PCR multiplex

Top PDF PCR multiplex:

Tcnica de PCR multiplex como mtodo diagnstico de infecciones de transmisin sexual

Tcnica de PCR multiplex como mtodo diagnstico de infecciones de transmisin sexual

En cuanto a la determinación de gérmenes a través de la PCR Multiplex, Zapara (2011) realizó una investigación basada en la amplificación de un fragmento del gen ADN ribosomal 16s mediante PCR en tiempo real para su aplicación como método de diagnóstico e identificación molecular en infecciones bacterianas locales realizado. Este autor también arribó a la conclusión de que la PCR resultaba ser una técnica eficiente y reproducible para detectar bacterias de relevancia clínica en controles positivos y en muestras clínicas en un ensayo de campo limitado; por lo que apoyaba su utilidad para detectar infecciones. 7

13 Lee mas

Detección de  cepas de  Escherichia coli Shiga Toxigénica (STEC)  y  enteropatógena (EPEC)  basada en PCR multiplex

Detección de cepas de Escherichia coli Shiga Toxigénica (STEC) y enteropatógena (EPEC) basada en PCR multiplex

Debido a que las EPEC y STEC poseen características de colonización similares, se considera que STEC debe haberse originado como resultado de una cepa de EPEC que sufrió la infección por un bacteriófago portador del gen de la toxina de Shiga (Bailey & Scott, 2009) La PCR puede dar un informe detallado de las cepas presentes y cuáles son los genes patógenos que contienen, ya que su estudio se centra en el material genético del microorganismo (Rodríguez, et al., 2002). Sin embargo, existe la PCR multiplex que permite estudiar varios genes simultáneamente, ahorrando de esta manera tiempo y reactivos, sin perder su sensibilidad y especificidad. (Xu, Liu, Guan, Cui & Li, 2015).

12 Lee mas

Serotipificación de aislados de enfermedad invasiva en menores de cinco años por PCR multiplex secuencial en Paraguay

Serotipificación de aislados de enfermedad invasiva en menores de cinco años por PCR multiplex secuencial en Paraguay

Resumen: Mediante la implementación de una PCR multiplex secuencial con protocolo CDC para Latinoamérica se serotipificó cepas de Streptococcus pneumoniae aisladas de enfermedad invasiva en niños menores de cinco años en Paraguay, durante el período 2011 a 2013. Se identificaron 58.6 % de los serotipos en la primera reacción de PCR, 19.1% en la segunda reacción, 8.3% en la tercera reacción, 3.8% en la cuarta reacción, 0.6% en la quinta reacción, 3.8% en la sexta reacción, 1.3% en la sétima y octava reacción amente. El 100% de las cepas aisladas ( N=157) fue confirmada por Quellung. El serotipo 14 fue encontrado con mayor prevalencia en 33.1 % de las enfermedades invasivas, seguido del serotipo 3 y 6A con 8.3% ; serotipo 19F con 7%, serotipo 6B con 5.7% y 4.5% con serotipo 7F. Puesto que la introducción de la vacuna neumocócica conjugada (PCV10) en Paraguay se produjo en el año 2012, se evidencia una disminución de aislamientos de los serotipos vacunales como el serotipo 1, 5, 9V, 14, 18C, 19F y 23F. Así mismo se pudo observar un aumento de los serotipos 3 y 9A, así como la aparición de otros serotipos no vistos hasta entonces como los serotipos 9N, 23B, 24F y 38. Ello puede estar indicando un cambio post vacunal en la frecuencia de serotipos.

13 Lee mas

Puesta a punto de una técnica de PCR Multiplex para el diagnóstico de la resitencia de Haematobia irritans a insecticidas

Puesta a punto de una técnica de PCR Multiplex para el diagnóstico de la resitencia de Haematobia irritans a insecticidas

12 vitro, el principal inconveniente que tienen es que sólo diagnostican la resistencia fenotípica, lo cual no es precoz, o sea la diagnostica cuando tenemos el problema y precisa de muchísimos individuos para realizar el test. Teniendo en cuenta que la mutación tipo kdr ya fue diagnosticada en poblaciones de moscas resistentes a PS en Uruguay, siendo frecuente, y que fenotípicamente se ha demostrado resistencia a fipronil, se decidió poner a punto una técnica PCR Multiplex alelo específica para la mutación tipo kdr y rdl con el objetivo de diagnosticar la frecuencia de individuos de H. irritans resistentes a estos insecticidas.

