• No se han encontrado resultados

3. INTRODUCCION

3.1. ANALISIS DE TEXTOS SELECCIONADOS

3.1.1. ANALISIS CONCEPTUAL

The research on ectomycorrhizae (EM) received a great impulse in the last 40 years thanks to the work of many scientists. The first morphological investigation together with the latest ecological, physiological and genetic studies widened the information now available, but the progresses in the anatomical identification of the fungi is a prerequisite of the studies of EM communities (De Roman et al., 2005). The molecular analysis are not sufficient and not always efficient or reliable to classify the species, and morphological in combination with anatomical features have a fundamental role to understand the fungal structure and its different developmental stages on the host. Since the beginning of ectomycorrhizal symbiosis research in the late 19th century, a lot of EM morphotypes have been more or less accurately described, and few authors tried to create a classification systems and to develop identification keys similar to that available for plants and animals, but this was a difficult task (De Roman et al., 2005). The first attempt was made by Dominik (1969) and a few years later Zak (1973) attested that a detailed description of each EM was essential for the identification. Goodman et al. (1996–2000) realized concise Descriptions of North American Ectomycorrhizas, and the descriptions published according to this system were more detailed than those in Ingleby et al. (1990), but they lacked the level of detail. In the year 1986 Agerer (1986, 1987–2006, 1994, 1999) began to publish guidelines for the systematic descriptions and identification of EM that are widely used nowadays (De Roman et al., 2005). In addition, Agerer created a binomial nomenclature system for those EM described but not yet identified, edited a Colour Atlas of Ectomycorrhizas (Agerer 1987–2006) with photographs of the EM to facilitate identification by comparison, and developed a synoptic key and determine EM (Agerer & Rambold 1998, 2004-2007).

Some 5.000-6.000 fungal species are estimated to be ectomycorrhizal fungi (Molina et al. 1992; Taylor & Alexander 2005), but only a small portion of them has been investigated by anatomical studies (Agerer 2006). The most important informative ectomycorrhizal features for the recognition of fungal relationships are:

a) structure of the mantle layer as seen in plan view; b) structure of rhizomorphs;

c) shape of cystidia;

d) features of emanating hyphae.

In addition all the anatomical features, can be used to characterize EM, in particular those including hyphae (Agerer 2006). Recent investigations about the ecological function of the symbiotic species in the ecosystem, gave the possibility to apply putatively ecologically important features as expressed by their exploration types (Agerer 2001). Up to now only Brand (1991) published a more detailed contribution to the ectomycorrhize on Fagus sylvatica L., with 23 descriptions. Here we present the structure of the community discovered in beech coppices of different age in the Province of Trento (Trentino-Südtirol Region in Italy), thanks to three years of research on this topic.

2. Methods

The collected rootlets were carefully cleaned from adehring soil and debris in tap water. Under a stereomicroscope connected to digitals cameras the EM were sorted at first into morphotypes based on colour, occurence and abundance of cystidia, emanating hyphae and rhizomorphs (Agerer 1987- 2006, Agerer 1991). Furthermore several root tips of each morphotype per sample were anatomotyped following Agerer (1991). These analyses were completed within 12 days after sampling. Also the available literature was used to classify the anatomotypes (Goodman et al. 1996- 2000; Agerer 1987-2006; Cairney & Chambers 1999; Brand 1991, Agerer & Rambold 2004-2007; Haug et al., 1994). Subsenquently, EM were classified into exploration types (Agerer 2001) and we noted the hydrophobicity attitude according Unestam (1991).The anotomotypes unidentified by molecular or anatomical tools, were classified by an alphanumerical code (EDMxx). For the other anatomotypes we wrote the name and the alphanumerical code. Sequences taxon categories were assigned as follows: sequence similarity of 100% (= identification to species level) sequence to similarity of 95% to 99% (= identification to genus level) sequence similarity of < 95% (= identification to family or ordinal level).

DNA extraction, amplification and sequencing.—DNA was extracted from organs of

ectomycorrhizae after Gardes and Bruns (1993) using a Quiagen DNeasy plant Mini Kit (Quiagen, Hilden, Germany), according to the manufacturer’s instructions. PCR amplification was performed for internal transcribed spacers ITS1, ITS2, and for 5.8S region of the nuclear ribosomal DNA, using basidiomycete specific primer pairs ITS1F (5´ cttggtcatttagaggaagtaa 3´) and ITS4B (5´tcctccgcttattgatatgc 3´). PCR amplification was performed using a Ready To GoTM beads (Amersham Pharamacia Biotech., Piscataway, New Jersey), with 20 µm of PCR solution (composed of 120 µm ddH2O, 30 µl buffer, 21,6 µl MgCl, 12 µm ITS1F, 12 µl ITS4B, 30 µl dNTP-Mix and 2,4 µm Taq-Polymerase) and 5 µl extracted DNA. The PCR was programmed as follows: 95 °C for 5 min, [90° 30 sec, 55 °C for 30 sec, 72 °C for 1 min (+ 2 sec for each cycle): 35 cycles], 72°C for 10 min,16 °C infinitely (Tedersoo et al., 2006). Amplified PCR products (2 µl) were run with bromophenol blue (2 µl) on 1% agarose gels for 30 min at 95 W, then stained in ethidium bromide for 10 min and afterward in ddH2O for 1 min. PCR products were then visualised under the UV light. Successful DNA bands were purified using the QIAquick-PCR purification Kit (Qiagen GmbH, Hilden, Germany) according to manufacturer’s instructions. DNA sequencing was performed by the sequencing service of the Institute for Genetics, Department Biology I (Ludwig- Maximilians-Universität, München), using BigDye Terminator Ready Reaction Cycles Sequencing Kit v3.1 (Applied Biosystems, Foster City, CA, USA). Sequencing was performed on 6,7 µm DNA probes plus 0.3 µ m ITS1F (forward) and 0.3 µm ITS4B (reverse). DNA sequences were aligned pairwise using the BIOEDIT (Bioedit Sequence Alignment Editor for Windows 95/98/NT/XP). Consensus sequences were compared with sequences from the GenBank databsase with BLASTn (National Center for Biotechnology Informations) or UNITE (Kõljalg et al., 2005) and in most case were blasted against both databases.

The anatomotypes are stored in FEA in the TeSAF Department Herbarium of the University of Padua.

Documento similar