• No se han encontrado resultados

The single spore isolates produced in Section 2.2.2.2 were initially grouped into L. maculans or L. biglobosa based on their culture morphology after 14 days growth on PDA at 15°C in 24 h darkness. Leptosphaeria maculans isolates characteristically produce white mycelium with a dark green underside and pycnidia, with no pigment produced in the growth media. Leptosphaeria biglobosa isolates produce white fluffy mycelium and pycnidia, and also produce yellow pigment in the growth media. The colonies of L. maculans grow more slowly than those of L. biglobosa,

with diameter growth of approximately 0.4-1.5 mm/day and 1.6-3.1 mm/day, respectively (Humpherson-Jones, 1983). To confirm the species identity representative isolates for both morphological groups were selected.

2.2.6 Identification of Leptosphaeria spp. isolates by molecular techniques

2.2.6.1 Isolates selection

To confirm morphological identification (Section 2.2.5) of isolates as either L. maculans or L. biglobosa, species-specific polymerase chain reaction (PCR) using species-specific primers (LmacF, LmacR and LbigF) was done. Forty representative L. maculans isolates from different regions and host plants, including two ICMP isolates, as well as four L. biglobosa isolates (three recovered during sampling and one ICMP isolate), were identified using species-specific PCR. In addition, one isolate each from the other species commonly isolated from brassica leaf lesion/stem cankers (Alternaria spp., Fusarium spp. and Phoma spp.) were included in the PCR. For further confirmation of pathogen species identity, the ITS, actin and β-tubulin genes regions of four randomly selected L. maculans isolates and all four L. biglobosa isolates was amplified and PCR products were sequenced.

20

2.2.6.2 Genomic DNA extraction

Single spore isolates were grown on PDA and incubated at 15°C in 24 h darkness for 7 days. Five mycelia plugs were cut from the edge of each actively growing culture and subcultured in potato dextrose broth (PDB; DifcoTM New Jersey, United State) in deep Petri dishes (25 mm depth; Labserv, Thermo Fisher Scientific). These PDB cultures were incubated at 15°C in 24 h darkness. After 5 days or when the mycelia had grown to approximately 2-3 cm in diameter, the cultures were harvested using sterile micropipette tips and transferred onto a sterile MiraclothTM on top of 10-20 absorbent paper towels. The Miracloth™/paper towel layers were folded and pressed for a few second until excess PDB was absorbed. The agar plugs were removed from the pressed mycelia and the remaining mycelia were wrapped in aluminium foil, labelled, snap frozen in liquid nitrogen and stored at -80°C until used for DNA extraction.

The extraction of the genomic DNA was done using the Puregene® system (Gentra systems, Minneapolis, USA). Approximately 100 mg of freeze-dried mycelium was ground to a fine powder in liquid nitrogen using a mortar and pestle. The ground mycelium was placed into a pre-cooled 1.7 mL tube and 500 µL of Cell Lysis solution added, mixed by pipetting the mixture several times and incubated in a water bath at 65°C for 1 h. The tubes were then removed from the water bath, inverted 10 times and 1.5 µL of RNAse (10 mg/mL, Invitrogen) added. The samples were inverted 25 times to mix and incubated at 37°C for 15-30 min. The tubes were cooled to room temperature and 167 µL of Protein Precipitation solution was added to each cell lysate and mixed by vortexing for 20 s. The tubes were centrifuged at 16,000 g for 3 min and the supernatants transferred to new 1.7 mL tubes. The DNA was precipitated by adding 500 µL of ice-cold isopropanol to each tube, inverting 30-50 times and centrifuging at 16,000 g for 1 min to pellet the DNA. The supernatants were decanted and the tubes were drained carefully onto clean absorbent paper towels. Then, the DNA pellets were washed by adding 300 µL ice-cold 70% ethanol, inverting the tubes gently (~10 times), and then centrifuged at 16,000 g for 1 min. The ethanol was carefully decanted and the DNA pellets in each tube were air-dried for 15 min. Finally, 30 µL of sterile nanopure water (SNW) was added to each tube.

2.2.6.3 DNA concentration

The DNA concentration in each tube was determined by spectrophotometry (Nanodrop 3.0.0 spectrophotometer; Nanodrop Technologies Inc., Delaware, USA). All DNA samples were diluted to 20-25 ng/µL using SNW for use in PCR.