41 Lee mas

Identificación molecular mediante secuenciación y PCR Multiplex del pez vela (Istiophorus platypterus: Istiophoridae) en Costa Rica

Identificación molecular mediante secuenciación y PCR Multiplex del pez vela (Istiophorus platypterus: Istiophoridae) en Costa Rica

Costa Rican legislation has stipulated the protection of sailfish (I. platypterus) by prohibiting the commercial fishery and exportation of this species. However, it is suspected that in the last few years illegal exportation of sailfish has been occurring, fact that cannot be demonstrated due to the limitations of the conventional methods used for species identification once the product has been processed. This is why the objective was to standardize two alternative techniques that allow a specific identification of the economically important billfishes in Costa Rica. The analysis based on the mitochondrial cytochrome c oxidase subunit I (COI) gene sequences identified the samples as I. platypterus, K. audax, M. nigricans, X. gladius and Thunnus sp. Phylogenetic reconstruction demonstrated that COI gene does not differentiate unambiguously the species T. angustirostris and T. pfluegeri nor the species K. audax and K. albida, nevertheless this distinction is not important in Costa Rican market. Also, the multiplex PCR assay standardized to amplify specific fragments of the mitochondrial control region allowed the identification of the species: I. platypterus, Kajikia sp., X. gladius and Thunnus sp. This study reveals that genetic identification can be used as a reliable tool for the identification of billfishes.

79 Lee mas

TítuloCaracterización de cuatro loci microsatélites polimórficos en "Palaemon serratus"

TítuloCaracterización de cuatro loci microsatélites polimórficos en "Palaemon serratus"

En el presente trabajo, este método de marcaje de los productos de PCR se llevó a cabo en dos PCRs multiplex optimizadas por Perina et al. (2015, enviado), combinando en cada una de ellas dos fluorocromos diferentes; concretamente, se utilizaron los primers M13 marcados con HEX (hexacloro-6-carboxi-fluoresceína, de color verde) y los primers CAG con 6-FAM (6-carboxi-fluoresceína, de color azul). Con el fin de obtener una fuerza de señal máxima, se debe optimizar el protocolo teniendo en cuenta que: los primers universales marcados con fluorescencia y los primers forward se deben utilizar en cantidades equimolares; los primers reverse se deben utilizar en un cuarto de la cantidad de los primers forward, de modo que los primers universales puedan continuar la reacción cuando los primers reverse se hayan agotado; dado que la temperatura de annealing de los primers universales marcados con un colorante fluorescente es solamente 53°C, los últimos ocho ciclos de PCR deben procesarse con una temperatura de annealing de 53°C aproximadamente y, por último, la etapa de elongación final no debe ser más corta de 10 min (Schuelke, 2000). Teniendo en cuenta lo anterior, el protocolo óptimo de PCR multiplex (Tabla 1) llevado a cabo en un termociclador (MyCycler Thermal Cycler, Bio-Rad Laboratories), consiste en un paso inicial de desnaturalización a 95°C durante 5 min, seguido por 30 ciclos a 95°C durante 30 s, 56°C durante 90 s y 72°C durante 30 s; 8 ciclos a 95°C durante 30 s, 52°C durante 90 s y 72°C durante 30 s; un paso final de extensión a 68°C durante 30 min y una última etapa a 4°C infinito con el fin de que las muestras se conserven hasta que son retiradas del termociclador. Ambas PCRs multiplex fueron realizadas en un volumen final de 12,5 μL conteniendo 1 μL de ADN (10 ng/μL), 6,25 μL de Type-it Microsatellite PCR kit (Qiagen), 4 μL de agua (PCR-grade water) y 1,25 μL de la mezcla de primers con una concentración final de 2 μM (en el caso de los primers con la “cola” universal, la concentración es de 0,2 μM) (Perina et al., 2015 enviado).

