoma (Porwal, 2009), el enfoque de Identidad de Nucleótido Promedio (ANI) (Kim et., al 2017; Konstantinidis y Tiedje, 2005). La filogenia basada en la distancia del genoma, basado en la secuencia de todo el genoma (GBDP), el calculador de distancia genoma- genoma in sílico (isDDH) (Colston et al., 2014), el análisis de secuencia multi-locus (nMLSA), gyrB y plcR , polimorfismo de Longitud de Fragmento Ampliado (AFLP), son estándares de oro para la definición de la especie procariota, sin embargo estos enfoques aun no son capaces de llegar a una conclusión acorde y convincente, por lo tanto, hasta ahora, las relaciones filogenéticas y taxonómicas de Bacillus aún se encuentran bajo discusión intensa y controvertida (Liu et al., 2015).

44 Lee mas

Methods for the study of microbial communities in fermented foods

Methods for the study of microbial communities in fermented foods

ABSTRACT. The importance of ecological concepts to understand the presence and growth of microorganisms in foods is presently recognized. The production of fermented foods under controlled conditions and its safety assurance depend on the knowledge and control of their microbiota. Traditional fermented foods are obtained by natural fermentations (in which no inoculum is added) and con- tain complex microbiotas, which are difficult to describe through the use of traditional microbiological methods. The microbial structure of these foods can be studied with different approaches. One of them consists on the typification of isolated microorganisms with meth- ods based on DNA as RFLP, ribotyping, AFLP, ARDRA and RAPD. In order to detect non-culturable or not yet cultured microorganisms, nucleic acids are directly extracted from foods and the microbial di- versity is determined from them. Examples of these techniques are the construction of 16S rDNA clone libraries and fingerprinting techniques, such as DGGE and TGGE. Recent advances on the ap- plication of these techniques on the study of fermented foods are presented.

12 Lee mas

Microbial communities: Different models and a certain methodological unityDiversity of endosymbiotic bacteria of insects belonging to the Triatominae subfamilyComparative analysis on the role of diverse microbial species in the creation of

Microbial communities: Different models and a certain methodological unityDiversity of endosymbiotic bacteria of insects belonging to the Triatominae subfamilyComparative analysis on the role of diverse microbial species in the creation of

Estudios de consorcios utilizando esta metodología, han permitido identificar exitosamente los miembros predomi- nantes de asociaciones de bacterias hidrocarbonoclastas, de reactores de lecho fluidizado anaerobio que remueven 2,4,6-Triclorofenol (Fig. 2A); de reactores de ambientes me- tanogénicos que remueven percloroetileno de efluentes contaminados; y de consorcios de gránulos del probiótico Kéfir (Fig. 3A). En el caso de la comunidad que remueve eficientemente clorofenoles (Fig. 2B), las biopartículas con soporte de carbón activado, exhibieron una notable diversi- dad de bacterias al microscopio electrónico de barrido (Fig. 2D), que se mantuvo estable a lo largo del estudio de acuer- do al análisis tipo DGGE (Fig. 2C). Las bacterias identifica- das pertenecen a los géneros Dehalobacter sp., Syntropho- botulus sp., Propionobacterium sp. y Methanosaeta sp., entre otros. El consorcio microbiano residente de los granos de Kéfir, mostró también una diversidad morfológica unice- lular interesante tanto a la observación microscópica de luz visible de tinciones de Gram (Fig. 3B), como a la observa- ción al microscopio electrónico de barrido (Fig. 3D). El aná- lisis comparativo tipo DGGE de varias cepas de gránulos, reveló que su composición es muy semejante (Fig. 3C) y la identificación ha revelado la presencia de Saccharomyces sp., y de Lactobacillus sp. La experiencia práctica de carac- terización de comunidades microbianas aplicando nuestro método basado en la genotipificación del 16S rDNA, mues- tra su conveniencia para caracterizar la estructura de la co- munidad e identificar los microorganismos presentes. Figura 1. Guía práctica para el estudio de la estructura y dinámica de una

15 Lee mas

Biodiversidad y endemismo de los caracoles terrestres Megalobulimus y Systrophia en la Amazonia occidental.

