Characterization of PgChP, a novel chitosanase with antifungal activity from Penicillium chrysogenum

Characterization of PgChP, a novel chitosanase with antifungal activity

from Penicillium chrysogenum

Andrea Rodríguez-Martín, Susan Liddella_{, Raquel Acosta, Félix Núñez, Miguel A.} Asensio*

Higiene y Seguridad Alimentaria, Facultad de Veterinaria. Universidad de Extremadura, Avda. de la Universidad, s/n. 10071- Cáceres, Spain.

a _{Division of Animal Sciences, University of Nottingham. Sutton Bonington Campus. Loughborough,}

Leicestershire. LE12 5RD. United Kingdom.

* Corresponding author: Telephone (+34) 927 257 125; fax: (+34) 927 257 110. E-mail: [email protected]

ABSTRACT

A new fungal chitosanase with antifungal activity, PgChP from Penicillium chrysogenum, is described. Two isoforms were found by SDS-PAGE in the purified extract of PgChP. After enzymatic deglycosylation only the smaller isoform was observed by SDS-PAGE. Identical amino acid sequences were obtained from the two proteins and these showed a high similarity with fungal chitosanases. Analysis of the molecular mass by electrospray ionization mass spectrometry (ESI-MS) revealed the existence of six peaks from 30 to 31 kDa differentiated by a mass multiple of 162 Da, the typical mass of galactose or mannose residues. This could be due to different levels of glycosylation of the same protein PgChP. The isoelectric point was aproximately pH 5 estimated by two-dimensional polyacrylamide gel electrophoresis. PgChP is the first chitosanase to be described from P. chrysogenum. KEY WORDS: antifungal protein, food preservative, glycosylation, N-linked oligosaccharides, protective culture, toxigenic mould.

INTRODUCTION

The antifungal protein PgChP was selected in previous studies (Acosta et al., 2009a) from the strain AS51D isolated from dry-cured ham and characterized as Penicillium chrysogenum according to classical taxonomical methods (Pitt and Hocking, 1997). PgChP was purified by fast protein liquid chomatography and showed antifungal activity against selected toxigenic moulds (Acosta et al., 2009a).

Antifungal proteins have been described from diverse organisms including plants and animals, but only scant information is available about antifungal proteins of fungal origin. Many antifungal proteins have interesting applications because they attack compounds of fungal walls that are not present in mammalian cells, such as glucanases, chitinases and chitosanases (Adams, 2004). Fungal infections and contaminations have led to an increasing demand for antifungal drugs in diverse fields including agriculture, medicine and food protection. Many antifungal drugs have low efficacy rates, show severe side effects and cause resistance on the microorganisms, as antibiotics (Meyer, 2008). This makes it necessary to study new compounds, including fungal proteins such as PgChP. However, before any application of PgChP, an exhaustive characterization of the protein is required.

In previous studies, another antifungal protein from P. chrysogenum, named PgAFP, showed evidence of glycosylation by periodic acid-Schiff staining (Acosta et al., 2009b). Glycan chains in glycoproteins participate in many biological processes, such as protein interactions, or confer stability on the protein against proteases or heat treatments (Morelle et al., 2006). These modifications introduce variations in the molecular mass and net charge of the protein. Enzymatic and chemical deglycosylation treatments followed by SDS-PAGE and electrospray ionization mass spectrometry are commonly used to evaluate this sort of post-translational modification (Claverol et al., 2003). Additional information on the molecular mass and amino acid sequences is typically obtained by mass spectrometry after digestion in-gel or in-solution with proteolytic enzymes (Habermann et al., 2004).

This paper describes the amino acid sequencing, molecular mass determination and isoelectric point estimation of the antifungal protein PgChP.

MATERIALS AND METHODS Microbial strain

P. chrysogenum AS51D was isolated from dry-cured ham, being identified according to classical morphological and biochemical studies (Acosta et al., 2009a).

Genetic identification of the mould

Genetic characterization of AS51D was carried out by amplifying the fragments 18S-28S rRNA intergenic spacer (ITS) by polymerase chain reaction (White et al., 1990).