27 Lee mas

Eigenvector centrality of nodes in multiplex networks

Eigenvector centrality of nodes in multiplex networks

Introducing a layer structure on a complex network or, equivalently, distinguishing different types of interactions between its nodes, may significantly vary the behaviour of the network (cf. Refs. 14–16). The main goal of this paper is analysing the influence of the layer structure in some eigenvector-like centralities of multiplex networks. In order to that, we have introduced several eigenvector centralities that take into account the layer structure by means of a directed graph of influences among layers. The examples presented in the paper show that the centrality measures introduced are qualitatively different and, in particular, dif- ferent from the eigenvector centrality of the projected net- work. In order to measure conveniently these differences, we have introduced an algorithm that produces randomly

11 Lee mas

Utilización de técnicas moleculares para la identificación y caracterización genotípica de cepas de Mycobacterium aisladas en cultivo y presentes en muestras clínicas

Utilización de técnicas moleculares para la identificación y caracterización genotípica de cepas de Mycobacterium aisladas en cultivo y presentes en muestras clínicas

Actualmente se requieren técnicas moleculares alternativas que permitan una rápida identificación de los miembros del género Mycobacterium. Una opción adecuada sería la utilización de ERIC-PCR, técnica utilizada ampliamente para la identificación de distintos géneros bacterianos pero muy poco explotada en micobacterias. Este procedimiento presenta un gran poder de discriminación entre cepas estrechamente relacionadas a nivel genómico y solo requiere un par de iniciadores universales. Por otro lado, es factible realizar el protocolo en un solo día de trabajo, lo que permite la identificación en un periodo corto de tiempo y a menor costo.

91 Lee mas

2008 PCR

2008 PCR

Método de Ct comparativo (Método ΔΔCT) El método de CT comparativo, también llamado el método de ΔΔCT, es similar al método de la curva estándar relativa, excepto que este usa las fórmulas aritméticas para lograr un resultado para la cuantificación relativa. Es posible eliminar el uso de curvas estándar y usar el método de ΔΔCT, pero las eficacias de PCR entre el blanco (s) y control (s) (endógeno) deben ser relativamente equivalentes (16). La ventaja de este método es que no exige curvas estándar para cada pozo de reacción, permitiendo el ahorro de reactivos y es útil cuando hay un número alto de blancos y/o de muestras (33).

11 Lee mas

Desarrollo de una prueba RT PCR con Primers específicos – degenerados diseñados para incrementar la sensibilidad de las PCRs de diagnóstico y secuenciación de avibirnavirus

Desarrollo de una prueba RT PCR con Primers específicos – degenerados diseñados para incrementar la sensibilidad de las PCRs de diagnóstico y secuenciación de avibirnavirus

For these reasons, in this study the RT-PCR technique was evaluated with degenerate- specific primers to increase the sensitivity of the PCRs as a diagnostic and sequencing test for IBDV. The samples evaluated were a vaccine and stock infected with IBDV. Different aspects were evaluated in the design of the RT-PCR and the choice of the extraction method. IBDV diagnostic and sequencing PCRs were performed to select the best pair of degenerate-specific primers which were R6 with F11 for segment A and R7 with F12 for segment B. Two types of reverse transcriptase enzymes were compared, obtaining better results with the M-MuLV enzyme and adding 20% DMSO. In addition, the final conditions for RT-PCR were evaluated with partial sequencing PCR of segment A and B, demonstrating that the mix of specific-degenerated primers together with random hexamers successfully amplifies RNA from stock tissue. In conclusion, RT-PCR designed with degenerate-specific primers in conjunction with random hexamers increased the sensitivity of the diagnosis and sequencing PCR of IBDV.

12 Lee mas

Identificación molecular por PCR y nested PCR de rickettsias en Crassostrea gigas.

Identificación molecular por PCR y nested PCR de rickettsias en Crassostrea gigas.