Biodiversidad y endemismo de los caracoles terrestres Megalobulimus y Systrophia en la Amazonia occidental.

In this work we performed a biogeographic study of two genera of Amazonian land snails, Megalobulimus (Strophocheilidae) and Systrophia (Scolodontidae). We used samples from different regions of the Peruvian Amazon, as well as bibliographic information. We analyzed both nuclear (5.8S-ITS2-28S rRNA) and mitochondrial (16S rRNA) genes to reconstruct phylogenies and obtain hypotheses concerning the evolutionary relationships among Amazonian genera and other species with global distribution. The nuclear phylogeny allowed us to de- termine the evolutionary position of both genera, and the mitochondrial phylogeny permitted the differentiation of species at the intrageneric level. We found that Megalobulimus clustered with the non-achatinoid clade within Stylommatophora, as expected, but its relationship to family Acavidae could not be demonstrated. Systrophia did not cluster with any of the two established clades, but formed a basal one within Stylommatophora. The mitochondrial gene 16S rRNA allowed us to differentiate Megalobulimus species, and performed well for DNA barcoding of these edible snails. Biogeographical analysis revealed several endemic species in the Peruvian Amazon within both genera, highlighting the Chanchamayo and Inambari biogeographic units.

16 Lee mas

microbiologia y biologia molecular

microbiologia y biologia molecular

Sin despreciar la importancia de los cultivos, los métodos moleculares son indispensables en el estudio de la función de los microorganismos en el suelo. Mediante métodos moleculares se pueden analizar genes funcionales clave en procesos importantes en suelo tales como la desnitrificación, nitrificación, fijación de nitrógeno, oxidación de metano (Rösch, et al., 2002; Jaatinen, et al., 2004; Okano, et al., 2004). De manera análoga a los estudios de diversidad de 16S rRNA, se puede determinar la diversidad de estos genes en diferentes suelos o diferentes condiciones e incluso proceder a su cuantificación. Mucho más importante es determinar si esos genes se están expresando, lo cual está directamente ligado a la participación del microorganismo que los posee en el proceso estudiado. La expresión de genes funcionales mediante la detección de RNA mensajero (mRNA) se ha realizado con éxito en sistemas complejos como suelos (Sessitsch, et al., 2002; Bürgmann, et al., 2003). Las nuevas técnicas de hibridación en microchips para la detección de genes funcionales permitirán realizar estudios mucho más complejos en los próximos años (Cook, et al., 2003).

11 Lee mas

Caracterización molecular de los microbios patógenos oportunistas asociados a infecciones pulmonares en niños con fibrosis quística en el Perú, 2014-2015

Caracterización molecular de los microbios patógenos oportunistas asociados a infecciones pulmonares en niños con fibrosis quística en el Perú, 2014-2015

In patients affected by cystic fibrosis (CF), morbidity and mortality are mainly associated with chronic microbial infections of the lower respiratory tract caused by opportunistic pathogens. In this study the cultivable bacterial communities were characterized from sputum samples from 21 Peruvian pediatric patients with CF registered in the National Hospital Edgardo Rebagliati Martins (ESSALUD) and National Institute of Child Health (INSN). Bacteria were grown and isolated by standard microbiological culture techniques, while the characterization of inbred strains was performed by sequencing the 16S rRNA gene and analysis by MALDI TOF and MALDI TOF/TOF mass spectrometry. It was possible to isolate 127 strains which were differentiated into 35 species by sequencing the 16SARNr gene. The predominant pathogens were Pseudomonas aeruginosa (31.5%), Staphylococcus aureus (12.6%), Klebsiela oxytoca (3.1%), and other rare species as Acrhomobacter xylosoxidans (0.8%) and Paenibacillus sp. (0.8%). MALDI TOF mass spectrometry analysis allowed us to get mass spectra representative of each isolated species of Peruvian patient, also being achieved to recover and characterise protein sequences of the most common species by MALDI TOF/TOF. Our data show that microorganisms colonizing the lower airways of CF patients are part of a complex microbial ecosystem. The characterization of these microorganisms is an important step to understand the progression of the disease. With the results obtained by the analysis 16S rRNA, and MALDI TOF we achieved obtain specific spectra of bacteria of Peruvian patients which will serve to build a database of native pathogenic strains for future studies and, on the other hand, identify by MALDI TOF/TOF technique a wide diversity of proteins which will allow us to establish the relationship between bacterial proteome and its pathogenicity. Finally, knowing bacterial diversity would lead to improvement in the antibiotic therapy and increases the life expectancy of CF patients Peruvian.