DNA isolation. The mould AS51D was grown in malt extract broth, made of glucose 2% (w/v), malt extract 2% (w/v), and peptone 0.1% (w/v), pH 4.5, at 25ºC for 5 days. Two grams of mycelium were broken with morter and pestle after freezing by adding liquid nitrogen. Lysis was performed by homogenizing the powder in 4 ml 0.05 M Tris-HCl, pH 8, 0.005 M ethylenediamine tetraacetic acid (EDTA), 0.05 M NaCl (TES) buffer and 1% (w/v) sodium dodecyl sulfate (SDS). Afterwards, 200 µl proteinase K (20 µg/µl) was added, and the mixture was incubated at 60ºC for 35 min, cooled on ice and extracted with phenol-chloroform-isoamyl alcohol (25:24:1). The suspension was centrifuged at 3,000 ×g for 2 min at 4ºC. The upper phase containing DNA was transferred to a fresh tube and precipitated by the addition of 3 M sodium acetate pH 5.2 to a final concentration of 10% (w/v) and two volumes of cold ethanol. After centrifugation, the pellet was washed with 70% (v/v) ethanol, centrifuged again in the conditions mentioned above, resuspended in sterile water and treated with 50 µl RNase (10 µg/µl) at 37ºC for 60 min. Finally, DNA was extracted with phenol-chloroform-isoamyl alcohol and precipitated again as indicated above, resuspended in water and stored at -70ºC. The quantity and quality of purified DNA was determined spectrophotometrically in a Biophotometer (Eppendorf AG, Hamburg, Germany).

ITS amplification. PCR fragments for sequence analysis were obtained using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) covering the internal transcribed spacer 1 (ITS1) region, 5.8S, and ITS2 region of the ribosomal DNA. For each 50 µl reaction, a mixture was prepared containing 50 ng of genomic DNA,

0.1 vol. of 10× PCR buffer (10 mM Tris-HCl, pH 8.8, 50 mM KCl, 0.1% Triton X-100), 4 mM MgCl2, 1 mM of deoxynucleoside triphosphates (Roche, Mannheim, Germany), 0.4

µM of each primer, and 2 U of DyNAzyme I DNA Polymerase (Finnzymes, Espoo, Finland). Reactions were run on a programmable thermal cycler Mastercycler epgradient (Eppendorf AG) with an initial denaturation of 3 min at 96°C, followed by 30 cycles at 94°C for 30 s, 60°C for 30 s, and 72°C for 40 s, with a final extension at 72°C for 10 min. Aliquots of the PCR were electrophoresed on 2% (w/v) agarose gels in 1× TAE buffer (40 mM Tris-acetate, 1 mM EDTA) pH 8, using a Sub-Cell GT apparatus (Bio-rad Laboratories, Hercules, USA). Products were visualized using the UV transillumination G-

Box (Syngene, Fredericks, USA) and photographed with a GeneSnap camera (Syngene). DNA fragments were gel-purified and sequenced at the Institute of Biomedicine (CSIC, Valencia, Spain). The sequences obtained were searched against the public databases using the Basic Local Alignment Search Tool (BLAST).

PgChP purification

P. chrysogenum AS51D was grown in malt extract broth at 25ºC for 15 days. The medium was filtered through a 0.45 µm diameter pore size cellulose acetate membrane and PgChP

was purified using an ÄKTA fast protein liquid chromatography system (Amersham Bioscience AB, Uppsala, Sweden) according to Acosta et al. (2009a). For this, filtered medium was loaded on a HiTrap SP HP 5 ml ion exchange column (Amersham Pharmacia Biotech AB) equilibrated with 0.02 M sodium acetate buffer, pH 4.5. Bound proteins were eluted with a gradient of NaCl to 1 M (0 to 25% in 15 column volumes (CV), increasing to 100% in 2 CV, followed by 15 CV at 100%) in 0.02 M sodium acetate buffer. Eluted proteins were detected at 214 nm. The fraction that showed antifungal activity in previous studies (Acosta et al., 2009a) was purified using a HiLoad 26/60 Superdex 75 prep grade gel filtration column (Amersham Pharmacia Biotech AB) equilibrated with 50 mM sodium phosphate, 0.15 M NaCl buffer pH 7, at a constant flow rate of 2.5 ml/min. Data collection and processing were done using the UNICORN software 4.12 (Amersham Pharmacia Biotech AB). Finally, the fraction containing PgChP was desalted and concentrated with YM-10 Microcon Centrifugal Filter Units (Millipore Iberica, Madrid, Spain) and stored at - 20ºC.

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE)

SDS-PAGE was performed as described Laemmli (1970). The protein PgChP was separated on a 4% (v/v) polyacrylamide stacking and 8% (v/v) polyacrylamide resolving gel. Gels were stained with Imperial Protein Stain (Pierce Biotechnology, Rockford, USA). Two preparations of molecular weight markers were used: Precision Plus Protein Standards with ten proteins between 10 and 250 kDa (Bio-Rad) and the Low Molecular Weight Electrophoresis calibration kit with proteins between 14.4 and 97 kDa (Pharmacia, Uppsala, Sweden).