ACTTACTAAACCACCTACACACCC) would be able to detect a fragment of the gene 16S rRNA of rikettsiae in Crassostrea gigas. To cover this goals, the DNA extraction from gills and visceral mass of C. gigas following the protocol CTAB was completed, and to verify the proper extraction, an amplification of reference actin gene by PCR using the primers Bi-actin-Fw and Bi-actin-Rev.was performed. The results indicate that DNA extraction was adequate as it was able to amplify the actin gene, however primers for both PCR tested as nested-PCR were unable to detect rickettsiae in C. gigas but they allowed to amplify the fragment of the gene 16S rRNA from a sample of Ostrea iridescens, according to the search in GenBank, it corresponded to a non-culturable bacteria (94% similarity) and not related to any of the rickettsiae whose sequences are deposited in the database (similarity of 84%). We conclude that the PCR primers tested both as nested- PCR failed to detect rickettsiae in the analyzed samples, either because they came from uninfected C. gigas or because primers were not specific enough to detect them. Testing is recommended for detection of rickettsiae using primers designed to detect other genes such as genes encoding rOmpA and rOmpB proteins, the gltA gene which encodes citrate synthase and the D gene.

41 Lee mas

Multiplex micro respiratory measurements of Arabidopsis tissues

Multiplex micro respiratory measurements of Arabidopsis tissues

A significant issue for the use of the microtitre plate OCR assays in the Seahorse XF96 is the need to secure material during the mixing and measurement phases. This is especially problem- atic for plant leaves as they are gas-filled structures, and so their buoyancy needs to be overcome for an extended period of time and during the addition and mixing phases of the assays. Two different methods were tested to immobilize leaf discs onto microtitre plate bases with differing success. Cell-Tak (BD Bioscience) is a formulation of multiple polyphenolic proteins extracted from the blue mussel Mytilus edulis (Silverman & Roberto, 2007). Researchers have been using this adhesive pro- tein mixture to immobilize animal cells and tissues for microplate assays for a number of years (Choi et al., 2010; Zhang et al., 2011; Robinson et al., 2012). However, Cell-Tak is expensive and we found that it took c. 30 min to adhere, leading to dehy- dration of leaf tissues which is undesirable. Cell-Tak also had a significant failure rate across wells in securing leaf tissues (c. 20% failure, Fig. S1). A much lower cost and more rapid solution was the use of medical-grade skin-glue (Leukosan â ), which is non- toxic, sets in c. 2 min and, when mixed with agarose, provided an excellent adhesive for leaf tissues to plastic surfaces (< 5% failure, Fig. S1). The agarose also provided aeration on the side of the leaf disc in contact with the plastic, as agarose has a gas-permeable macroporous structure with pore sizes of 100–300 nm (Plieva et al., 2009). Larger scale multiplex assays using most or all of the

11 Lee mas

PCR en tiempo real

PCR en tiempo real

PCR essentially any nucleic acid sequence present in a complex sample can be amplified in a cyclic process to generate a large number of identical copies that can readily be analyzed. This made it possible, for example, to manipulate DNA for cloning purposes, genetic engi- neering, and sequencing. But as an analytical technique the original PCR method had some serious limitations. By first amplifying the DNA sequence and then analyzing the product, quantification was exceedingly difficult since the PCR gave rise to essentially the same amount of product independently of the initial amount of DNA template molecules that were present. This limitation was resolved in 1992 by the development of real-time PCR by Higuchi et al. [Higuchi, R., Dollinger, G., Walsh, P.S., Griffith, R., 1992. Simultaneous amplification and detection of specific DNA-sequences. Bio-Technology 10(4), 413–417]. In real-time PCR the amount of product formed is monitored during the course of the reaction by monitoring the fluorescence of dyes or probes introduced into the reaction that is propor- tional to the amount of product formed, and the number of amplification cycles required to obtain a particular amount of DNA molecules is registered. Assuming a certain amplification efficiency, which typically is close to a doubling of the number of molecules per amplification cycle, it is possible to calculate the number of DNA molecules of the amplified sequence that were initially present in the sample. With the highly efficient detection chemistries, sensitive instrumentation, and optimized assays that are available today the number of DNA mole- cules of a particular sequence in a complex sample can be determined with unprecedented accuracy and sensitivity sufficient to detect a single molecule. Typical uses of real-time PCR include pathogen detection, gene expression analysis, single nucleotide polymorphism (SNP) analysis, analysis of chromosome aberrations, and most recently also protein detection by real-time immuno PCR.

