Objetivos específicos del Trabajo Fin de Grado
Top PDF Objetivos específicos del Trabajo Fin de Grado:
Efficient production process for food grade acetic acid by acetobacter aceti in shake flask and in bioreactor cultures
... Abstract: Acetic acid is one of the important weak acids which had long history in chemical industries. This weak organic acid has been widely used as one of the key intermediate for many chemical, detergent, wood and ...
Production of Vinegar from Oil palm Wine Using Acetobacter Aceti Isolated from Rotten Banana Fruits
... Acetobacter aceti can be isolated from various substrates such as rotten banana fruits which easily undergo spoilage and are usually discarded as ...using Acetobacter aceti isolated from ...
Acetobacter aceti fast identification by Real Time PCR in spoiled wine samples
... for Acetobacter aceti with 22bp. Name: Aceti-F 5´ TGGAGCATGTGGTTTAATTCGA 3´; Aceti-R 5´ GCGGGAAATATCCATCTCTGAA ...A. aceti has ...
Acetobacter aceti Isolated from Fermented Palm Wine in the South-West Region of Nigeria Elucidated High Nitrosamine Production in the Presence of Nitrite
... Acetobacter aceti. The time course of nitrosation during incubation of Acetobacter aceti with dimethylamine and nitrate or nitrite, and kinetics of nitrosation were ...of Acetobacter ...
In vivo and in vitro evaluation of an Acetobacter xylinum synthesized microbial cellulose membrane intended for guided tissue repair
... study, the mesenchymal stem cells aggregated to the cellu- lose membrane despite the difference of surface texture observed by electron microscopy thus demonstrating its ability to scaffold cells. The maintenance of ...
Chemical and microbiological analysis of red wines during storage at different temperatures
... e.g. Acetobacter aceti, Acetobacter pasteurianus, Gluconobacter oxydans [6], Gluconacetobacter liquefaciens and Gluconacetobacter hansenii ...
Enzymatic characterization of a recombinant carbonyl reductase from Acetobacter sp. CCTCC M209061
... hydroxysteroid dehydrogenase from Acetobacter ghanen- sis (WP_059024845.1), 56% with Cyclopentanol dehydro- genase from Mesorhizobium plurifarium (CDX57396.1), 51% with R-specific alcohol dehydrogenase from Lacto- ...
Immobilization of Acetobacter sp. CCTCC M209061 for efficient asymmetric reduction of ketones and biocatalyst recycling
... Biocatalysis using enzymes, microorganisms and plant cells, has generated considerable interest for the synthe- sis of various enantiopure alcohols used as pharmaceut- ical and agrochemical intermediates due to its high ...
High Performance Liquid Chromatographic Determination of Ascorbic Acid in Brassica Oleracea L. Var. Italica Plenck
... Sample and standard solutions preparation 0.5 gram of fresh tissue was ground to a fine powder under liquid N 2 and homogenized with 3×10 ml of an ice-cold solution containing 10% aceti[r] ...
Samarium (III) PVC-Membrane Sensor based on 2-{[2-(4-chlorophenyl)-2-oxoethyl]sulfanyl} acetic acid
... Sci., 10 2015 8644 - 8655 International Journal of ELECTROCHEMICAL SCIENCE www.electrochemsci.org Samarium III PVC-Membrane Sensor based on 2-{[2-4chlorophenyl-2-oxoethyl]sulfanyl} aceti[r] ...
Re-examination of the genus Acetobacter, with descriptions of Acetobacter cerevisiae sp. nov. and Acetobacter malorum sp. nov.
... The results of DNA–DNA hybridizations of all strains examined are shown in Table 2. DNA–DNA hybridization data revealed that four strains, LMG 1625 T , LMG 1599, LMG 1699 and LMG 1682, displayed a high level of DNA ...
The role of protein modifications in senescence of freeze-dried Acetobacter senegalensis during storage
... Results: Heterogeneous populations composed of culturable cells, viable but non-culturable cells (VBNC) and dead cells were generated when freeze-dried cells were kept at − 21 and 4°C fo[r] ...
Effect of aspartic acid and glutamate on metabolism and acid stress resistance of Acetobacter pasteurianus
... Amino acids play an important role in cell growth metabolism and survival of cell under severe environ- ment. Callejón et al. reported that AAB consumed amino acid when ethanol was converted to acetic acid [15], and free ...
Analysis of Grape Berry Epiphytic Microbiomes via QIIME
... microbiome, by examining the epiphytic microbiome of developing and sour rot infected grapes in New York and Tasmania. Sour rot is characterized by a distinct vinegar smell that is caused by the combination of Drosophila ...
ISOLATION OF THERMOTOLERANT AND HIGH ACETIC ACID-PRODUCING ACETOBACTER PASTEURIANUS FROM IVORIAN PALM WINE
... In this work, 104 strains were isolated from Ivorian palm wine. After thorough screening, five strains presenting the best potentialities were characterized. Morphological, biochemical, physiological and molecular ...
Isolation of Acetic Acid Bacteria and Preparation of Starter Culture for Apple Cider Vinegar Fermentation
... nera Acetobacter, Gluconacetobacter, Gluconobacter and Komagataeibacter be- cause of their superior capacity to oxidize ethanol and resistance to acetic acid released into the fermentative ...
Markedly improving asymmetric oxidation of 1-(4-methoxyphenyl) ethanol with Acetobacter sp. CCTCC M209061 cells by adding deep eutectic solvent in a two-phase system
... The metabolic activity retention (MAR, %) of immobi- lized Acetobacter sp. CCTCC M209061 cells was defined as the ratio of the consumed glucose amount by the immobilized cells pretreated in various media to that ...
Synthesis of cellulose acetate nanofiber (CANF) from bacterial cellulose (BC) incubated from cannery seafood wastewater (CSW) using Acetobacter xylinum
... As can be seen in the table, the best condition which maximum yield of bacterial cellulose 1.14 g and the best of COD treatment 71.2% can be carbon source COD ratio 11, 971 mg/L, 5 ml of[r] ...
Cloning, expression, purification and characterization of replication protein from plasmid pGP2 from Acetobacter estunensis
... analysis of amino acid sequence were determined the number of alpha helixes (4 larger than 4 aa) and beta structures (4 larger than 4 aa) and two domains: Helicase conserved C-terminal domain (137-175 aa) and HTH motive ...
Biocatalytic anti-Prelog reduction of prochiral ketones with whole cells of Acetobacter pasteurianus GIM1.158
... ( Acetobacter pasteurianus ...Two Acetobacter strains, Acetobacter pasteurianus ...examined. Acetobacter pasteurianus ...cultivate Acetobacter pasteurianus GIM1.158 cells. Obviously, ...