Reduction and alkylation of PgChP

Reduction and alkylation of the protein prior to deglycosylation or enzymatic digestion were performed with the protein in SDS-PAGE gel pieces or in solution. After SDS- PAGE, PgChP (25 µg per well) was stained using Imperial Protein Stain. The band was excised from the gel and washed three times by incubation in 100 µl of de-stain solution (50 mM ammonium bicarbonate, 50% acetonitrile) for 15 min at 40ºC with intermittent vortexing. Gel pieces were incubated at 56ºC in 100 µl of reducing solution (10 mM dithiothreitol in 50 mM ammonium bicarbonate) which was discarded after 45 min and replaced with 100 µl of alkylation solution (55 mM iodoacetamide in 50 mM ammonium bicarbonate) and incubation continued at room temperature in the dark for 45 min.The gel pieces were then washed in 100 µl of 50 mM ammonium bicarbonate for 5 min at 40ºC and the supernatant was discarded. The gel was washed twice in 100 µl of 50 mM ammonium bicarbonate in 50% acetonitrile for 1 min and centrifuged. Sample was dehydrated in 100 µl of acetonitrile and incubated for 1-2 min. Finally, the supernatant was discarded and the gel pieces were dried at 40ºC for a few min. After addition of the digestive enzyme, the tube containing the gel pieces was cooled at 4°C for 20 min and finally incubated at the optimal temperature of each enzyme.

For digestion of PgChP in-solution, different quantities of the protein (1.25, 2.5, and 6.25 µg) were added into tubes containing 50mM ammonium bicarbonate up to a final volume of 5 µl. Dithiothreitol 5 mM dissolved in 50 mM ammonium bicarbonate was added (5 µl) and the final solution was incubated at 50ºC for 30 min. After adding 10 µl of 20 mM iodoacetamide dissolved in 50 mM ammonium bicarbonate, sample was incubated at room temperature for 30 min in the dark before digestion with each enzyme.

Digestion with enzymes for amino acid sequencing

Trypsin digestion. Digestion with the reduced and alkylated protein was performed with PgChP in-gel and in-solution. Gel pieces containing PgChP were incubated with 10 ng/µl trypsin gold (Promega, Hampshire, United Kingdom) in 50 mM ammonium bicarbonate at 40 or 60ºC for 1.5, 3, or 16 h. Additionally, further automated in-gel digestions were carried out. For these, samples of PgChP in-gel pieces were de-stained, dehydrated, reduced, alkylated, washed, and digested using the ProteomeWorks MassPREP robotic liquid handling station (Waters, Manchester, UK), essentially as described above. For the digestion step, the microtiter plate containing the gel pieces was cooled to 6°C for 10 min

before addition of 25 µl per well of trypsin gold at 10 ng/µl. The plate was incubated at 6°C for 20 min and incubated at 37°C for 4 h. PgChP was digested in-solution by incubating at 37ºC for 16 h after adding 50 mM ammonium bicarbonate, containing 5% acetonitrile and 10 ng/µl of trypsin gold. All digested protein samples were stored at 4°C until ESI-MS analysis.

Chymotrypsin digestion. Digestion with the reduced and alkylated protein was performed with PgChP in-gel and in-solution. Gel pieces were digested at different concentrations (1, 5, 10, and 15 ng/µl) of chymotrypsin (Roche, Welwyn Garden City, UK) in buffer (100 mM Tris-HCl, 10 mM CaCl2 buffer pH 7.8), at 25ºC and 30ºC for 16 h. PgChP in-solution

was digested by chymotrypsin at 0.1, 1, 5, or 10 ng/µl with 5% (v/v) acetonitrile and the same buffer mentioned above. Temperatures and incubation time were identical to those used for in-gel sample digestions.

Analysis for glucidic residues

Chemical deglycosylation was carried out with PgChP in solution and using two different chemical methods: acid hydrolysis with HCl (Leis et al., 1997; Krapf et al., 2006) and - elimination with NaOH (Geert and Thomas-Oates, 1998; Tarelli, 2007). For acid hydrolysis with HCl, 1 µg of PgChP was incubated in 20 mM HCl at 50ºC for 3 h. - elimination with NaOH was performed by incubating 1µg of PgChP in 0.2 M NaOH at 45ºC for 16 h. Finally, both samples were analyzed by ESI-MS.

Enzymatic deglycosylation

PNGase F (New England Biolabs, Ipswich, UK) was used following the manufacturer’s instructions and samples were analyzed by SDS-PAGE.

E-DEGLY deglycosylation kit (Sigma, Madrid, Spain) contained the following deglycosylases: PNGase F, -2(3,6,8,9) neuraminidase, O-glycosidase, (1-4)-galactosidase, and −N-acetylglucosaminidase. Reactions were carried out under native and denaturing conditions according to manufacturer’s instructions and products were subjected to SDS- PAGE analysis.