31 Lee mas

Desarrollo de un kit de diagnóstico para Campylobacter fetus y Tritrichomonas foetus

Desarrollo de un kit de diagnóstico para Campylobacter fetus y Tritrichomonas foetus

Por el contrario, para Campylobacter, si bien se pudieron extraer los dos plásmidos que se muestran en la Figura 14, no se logró amplificar el fragmento mediante los primers nahE (Figura 14). Por tanto, si bien se obtuvieron colonias que poseían el plásmido con el gen LacZ interrumpido, no se posee clonado el inserto de interés. Esto se comprobó, digiriendo el plásmido nuevamente con las enzimas BamHI y EcoRI, para luego visualizarlo por gel de agarosa. En el caso de que se hubiese dado la clonación, se observarían dos bandas, una correspondiente al plásmido linealizado y otra al inserto. Sin embargo, solo se observó la banda correspondiente al plásmido, esto puede deberse a que el mismo se haya religado sin inserto en su interior. Otra opción, podría ser que se hayan insertado dímeros de primers. Esto es menos probable ya que se realizó una purificación del producto de PCR mediante kit, previo a la ligación.

72 Lee mas

Comparative clinical study of different multiplex real time PCR strategies for the simultaneous differential diagnosis between extrapulmonary tuberculosis and focal complications of brucellosis

Comparative clinical study of different multiplex real time PCR strategies for the simultaneous differential diagnosis between extrapulmonary tuberculosis and focal complications of brucellosis

before drawing the sample. The first of these was a 24-year-old woman with a kidney transplant and brucellar pyelonephritis in the transplanted organ, treated for two weeks before taking the renal biopsy with ciprofloxacin, meropenem and piperacillin- tazobactam. The second was a 33-year-old man with tuberculous vertebral osteomyelitis treated during the four months prior to taking the vertebral biopsy with rifampicin/isoniazid/pyrazin- amide/ethambutol for the first two months and with rifampicin/ isoniazid the second two months. In both cases the cultures were also negative. If these cases had been withdrawn from the analysis of efficacy, the sensitivity of the M RT-PCR for the overall sample would have risen to 92.5%. The other four false-negative results corresponded to two patients with brucellosis (one brucellar orchiepididymitis with positive blood cultures and a negative urine culture and the other vertebral osteomyelitis with negative blood and vertebral tissue cultures) and two patients with tuberculosis (one meningitis and one vertebral osteomyelitis, both with positive cultures and negative microscopic study). Table 4 shows the results of the M RT-PCR according to the type of microorganism, culture result and sample type. The M RT-PCR was positive in the four cases of extrapulmonary tuberculosis with smear-positive samples and in 17 (85%) of the 20 cases with smear-negative samples.

10 Lee mas

Reaccin en cadena de la polimerasa (PCR) y sus aplicaciones en dermatologa

Reaccin en cadena de la polimerasa (PCR) y sus aplicaciones en dermatologa

la presencia de diferentes agentes infecciosos, como Mycobac- terium tuberculosis, micobacterias atípicas, M. leprae, Bartonella hen- selae; espiroquetas, Treponema pallidum y Borrelia burgdorferi; virus herpes 1 y 2, virus, Epstein-Barr, citomegalovirus, herpes virus humano-8, parásitos como Leshmania spp., Aspergilus spp., Blas- tomycosis dermatitidis, Cándida spp., Coccidioides immitis, Cryptococcus neoformans, Histoplasma capsulatum y Paracoccidiomycosis brasiliensis, entre otros. Además la pcr se ha utilizado para analizar y buscar

6 Lee mas

Comparative performance evaluation of four commercial multiplex real-time PCR assays for the detection of the diarrhoea-causing protozoa Cryptosporidium hominis/parvum, Giardia duodenalis and Entamoeba histolytica

Comparative performance evaluation of four commercial multiplex real-time PCR assays for the detection of the diarrhoea-causing protozoa Cryptosporidium hominis/parvum, Giardia duodenalis and Entamoeba histolytica

No non-specific amplification/cross-reactivity was seen in any of the four multiplex qPCR methods when DNA samples from other parasitic/commensal species (E. dispar, L. infantum, T. cruzi, T. gondii, A. lumbricoides and S. stercoralis) were tested. All 24 DNA samples from apparently healthy subjects tested negative, excepting one sample that was G. duodenalis-posi- tive by R-Biopharm (Ct = 37.7) and a sample that was Cryptosporidium-positive by Seegene (Ct = 40.2). A number of previously unnoticed co-infections were observed within the panels of selected DNA samples positive for Cryptosporidium hominis/parvum, G. duodenalis and E. histolytica/dispar, most of them associated with high (� 35) Ct values (S1 Table). This finding is most likely due to the comparatively higher detection sensitivity of the multiplex qPCR methods with those of the conventional PCRs used in the primary diagnosis of the samples, although the occurrence of false-positive results could not be completely ruled out.