2.2.6.4 Species-specific PCR

For the species identification, DNA from the L. maculans/L. biglobosa isolates was amplified using two forward species-specific primers, LmacF (5’ – CTTGCCCACCAATTGGATCCCCTA – 3’) and LbigF (5’ – ATCAGGGGATTGGTGTCAGCAGTTGA – 3’), and a single reverse primer LmacR (5’ - GCAAAATGTGCTGCGCTCCAGG – 3’) (Liu et al., 2006). Amplification of the DNA extract was done in a 25 µL final volume which contained 1 × PCR buffer (Roche Diagnostics, Basel, Switzerland), 200 µM of each dNTP, 5 pmoles of each of the primers, 1 U FastStart Taq DNA polymerase (Roche Diagnostics, Basel, Switzerland) and 20-25 ng/µL DNA. A

21 negative control in which SNW was added instead of DNA was included in every PCR. Samples were briefly vortexed and centrifuged at 3,220 g for approximately 5 s before placing into the PCR machine (Applied Biosystem Veriti, 96 Wells Thermo Cycler). The PCR temperature regime used was, 95°C for 3 min of denaturation period, followed by 30 cycles of 95°C for 15 s, 70°C for 30 s and 72°C for 1 min, followed by an additional extension period of 72°C for 10 min (Liu et al.,

2006).

After amplification, the PCR products (7 µL of each) were separated on a 1% agarose gel using 1× TAE buffer (40 mM Tris acetate, 2 mM Na2EDTA, pH 8.5) at 10 V/cm for 45 min. A 1 Kb Plus DNA LadderTM (0.1 ng/µL; Invitrogen, California) molecular weight marker was loaded in the first lane of each gel and the negative control loaded in the last lane. Then, the agarose gel was

transferred to plastic container containing ethidium bromide (0.5µg/mL), allowed to stain in a shaker for 15 min and then destained in water for 10 min. The stained gels were photographed under UV light using FireReader UVITEX Cambridge.

2.2.6.5 PCR and sequencing of ITS, β-tubulin and elongation factor regions

For further species confirmation, the ITS, actin and β-tubulin gene regions of four isolates from each L. maculans and L. biglobosa were amplified using paired primers for each region (Table 2.1) and performed as described in above section. The PCR temperature regime for ITS was 94°C for 3 min, then 30 cycles of 94°C for 30 s, 50°C for 30 s, 72°C for 1 min and final extension at 72°C for 10 min. The PCR temperature regime for actin and β-tubulin gene regions was 5 min at 95°C, followed by 30 cycles of 30 s at 95°C, 1 min at 52°C, and 1 min at 72°C with a final extension of 5 min at 72°C. The PCR products were also separated on a 1% agarose gel as described above.

Table 2.1 Nucleotides sequences of the paired primers used for DNA amplification for sequencing of the ITS, actin and β-tubulin gene regions.

Primers Sequences Source

ITS ITS4 (5’ – TCCTCCGCTTATTGATATGC – 3’ ITS5 (5’ - GGAAGTAAAAGTCGTAACAAGG – 3’) Calderon et al., 2002; White et al., 1990 Actin gene region 5’ – TGGGACGATATGGAIAAIATCTGGCA – 3’ 5’ – TTAGAAGCACTTNCGGTG – 3’ Voigt et al., 2005 β-tubulin gene region 5’ – CARGCYGGTCARTGYGGTAACCA – 3’ 5’ – GCCTCAGTRAAYTCCATYTCRTCCAT – 3’ Voigt et al., 2005

The PCR products were sequenced at the Lincoln University Sequencing Facility using an ABI PRISM® 310 Genetic Analyzer (Applied Biosystems, Foster City, California). The resulting sequences and chromatographs were analysed using DNAMAN 5.2 (Lynnon Biosoft©) and Chromas Lite 2.1© (Technelysium PTY Ltd) software. Sequences obtained from this study were aligned with sequences from the NCBI database (www.ncbi.nlm.nih.gov) using MEGA 5. A different species was included as an out-group and included in the phylogenetic tree. A neighbour

22 joining tree was generated using the sequences of the New Zealand isolates and the sequences of representative L. maculans and L. biglobosa isolates used by Vincenot et al. (2008) retrieved from GenBank.

Documento similar