67 Lee mas

Caracterización de bacterias utilizables en procesos de biorremediación de aguas

Caracterización de bacterias utilizables en procesos de biorremediación de aguas

Mediante la secuenciación Illumina del gen 16S ARNr bacteriano, se caracterizó el microbioma total de dos plantas de tratamiento biológico de aguas de la provincia de Santa Fe, que actualmente funcionan eficientemente removiendo Mn. Los resultados obtenidos permitieron diseñar estrategias de selección y aislamiento de MOB en medios de cultivo específicos. Se obtuvieron 202 aislados bacterianos putativos oxidantes de Mn, los cuales fueron identificados molecularmente. Se determinó que un gran número de MOB eran previamente conocidos y varios de los aislamientos caracterizados nunca antes se habían informado como MOB. Un total de 23 MOB fueron caracterizadas en función de su capacidad oxidante de Mn y formadora de biofilms. Cinco de tales MOB fueron clasificadas como las mejores. Considerando como objetivo final el uso de estas cepas en plantas de tratamientos de aguas a fin de optimizar la remoción biológica de Mn, estas cinco MOB fueron estudiadas luego en función de su capacidad de oxidación de Mn frente a diferentes condiciones: cambios de temperaturas y presencia de metales inhibidores. La cepa MOB-181, perteneciente al género Pseudomonas, resultó ser la bacteria más versátil, con capacidad de oxidar en todas las condiciones ensayadas. Esta MOB además fue capaz de oxidar Mn(II) de un agua subterránea natural cuando estuvo inmovilizada sobre arena y no inhibió el crecimiento de otras MOB cuando se crecieron juntas.

169 Lee mas

Identificación molecular por PCR y nested PCR de rickettsias en Crassostrea gigas.

Identificación molecular por PCR y nested PCR de rickettsias en Crassostrea gigas.

caracterizar a miembros de la familia rickettsiae. Al respecto Andree, et al. (2000), utilizando secuencias de Anaplasma marginales, Ehrlichia bovis, Wolbachia pipientis; así como rickettsias reportadas en especies de salmónidos y en langostino, diseñaron varios juegos de primers, entre ellos, RA-5,1 (GTTGAACGTGCCTTCAGTTTAC) y RA 3,6 (ACTTGGACTCATTCAAAAGCGGA), que les permitió detectar la presencia de un procariota similar a una rickettsia, en ejemplares de Haliotis sp. con sintomatología del síndrome de marchitamiento. Adicionalmente Friedman, et al. (2000) a través de un análisis filogenético basado en 16S ARNr, identificaron a esta bacteria, como taxón único y propusieron la designación provisional de Candidatus Xenohaliotis californiensis.

