3. HIPÓTESIS Y OBJETIVOS
4.2.3 Análisis de los datos
The Metarhizium spp. isolates were identified by PCR amplification of the genomic sequence of the elongation EF1-α. The whole EF1-α gene consists of 2477 bp with the 5´region being the most informative region for the correct identification of different fungal isolates to species level. A total of 27 consensus sequences with a total span of 1700 bp were obtained for the EF1-α gene of each isolate.
The Neighbour-Joining method for the phylogenetic study of the data set allowed the identification of the Metarhizium isolates to species level (Figure 2.3). A section of the obtained phylogenetic tree strongly corresponded to the backbone topology of the PARB species complex, with M. brunneum forming the basal-most clade and M. robertsii parallel to a clade containing M. pingshaense and M.
anisopliae. Interestingly, only five of the study isolates belonged to this common and world-wide
distributed clade and none of the isolates were aligned to the M. pingshaense clade. Most of the remaining isolates, 57%, belonged to the M. novozealandicum clade. Another section of the obtained phylogenetic tree also coincides to the split of M. lepidiotae and the MGT clade which includes M.
majus and M. guizhouense. Only three isolates fell in this clade. Finally, two isolates belonged to clade
of cold active species: Metarhizium frigidum.
From all the isolates previously identified as M. anisopliae, the majority fell in the M. novozealandicum clade and others in M. robertsii, M. brunneum and M. guizhouense, except for F672 which belongs to
M. anisopliae. The Metarhizium isolates originally obtained from plant material as endophytes
belonged to M. robertsii (F447), M. anisopliae (F672) and M. guizhouense (Bk41). The isolate F144 previously identified as M. anisopliae var. anisopliae, in this study its sequence corresponded to that of Isaria fumosorosea and was the only isolate outside of the genus Metarhizium. This isolate was not included in the phylogenetic tree.
Figure 2.3 Molecular identification to the species level of Metarhizium spp. isolates. Neighbour- Joining phylogeny inferred from the analysis of the elongation factor 1-alpha gene (EF1- α). Support values were obtained from 1000 bootstrap replicates. Percentage of replicate trees in which the associated taxa clustered together are shown next to the branches. The analysis involved 43 nucleotide sequences, including reference strains obtained from GenBank (in bold). All positions containing gaps and missing data were eliminated. There was a total of 1353 positions in the final dataset.
2.3.3
Determination of the presence of adhesin genes (mad1 and mad2) and the
Metarhizium raffinose transporter (mrt)
Approximately 2 ng of genomic DNA from each isolate was used for PCR amplification of the targeted genes sequences, mad1, mad2 or mrt, using the pair of primers selected from the NCBI described in the methodology. However, using these set of primers did not result in gene amplification in most of the entomopathogenic isolates (Figure 2.4).
Figure 2.4 Molecular characterization of entomopathogenic fungi. Amplification of genes related with the fungal capacity to attach to the surfaces of either, insects (mad1) or plants (mad2), and their capacity to associate with roots (mrt). M, Molecular marker; +, Positive control; 20= F447; 21= C14; 22= MW#2; 23= MW#8; 24= B14; 25= Bk41; 26= MFI; 27= F327; 28= Bb18; 29= Bb21; -, Negative control. Metarhizium: 20 – 26; Trichoderma: 27;
Beauveria: 28-29.
A new set of degenerated primers were designed which contemplated the differences that might exist between different species. The new primers used and the size of the corresponding expected amplicon are given in Table 2.3.
Table 2.3. Primers used for the amplification of target genes related with the adhesion of
Metarhizium to insect or plant surfaces, mad1 and mad2, respectively, and the Metarhizium raffinose transporter gene (mrt).
Primers for: Code Sequence 5'-3' Amplicon
(pb) MAD1F* I TGCTGTCTTCRTCGTCYTACA 793 MAD1R* CGCAGTGCCACTTGATCTTG MAD2F* J ACCAGCACAGAAAGCAGWST 799 MAD2R* TGATTGGCAGGCTTGKTCCA MRT1F H CAGCCTCGCAGAATCTCCAT 738 MRT1R GCAGACGATTTCTGTTCGGC MRT2F* K GATGGAGAAGGAGCTCACRG 738 MRT2R* TCMCSTTGCGCRTCGAATCT
*All pair of primers were degenerated but for the pair H.
In Table 2.4 are shown the results obtained in this molecular characterization with the genes mad1,
mad2 and mrt using the entomopathogenic fungal isolates of this study. The size of the obtained
amplicons corresponded to the expected size using either non-degenerated and degenerated (*) primers: mad1* (793 bp); mad2* (798 bp); mrt1 (918 bp) and mrt2* (738 bp).
