• No se han encontrado resultados

CAPÍTULO V ANÁLISIS Y DISCUSIÓN DE RESULTADOS

5.3 Análisis de resultados del diagnóstico de desperdicios y fuentes

Three MPSIL0294 variants were designed to allow for a consistent method of expression and purification to be utilised. Restriction sites were chosen which allowed the inclusion of a C- terminal polyhistidine tag consisting of 8 histidine residues in tandem downstream from the various newly introduced tags on all three proteins. The MPSIL0294 open reading frame was placed under the control of the lac operon thereby allowing its expression to be controlled via IPTG or auto-induction. A human rhinovirus 3C protease (HRV-3C) motif was engineered downstream of the polyhistidine and other tags. All of these features were included in plasmid construct pBPT0294-CVH designed by Dr. Cheng Ma (Ma 2013).

Two of the three MPSIL0294 constructs were derived from pBPT0294-CVH along with two commercially purchased open reading frames for AtPH01_SPX_Avitag and TaALMT1-CTD which provided the avitag and SBP tag via sub-cloning. Initially a double restriction digest using Hind III and AvrII was performed on pBPT0294-CVH, AtPH01_SPX_Avitag and TaALMT1-CTD (see section 2.3.3). The resultant pBPT0294-CVH fragment was then ligated with either the

AtPH01_SPX_Avitag fragment or the TaALMT1-CTD fragment thereby creating the intermediate plasmids pL50 and pL51 respectively (see Figure 3.2).

While the original pBPT0294-CVH plasmid has two BamHI cut sites PL50 and PL51 have a single unique BamHI site (see Figure 3.2). Therefore a BamHI restriction analysis was used as a method to confirm the construction of pL50 and pL51 on a 1% agarose gel (see section 2.3.4). When digested by BamHI, pBPT0294-CVH produced two DNA fragments while pL50 and pL51 produced only one (see Figure 3.3).

Figure 3.1: Plasmid maps of pBPT0294-CVH, AtPH01-SPX avitag and ALMT CTD SBP: The plasmid constructs of

pBPT0294-CVH developed by Dr. Cheng Ma, and the purchased open reading frames of AtPH01_SPX_Avitag and TaALMT1-CTD. In order to produce the two of the three MPSIL0294 variants, a HindIII/ AvrII double restriction digest was performed initially upon pBPT0294-CVH and a resultant fragment was ligated with those produced by AtPH01_SPX_Avitag and TaALMT1-CTD. Within the blue box are the fragments of each DNA construct which were used after digestion with HindIII and AvrII. For clarity all restriction cut sites other than HindIII, AvrII, BamHI and PstI in pBPT0294-CVH have been removed.

Figure 3.2 Plasmid Maps of pL50 and pL51: The resultant plasmids produced as a consequence of the ligation between AvrII/HindIII fragments of pBPT0294-CVH and AtPH01_SPX_Avitag resulting in pL50 or those of pBPT0294-CVH and TaALMT1-CTD resulting in pL51. All restriction cut sites have been removed except for those relevant to the cloning strategy. These intermediate plasmids successfully place an avitag (in the case of pL50) and a SBP tag (pL51) into the expression vector but also unwanted genes such as AtPH01 SPX domain (pL50) and ALMT C-terminal domain (pL51). They also no longer contain the reading frame of MPSIL0294.

Figure 3.3 BamHI analysis of pBPT0294, pL50 and pL51: A BamHI digestion was carried out on samples of the

newly constructed intermediate plasmids pL50 (A) and pL51 (B). The resultant DNA fragments were analysed on a 1% agarose gel stained with SYBR®SAFE from life technologies and visualised with the G-Box from SynGene.

pL50 contained the open reading frame for AtPH01_SPX domain which plays a role in phosphatase homeostasis in eukaryotes (Secco, Wang et al. 2012) and is not relevant to this study but introduced an avitag sequence upstream from the polyhistidine-tag. pL51 on the other hand contained the open reading frame of ALMT, a transporter in plants, which plays a

role in aluminium tolerance (Ma and Furukawa 2003). Once again this protein is not relevant to this study but provided the SBP tag (see Figure 3.2).

In order to construct plasmids in which the MPSIL0294 gene was upstream from the desired tags, the irrelevant genes were switched with MPSIL0294 using an AvrII and PstI double restriction digest on pBPT0294-CVH, pL50 and pL51. The enzymes removed the open reading frames of MPSIL0294, the AtPH01 SPX domain and the ALMT from the plasmids (see Figure 3.1

and 3.2). The MPSIL0294 fragment was then ligated with the PL50 fragment (thereby creating

PVA1 MPSIL0294-avitag) and the PL51 fragment (creating PVA2 – MPSIL0294-SBP) (see Figure

3.4).

The insertion of the MPSIL0294 fragment re-introduced a BamHI site thereby allowing pVA1 and pVA2 to be distinguished from pL50 and pL51 once again via BamHI restriction analysis (see Figure 3.5).

Figure 3.4 Plasmid maps of pVA1 and pVA2: The final plasmids which place MPSIL0294 upstream from either an avitag (pVA1) or a SBP tag (pVA2), while removing the unwanted genes from pL50 and pL51. For clarity all restriction sites other those used throughout the cloning strategy have been removed.

Figure 3.5 BamHI analysis of pL50, pL51, pVA1 and pVA2: Plasmids pVA1 (A) and pVA2 (B) were digested with BamHI in order to check that the two MPSIL0294 constructs had successfully been made. The plasmid fragments were analysed on a 1% agarose gel stained with SYBR®SAFE from life technologies and visualised under UV with the G-Box from SynGene.

In the case of the MPSIL0294-V532C, site directed mutagenesis was used in order to replace a C-terminal valine with an accessible cysteine residue. The original MPSIL0294 plasmid - pBPT0294-CVH was used as the template DNA (see section 2.3.10) and utilised the following mutagenic primers:

Forward: 5' GAGCAACAAGTAGAGGAGTGTAAACCTGCAGGACTAG 3' Reverse: 5' CTAGTCCTGCAGGTTTACACTCCTCTACTTGTTGCTC 3'

(Mismatched nucleotides have been highlighted in red; their melting temperature was 78.3°C and had a GC content of 48.65%)

Samples from the mutagenesis experiment were analysed and found to only produce an amplification product when the mutagenesis procedure was carried out at 60 or 65°C (see

Figure 2.3.10). Once the methylated template DNA was removed via DpnI digestion, the newly

mutagenized DNA was amplified in OmniMax2 (see section 2.3.8).

Samples of each pVA1, pVA2 and pVA3 were then sent for sequencing via Source Bioscience using primers pTACF and pTACR (see section 2.3.11). While sequencing confirmed the correct construction pVA1 and pVA2, it showed that all of the pVA3 plasmids suffered from random

insertions of nucleotides into the plasmid thus rendering them unusable. Fortunately the desired codon substitution in MPSIL0294 had been successful while the arbitrary nucleotide insertions occurred upstream of a PstI/Sbf-I cut site. Therefore a double restriction digestion with AvrII and Sbf-I and subsequent ligation was performed on pVA3 and pBPT0294-CVH in order to switch the wild type MPSIL0294 gene with the mutant. The correct construction of pVA3 was confirmed via sequencing with the pTACF and pTACR sequencing primers (see

section 2.3.11).