41 Lee mas

Identificación de cepas bacterianas cultivables presentes en Scomber japonicus peruanus salada utilizando un fragmento del gen 16S ARNr. Tumbes, 2018

Identificación de cepas bacterianas cultivables presentes en Scomber japonicus peruanus salada utilizando un fragmento del gen 16S ARNr. Tumbes, 2018

La presente investigación se desarrolló en la Facultad de Ingeniería Pesquera y Ciencias del Mar de la Universidad Nacional de Tumbes, durante los meses de junio agosto y setiembre de 2018. Tuvo como objetivo identificar genómicamente las bacterias cultivables presente en la caballa comercializada en el mercado modelo de Tumbes, utilizando un fragmento del gen 16S ARNr. Inicialmente se aplicó un análisis microbiológico convencional y luego se realizó una PCR, para enviar a secuenciar los fragmentos amplificados. Los resultados encontrados y comparados con la base de datos del Genbank y que estuvieron entre 98 y 100% de similitud fueron: Staphylococcus sp., Halomonas sp., Staphylococcus sp., Staphylococcus equorum, Salinivibrio sp., Staphylococcus sp., Staphylococcus nepalensis, Staphylococcus equorum, Salinivibrio sp., Staphylococcus equorum. El promedio de humedad del músculo reportada fue de: Junio (62,73±3,02%), Agosto (62,72±10,34%) y Setiembre (47,71±5,53%); mientras que para el cloruro de sodio fue de: Junio (12,62±4,92%), Agosto (15,31±3,01%), Setiembre (11,87±4,67%). La apariencia externa fue: 36% normal, 50% brillante y 14% pálida. La textura fue: blanda 44%, firme 40% y flácida 16%. El olor fue de: fresco 70% y rancio 30%.

45 Lee mas

Aislamiento, Caracterización Bioquímica, Molecular y  Evaluación de la Capacidad de Captar NACL In Vitro de Bacterias Halófilas Provenientes de las Lagunas de Mejía, Arequipa   2017

Aislamiento, Caracterización Bioquímica, Molecular y Evaluación de la Capacidad de Captar NACL In Vitro de Bacterias Halófilas Provenientes de las Lagunas de Mejía, Arequipa 2017

En la actualidad, hablar de salinidad no es ajeno a la realidad nacional. Se ha manifestado como un factor limitante en la agricultura. Por ello es necesario buscar la forma de desalinizar los terrenos y se ha visto que los microorganismos tienen esta capacidad. El presente trabajo tuvo como objetivo el aislamiento, caracterización bioquímica, molecular y evaluación de la capacidad de captar NaCl in vitro de bacterias halófilas provenientes de las Lagunas de Mejía, Arequipa. Se tomaron 3 muestras de agua de las cuales se obtuvo una muestra compósito, dicha muestra fue sembrada e incubada a 37°C por 48 horas en medio de Aislamiento de Bacterias Halofílicas a una concentración de 15.89 % de NaCl. Se obtuvieron 6 colonias; luego se realizó un acondicionamiento de las colonias obtenidas, en medio de Aislamiento de Bacterias Halofílicas con concentraciones de NaCl de 15.89 %, 20.89 % y 25.89 %. Se obtuvo un óptimo crecimiento en el medio que contenía hasta 20.89 % de NaCl, todas ellas son Bacilos, cuatro (4) Gram + y dos (2) Gram -. La caracterización bioquímica se llevó a cabo con las pruebas LIA, TSI, Citrato de Simmons, SIM, MRVP, Catalasa y Oxidasa. La caracterización molecular con el gen ARNr 16S, identificó 6 cepas: Virgibacillus siamensis (H1), Halobacillus sp. (H2), Halobacillus hunanensis (H3), Salinicola zeshunii (H4), Bacillus halophilus (H5) y Kushneria sp (H6). El consumo de NaCl se demostró midiendo la conductividad durante un periodo de 48 horas en un medio de cultivo, partiendo de una concentración de 20.57 % NaCl (202.6 mS/cm). Todas las cepas bacterianas demostraron tener capacidad de captar NaCl in vitro, siendo la bacteria Kushneria sp. la que presentó mayor capacidad de captar NaCl hasta 16.97 % NaCl (180.9 mS/cm), mientras que Halobacillus hunanensis presentó menor capacidad de hasta 18.83 % NaCl (192.1 mS/cm).