Using this new set of degenerated primers in a touchdown PCR, gene amplification was obtained in a higher number of isolates than previously, but results seemed to be genus specific given the fact that no amplification was obtained in the Beauveria isolates (Figure 2.5).
Figure 2.5 Molecular characterization of entomopathogenic fungi. Amplification of genes related with the fungal capacity to associate with roots (mrt) using non-degenerated and degenerated primers (*). M, Molecular marker; +, Positive control; 25= BK41; 26= MFI; 27= FCC327; 28= Bb18; 29= Bb21; -, Negative control. Metarhizium: 25 – 26; Trichoderma: 27; Beauveria: 28-29.
The mad1 gene, which is related to the ability of the fungi to attach to insects, was found in only 33.3% of the isolates and its presence was homogenously distributed among the different species (Table 2.4). As expected, both B. bassiana isolates, T. harzianum F327 and I. fumosorosea, seemed not to have a homologous sequence and no amplification was determined.
Table 2.4. Determination of the presence of the genes mad1, mad2 and mrt by molecular techniques. Using non-degenerated and degenerated (*) primers, the presence of the target genes was determined by amplification with PCR. The results, absence (0), presence (1), were confirmed in three different PCR amplifications. To corroborate the results obtained by PCR, a second molecular technique, a Dot-blot was applied using hybridization probes also obtained by amplification with non- and degenerated (*) primers. Scoring for the Dot-blot is absence (-), presence (+).
PCR Dot-blot
Collection N° Species MAD1* MAD2* MRT1 MRT2* MAD1* MAD2* MRT1 MRT2*
A1080 Metarhizium anisopliae 1 1 1 1 + + + +
F30 Metarhizium novozealandicum 0 0 1 1 + + + + Bb18 Beauveria bassiana 0 0 0 0 - + + - Bb21 Beauveria bassiana 0 0 0 0 - - + - BK41 Metarhizium guizhouense 1 1 1 1 + + + + F31 Metarhizium novozealandicum 0 0 1 1 + + + + F11 Metarhizium novozealandicum 0 0 1 1 - + - - F120 Metarhizium robertsii 1 1 1 1 + + + + F133 Metarhizium novozealandicum 0 0 1 1 + + + + F137 Metarhizium brunneum 1 1 1 0 + + + + F138 Metarhizium robertsii 1 1 1 0 + + + + F142 Metarhizium guizhouense 1 1 1 1 + + + + F144 Isaria fumosorosea 0 0 0 0 + + + + F148 Metarhizium novozealandicum 0 0 1 1 + + + + F16 Metarhizium guizhouense 1 1 1 1 + + + + F178 Metarhizium novozealandicum 0 0 1 1 + + + + F264 Metarhizium novozealandicum 0 0 1 1 + - + + F327 Trichoderma harzianum 0 0 0 0 - - + - F387 Metarhizium novozealandicum 0 0 1 1 + + + + F401 Metarhizium novozealandicum 0 0 1 1 + + + + F447 Metarhizium robertsii 1 1 1 1 + + + + F628 Metarhizium novozealandicum 0 0 1 1 + - + + F672 Metarhizium anisopliae 1 1 1 0 + + + + F98 Metarhizium novozealandicum 0 0 1 1 + + + + F99 Metarhizium novozealandicum 0 0 1 1 + + + +
MFI Metarhizium novozealandicum 0 0 1 1 + + + +
MW#2 Metarhizium frigidum 0 0 0 1 - - + +
The mad2 gene, related with the ability of the fungi to attach to plant surfaces occurred in 31% of the isolates, and only in those that previously had had amplification of the mad1 gene. On the other hand, the gene which putatively confers the ability of fungi to assimilate sugars from roots exudates, mrt, was widely distributed among the different species and detected in 80% of the isolates. The gene seemed to be present in all Metarhizium isolates except for the isolates M. frigidum MW#2 and MW#8. In the case of the other genera, both B. bassiana isolates, T. harzianum F327 and I. fumosorosea F144, the gene mrt was not amplified with the PCR conditions used. The use of degenerated primers for the
Metarhizium raffinose transporter, mrt2*, allowed amplification in all the Metarhizium isolates, but
not for the other genera (Table 2.4).
The M. novozealandicum clade was the only where none of the isolates had amplification of mad1 and
mad2, although all of them were isolated from insects, except for the F133 isolate obtained from soil.
On the other hand, isolates from this clade, did have the mrt1 and mrt2 genes. Another two isolates obtained from insects that had the mrt gene but not mad1 and mad2 were in M. frigidum.
Comparison between PCR results and Dot-blot showed several results where one was negative and other positive. In general dot-blot is less discriminating as hybridisation can occur with less than exact matches, whereas PCR requires exact or nearly exact primer matches to the gene of interest.