11 Lee mas

Amplicon DNA melting analysis for the simultaneous detection of Brucella spp and Mycobacterium tuberculosis complex. Potential use in rapid differential diagnosis between extrapulmonary tuberculosis and focal complications of brucellosis.

Amplicon DNA melting analysis for the simultaneous detection of Brucella spp and Mycobacterium tuberculosis complex. Potential use in rapid differential diagnosis between extrapulmonary tuberculosis and focal complications of brucellosis.

To optimize the reaction parameters, all tests were performed initially in an individual format. These real time PCR assays and the parameters used in the design of the primers were taken into account to facilitate subsequent multiplex reactions, once the optimization and sensitivity were completed. A total of nine M RT-PCR reactions were developed and evaluated, as a result of the different gene combinations. Amplifications and melting curve analyses were performed on the LightCycler 2.0 Instrument (Roche Diagnostic, Indianapolis, IN) using the LCH FastStart DNA Master SYBR Green I kit (Roche Molecular Biochemicals, Mannheim, Germany). The multiplex amplification mixture included 1X master mix, 3–4 mM MgCl 2 , 0.5–0.6 m M primers,

9 Lee mas

Cuantificación relativa de longitud telomérica en una muestra de individuos jóvenes colombianos a través de una técnica de pcr en tiempo real multiplex

Cuantificación relativa de longitud telomérica en una muestra de individuos jóvenes colombianos a través de una técnica de pcr en tiempo real multiplex

reactivos, tipo y concentración de primers utilizados, reactivos y equipos. Después de utilizar todas las variantes metodológicas posibles Jodzyck, (2011), demuestra que los primer utilizados para la amplificación de telómeros presentan en sus cadena 3’, tres bases complementarias entre ellas, formando un producto muy estable a temperaturas altas. Además el uso de Taq polimerasas convencionales, favorecerían la aparición de estas bandas, por lo que sería recomendable utilizar polimerasas Hot Start para realizar los ensayos. Teniendo en cuenta los resultados obtenidos por Jodzyck, (2011), se decidió realizar una PCR convencional utilizando la Taq Polimerasa Biolase (Bioline USA, Inc), bajo el mismo programa de amplificación sugerido por Cawthon (2009). A pesar del uso de esta nueva Taq polimerasa se continuó observando la amplificación y presencia de banda en los controles negativos. Por lo que se decidió adicionar a la reacción 1M del coadyuvante Betaína; este reactivo sirve eficazmente para aumentar el rendimiento de la reacción, disminuyendo la formación de estructuras secundarias causadas por regiones ricas en GC (Henke, Herdel, Jung, Schnorr, & Loening, 1997). Los resultados mostraron que la adición de la betaína tampoco favoreció la eliminación de las bandas en los controles negativos, ni para los ensayos multiplex, como singleplex.

87 Lee mas

A new multiplex PCR assay for the simultaneous detection of vancomycin resistant enterococci from rectal swabs

A new multiplex PCR assay for the simultaneous detection of vancomycin resistant enterococci from rectal swabs

Because the new PCR-based assay used here allows the simultaneous identification of important species of Entero- coccus and their vancomycin resistance genotypes (vanA, vanB, vanC1 and vanC2/C3), the assay has a broad applica- bility. For instance, this assay can also be used to identify VRE cultured on conventional agar plate media or in blood culture bottles, shortening the time of the VRE identifica- tion process by over 24 hours. Unlike other molecular kits, this new assay also detects vanC1 and vanC2/C3 genotypes (genes carried by resistant Enterococcus gallinarum and Enterococcus casseliflavus/flavescens, respectively). Al- though the clinical significance of these species is not yet fully established, because these organisms have been re- covered infrequently from clinical specimens, they may also cause serious invasive infections. 21,22

6 Lee mas

Show all 661 documents...

Related subjects