117 Lee mas

Filogeografía de los langostinos del género macrobrachium (decapoda: palaemonidae) de la Península de Baja California, México

Filogeografía de los langostinos del género macrobrachium (decapoda: palaemonidae) de la Península de Baja California, México

(Wiegmann, 1836) morfotipo olfersii y morfotipo hobbsi con 54 haplotipos del gen 16S, de los cuales 64 secuencias están presentes en nueve cuencas de la Península de Baja California y 132 se presentan en 16 cuencas de la vertiente continental del pacífico mexicano. Las mutaciones se indican con puntos negros a lo largo de las ramas de la red de haplotipos. Las cuencas de la Península de Baja California: LPU = La Purísima; SR = Santa Rita; LP-SH = Las Pocitas-San Hilario; TS = Todos Santos; PES = Pescadores; PEC = Plutarco E. Calles; MUL = Mulegé; La Paz; SJC = San José del Cabo. Las cuencas de la vertiente continental del Pacífico mexicano: RM = Río Mayo 3; RS = Río Sinaloa 2; MOC = Río Mocorito; RC = Río Culiacán; RE = Río Elota; RPIA = Río Piaxtla 2; RP = Río Presidio 2; RB = Río Baluarte 2; RCA = Río Cañas 2; RSP = Río San Pedro- Desembocadura; RH = Río Huaynamota; RA-I = Río Ameca Ixtapa B; RPU = Río Purificación; RCO = Río Coyuca 2 y RV = Río Verde. Cada círculo representa un haplotipo único. El tamaño de cada círculo se relaciona con el número de frecuencias de cada haplotipo. Hay un nódulo central y las puntas de la red señalan haplotipos únicos y recientes. Existe un solo paso mutacional entre los haplotipos. Excepto

281 Lee mas

Genomic organization of the rDNA cistron of the teleost fish Cyprinus carpio

Genomic organization of the rDNA cistron of the teleost fish Cyprinus carpio

The natural segregation of the carp nucleolar components and the down regulation of rRNA transcription during the adaptation of the fish to the cold season are analogous to the blocking of rRNA synthesis and nucleolar segregation obtained in vitro with Actinomycin D. Thus, the carp acclimatization constitutes a valuable model to study the regulation of ribosome biogenesis, which is closely synchronized at multiple steps, including the regulation of pre-rRNA synthesis at different stages of the process, e.g. chromatin remodeling, transcriptional activation, initiation, elongation and termination (Leary and Huang, 2001). All these regulatory steps involve interactions between cis-acting elements of rDNA genes and trans-acting protein factors. To approach the study of the regulation of rRNA synthesis during the seasonal

11 Lee mas

Diversidad bacteriana en el tracto digestivo de la lombriz de tierra Pontoscolex corethrurus.

Diversidad bacteriana en el tracto digestivo de la lombriz de tierra Pontoscolex corethrurus.

La reacción en cadena de la polimerasa (PCR) se realizó en un termociclador Biorad DNA Engine PCR System PIC200 Peltier Thermal. Se amplificó la región del gen 16S ribosomal del ADN extraído de las cepas bacterianas. Se utilizaron los primer universales 8F-forward (5´-AGAGTTTGATCCTGGCTCAG-3´) y 1492R reverse (5´- AGAGTTTGATCCTGGCTCAG-3´) (Vickerman et al., 2007). Así como las indicaciones de la preparación del mix, 5 μl del tampón para PCR (X10) (promega ®) , 1μl de la mezcla de nucleótidos 10 mM (promega ®) , 1.5 μl de MgCl2 50 mM (promega ®), 0.5 μM de cada primer (promega ®), 2.5 U enzima taq polimerasa (promega®) y 5 μl del ADN extraído de las bacterias aisladas del tracto digestivo de la lombriz de tierra, hasta conseguir un volumen final de reacción 25 μl (Vickerman et al., 2007). El programa de amplificación comprendió un ciclo de predesnaturalización a 94° C, por 3 min, 35 ciclos de amplificación consiste en desnatulización a 94° C, por 1 min; alineamiento a 55° C por 1 min y extensión a 72° C por 2 min y un último ciclo de elongación final a 72° C por 5 min (Silva, 2009; Vickerman et al., 2007). Los productos de amplificación fueron visualizados en geles de agarosa 0.8 %, debido al tamaño de los fragmentos a separar (Vickerman et al., 2007; Aaij y Borst, 1972).