The probes for each gene mad1, mad2 and mrt were obtained through a touchdown PCR. The incorporation of the digoxigenin-11-dUTP increased the molecular weight in the amplifying sequence and in a gel electrophoresis the probe runs slower when compared to same unlabelled DNA sequence (Figure 2.6).
Figure 2.6 Hybridization probes for the Dot-blot technique. The probes of the corresponding genes
mrt1, mad1, mad2 and mrt2 were obtained through amplification by PCR with marked
nucleotides. The product of the PCR was run in a gel of agarose (2%) together with the amplicon of the same sequence but using normal nucleotides. Hybridization probes: 1, 2, 3, 4, 5, 6, 7, and 8; F447, amplicon using normal nucleotides.
The Dot-blot also requires a high concentration of genomic DNA to be hybridized to the nitrocellulose membrane. In previous studies it was determined that around 300 ng/mL of pure genomic DNA would be necessary. The concentration of DNA (ng/µL) obtained after extraction and the volume necessary to apply onto the nitrocellulose membrane to reach the appropriated final DNA concentration are in the Table 2.5.
Table 2.5. DNA concentration obtained after extraction.
Collection N° Species DNAo (ng/µl)
Vol. (µl)
DNAf (ng/µl) A1080 Metarhizium anisopliae 124 2.5 310 F30 Metarhizium novozealandicum 324 1.5 486 Bb18 Beauveria bassiana 370 1.5 555 Bb21 Beauveria bassiana 422 1.5 633 Bk41 Metarhizium guizhouense 234 1.5 351 F31 Metarhizium novozealandicum 394 1.5 591 F11 Metarhizium novozealandicum 79.2 4.0 317 F120 Metarhizium robertsii 166 2.0 332 F133 Metarhizium novozealandicum 418 1.5 627 F137 Metarhizium brunneum 238 1.5 357 F138 Metarhizium robertsii 256 1.5 384 F142 Metarhizium guizhouense 117 2.0 234 F144 Isaria fumosorosea 360 1.5 540 F148 Metarhizium novozealandicum 542 1.5 813 F16 Metarhizium guizhouense 234 2.0 468 F178 Metarhizium novozealandicum 302 1.5 453 F264 Metarhizium novozealandicum 428 1.5 642 F387 Metarhizium novozealandicum 462 1.5 693 F401 Metarhizium novozealandicum 416 1.5 624 F628 Metarhizium novozealandicum 372 1.5 558 F672 Metarhizium anisopliae 114 3.0 342 F98 Metarhizium novozealandicum 336 1.5 504 F99 Metarhizium novozealandicum 310 1.5 465 F327 Trichoderma harzianum 332 1.5 498 F447 Metarhizium robertsii 388 2 776
MFI Metarhizium novozealandicum 994 1.5 1491 MW#2 Metarhizium frigidum 318 1.5 477 MW#8 Metarhizium frigidum 264 1.5 396
DNAo, DNA concentration after extraction; Vol, volume applied of DNA to the nitrocellulose membrane; DNAf, final concentration of DNA in the dot blot.
According to the results obtained with the Dot-blot technique, the mad1 gene for adherence to the insect cuticle was found in 79% of the samples (Table 2.4). The exceptions were B. bassiana, M.
novozealandicum F11, T. harzianum F327 and both M. frigidum isolates. The mad2 gene, related to
adherence to the plant surface, was also widely distributed among the different genera found in 82% of the isolates. The mrt gene was present in all the isolates but not in M. novozealandicum F11. When the same gene was targeted but using the probe obtained with degenerated primers it was not detected in M. novozealandicum F11, in B. bassiana (Bb18 and Bb21) or in T. harzianum F327 (Table 2.4).
Considering the results obtained from the Dot-blot, the mad1 gene of insect adherence seems to be widely distributed among the Metarhizium spp. except for M. frigidum. Also, the gene related with attachment of Metarhizium spp. to plant surfaces, or the gene related with the transport of sugars from the plant to the fungal hyphae seemed also to be present in almost all the Metarhizium isolates.
Despite the fact that both techniques used for determination of the presence of the genes in the isolates, amplification by PCR and hybridization by Dot-blot, had differences in the number of positives obtained for both the mad1 and mad2 genes, both techniques agree with the high frequency that the
mrt gene is distributed in the different Metarhizium species. Additionally, the genes mad1, mad2 and
the mrt seem to have uniformly distributed among the isolates in the PARB and MGT clades. The M.
frigidum seemed to lack only the mad2 gene, while some isolates of the M. novozealandicum clade
might not have the mad2 gene.