109 Lee mas

TítuloThe linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

TítuloThe linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae)

Most eukaryotic genes are transcribed into precursor messenger RNAs that must undergo splicing, an essential step of gene expression. During precursor messenger RNA splicing, introns are removed from the precursor messenger RNA and exons are ligated together to form mRNA (Will and Lührmann, 2005). Splicing is performed by the spliceosomes, ribonucleoprotein complexes consisting of small nuclear RNAs and several proteins. The U1 small nuclear RNA molecule is a component of the major spliceosome, essential for the interaction with the 5′ splice site of introns (Zhuang and Weiner, 1986). This molecule is encoded by the U1 small nuclear DNA (U1 snDNA), which consists of an RNA coding region (hereafter, U1) and an IGS (when it is organised in tandem repeats). U1 snDNA, transcribed by RNA polymerase II, is a multigene family with a variable number of repeats in each genome (around tens of repeats in the metazoan species studied by Marz et al., 2008). Although not much information is available about the organisation of U1 snDNA, it was found to be linked to other multigene families, such as 5S rDNA (Pelliccia et al., 2001), other spliceosomal snDNA families (Marz et al., 2008) and organised in the same array together with 5S rDNA repeats and other spliceosomal snDNA (Manchado et al., 2006). In general, however, clustered copies of distinct or the same small nuclear RNA coding genes are not common in metazoan genomes (Marz et al., 2008).

26 Lee mas

Aspergillus sección Nigri: estudio fisiológico y molecular de especies ocratoxígenas

Aspergillus sección Nigri: estudio fisiológico y molecular de especies ocratoxígenas

En el caso de las cepas de A. carbonarius el porcentaje de cepas descritas como ocratoxígenas es variable, pero alcanza valores del 100% en muchos estudios. Dos de las cepas incluidas en nuestro estudio habían sido previamente citadas como no ocratoxígenas. Una de ellas (M325), se había descrito como no productora al utilizar granos de café como sustrato pero fue capaz de elaborar OTA en las condiciones analizadas en nuestro estudio. En cambio, la cepa CBS 110.49 considerada como débilmente ocratoxígena al utilizar también granos de café como sustrato, no elaboró OTA en ninguno de los estudios realizados. Cabe pensar por tanto que no se ha utilizado el sustrato idóneo o que probablemente ha perdido la capacidad de producir OTA. Por último, la cepa A-1082, inicialmente identificada como A. carbonarius, tampoco fue capaz de producir OTA en ninguna de las condiciones estudiadas. Mediante el análisis de la región ITS-5,8S del rDNA (artículo 3.3) se pudo determinar que las cepas de A. carbonarius estudiadas eran coespecíficas excepto la cepa A-1082 que se diferenció claramente de las 5 cepas restantes, hecho también confirmado mediante RAPD. Esta cepa pertenecería a la nueva especie propuesta dentro de la sección Nigri, denominada "A. ibericus". No se observó ninguna correlación entre las subdivisiones observadas mediante RAPD y el nivel de producción de OTA de las 5 cepas de A. carbonarius. Un aspecto a considerar en este punto es si realmente existen en la naturaleza cepas de A. carbonarius no ocratoxígenas. Las cepas ensayadas han demostrado esta capacidad como mínimo en alguno de los estudios realizados. Esto podría explicar por qué mediante las técnicas moleculares estudiadas no se pueden diferenciar las cepas en función de sus propiedades ocratoxígenas.

165 Lee mas

Application of molecular techniques to the diagnosis and epidemiology of Haemophilus parasuis

Application of molecular techniques to the diagnosis and epidemiology of Haemophilus parasuis

The first part of this work (Chapter 1: “Genotypic diversity of Haemophilus parasuis Field Strains”) reported a single locus sequence typing method (SLST), based on a partial sequence (596 bp) of the hsp60 gene, for H. parasuis epidemiology. Also, partial 16S rRNA gene sequences (~1400 bp) were used to confirm H. parasuis identification. Surprisingly, we found more variability in 16S rRNA gene than expected and therefore, this gene could also be used for strain typing. ERIC-PCR fingerprints were included in the study to compare the resolution of the different methods. Unfortunately, this SLST scheme was limited by the disturbing effects of lateral gene transfer (LGT) and more resolution was needed to clarify the existence of lineages associated to septicaemia outcome. The second part of the work (Chapter 2: “Study of the population structure of Haemophilus parasuis by multilocus sequence typing”) reported the development of a multilocus sequence typing (MLST) scheme for H. parasuis to overcome these limitations. The use of sequences (470-600 bp) from seven loci for typing provides increased robustness against LGT. Moreover, the use of several sequences generates representative phylogenetic studies to elucidate distant historical relationships. Accordingly, this thesis represents an evaluation of different genotyping techniques for H. parasuis, using more than 100 isolates. Noteworthy, an effort was made to have a representative panel of strains. Consequently, nasal isolates form animals from farms with and without Glasser’s disease, and clinical isolates, from lung and systemic sites, were included. Nasal isolates were included to avoid the problem of many pathogen databases that represent a biased sample of the natural populations since they contain mainly virulent isolates (Perez-Losada et al., 2006 25). Actually, isolates from healthy carriers can constitute the bulk of the population of many species, since colonization is common but disease is rare (Enright & Spratt, 1999). The detailed protocols of the procedures used in the studies included in both chapters can be found in annex II.

100 Lee mas

Estudio del rol del factor UBF en la expresión de poblaciones de rDNA variantes durante la adaptación estacional de Cyprinus carpio

Estudio del rol del factor UBF en la expresión de poblaciones de rDNA variantes durante la adaptación estacional de Cyprinus carpio

El presente trabajo se avocó en identificar cambios en la expresión de V-rDNAs durante la aclimatización de la carpa y caracterizar el efecto del factor UBF sobre el control expresión de estas poblaciones de V-rDNAs. En este trabajo logramos amplificar la secuencia de cDNA que codifica para UBF de carpa, pudiendo analizar las principales características de esta proteína. Posteriormente, mediante estudios de expresión, logramos determinar que la transcripción de UBF es regulada estacionalmente. En este contexto, pudimos establecer que existe un mayor contenido de esta proteína durante la estación de verano en comparación a la estación de invierno. Por otro lado, utilizando ensayos in vitro e in vivo, determinamos que la concentración de la proteína UBF se relaciona positivamente con la actividad transcripcional de los genes ribosomales en la carpa durante su ciclo estacional. Así, logramos establecer que UBF es el responsable de mantener el estado activo del rDNA. Nuestros resultados demostraron que durante la estación invernal baja el contenido nuclear de UBF, así como su asociación al rDNA. En ese estado, la transcripción decrece a causa de una disminución de los genes ribosomales activos. En paralelo, ensayos in vitro demostraron que una sobreexpresión de UBF durante la estación invernal permite mantener constante la cantidad de genes ribosomales activos, aumentando así la tasa transcripcional de los mismos. Consecuentemente, estos datos sugieren que los niveles de UBF son capaces de controlar la biogénesis ribosomal en la carpa, de manera cíclica y en respuesta a los estímulos medioambientales.

5 Lee mas

Show all 83 documents...

Related subjects