Electrospray ionization mass spectrometry (ESI-MS) analysis for peptide sequence determination

After deglycosylation and enzymatic digestion, formic acid was added to a final concentration of 0.1% (v/v); then the sample was desalted using Zip-Tip C18 reverse phase

pipette tips (Millipore) according to manufacturer’s instructions. Peptides were eluted with an equal volume of 50% (v/v) acetonitrile and 0.1% (v/v) formic acid. Samples were loaded into individual borosilicate nanospray needles (Waters) using 1-10 µl GELoader pipette tips (Eppendorf) and analyzed in a Q-TOF2 mass spectrometer (Waters). ESI-MS was carried out with a capillary voltage of 900–1200 V in positive ion mode, using argon as the collision gas. Survey scans of peptide mass spectra were performed with the sampling cone set at 45–50 V and data were acquired from 400–1500 m/z with a cycle time of 2.4 seconds. Peptide mass spectra presented resulted from combining typically 5 – 15 min of data acquisition. Individual peptide ions were selected manually for tandem MS analysis. Collision voltages were optimised manually for individual peptides. Tandem MS fragmentation spectra were collected typically from 50 to 1600 m/z. Tandem MS spectra were deconvoluted into singly charged, mono-isotopic masses using the MaxENT3 maximum entropy software and peptide sequences were determined by manual interpretation using the PepSeq software within the MassLynx V 4.0 package (Waters, UK). De novo peptide sequences were searched against the public databases using BLASTP with parameter settings for “short and nearly exact matches". A multiple sequence alignment of fungal chitosanases was produced using the program T-Coffee at www.ebi.ac.uk.

Molecular weight determination by ESI-MS

The molecular weight of PgChP was determined by electrospray mass spectrometry in a Q- TOF2 mass spectrometer (Waters, UK). PgChP (0.125 µg/µl) in 1% (v/v) formic acid was desalted using C18 reverse phase pipette Zip-Tips (Millipore) according to the manufacturer’s instructions. Protein was eluted into 50% (v/v) methanol, 1% (v/v) formic acid, and loaded into nanospray needles for analysis. The mass spectrometer was operated with a capillary voltage of 900-1200 V and the sampling cone at 45-50 V. Data were acquired between 400 and 3000 m/z with a cycle time of 1 second. Mass spectra resulted from combining typically 5 min of data. Spectra were deconvoluted using the MaxEnt1

maximum entropy software with an output range of 20,000 and 40,000 Da, at a resolution of 1 Da and a peak width of 0.75 Da.

Isoelectric point estimation by 2D-PAGE

Isoelectric focusing was performed on 7cm IPG ReadyStrips pH 3–10NL (Bio-Rad). Concentrated protein (20 µg) was dissolved in a sample buffer containing 7 M urea, 2 M thiourea, 4% (w/v) CHAPS, 0.005% (w/v) bromophenol blue, 0.5% (v/v) destreak reagent (GE Healthcare, Uppsala, Sweden) and 0.5% ampholyte and incubated at room temperature for 60 min. The first-dimension separation was performed on a Protean IEF Cell System (Bio-Rad). The IPG strip was loaded using active in-gel rehydration. Electrofocusing was performed as follows: 250 V for 15 min, then at a linear gradient from 250-4,000 V for 2 h, followed by 4,000 V until a total of 18,000 V/hr was reached. The voltage decreased to a holding voltage of 500 V. After IEF, the strip was equilibrated with a sample equilibration buffer (SEB) containing 6 M urea, 375 mM Tris-HCl (pH 8.8), 2% (w/v) Sodium Dodecyl Sulphate (SDS), 30% (v/v) glycerol, and 0.0125% (w/v) bromophenol blue. In the first incubation, SEB contained 1% (w/v) dithiothreitol, after 8 min this solution was replaced with SEB containing 25% (w/v) iodoacetamide and the strip was incubated for a further 8 min. The IEF strip was placed onto 8% (v/v) polyacrylamide gels and sealed in with agarose. SDS-PAGE was then carried out at 125 V for 50 min. Proteins were visualized by staining with Imperial Protein Stain (Pierce Biotechnology) and gel images were scanned on a GS800 scanner (BioRad). Precision Plus Protein Standards (Bio-Rad) were used as molecular weight markers. A separate 2D-gel was performed with 2-D SDS-PAGE Standards (15 µl) (Bio-Rad) to provide calibrated pI points to allow estimation of the pI of PgChP.

RESULTS

Genetic characterisation of P. chrysogenum AS51D

Amplification of the 18S-28S rRNA intergenic spacer (ITS) sequence revealed a band of 585 bp, which was sequenced and compared against other sequences in BLAST. The strain AS51D displayed 100% of identity and the maximum score with the 18S-28S rRNA intergenic spacer of Penicillium chrysogenum strain FRR 807, accession number in GenBank: AY373839. Thus, AS51D was confirmed as P. chrysogenum.

Analysis of PgChP protein by SDS-PAGE

SDS-PAGE of purified PgChP to estimate the molecular mass was revealed two discrete bands (Figure 1): an intensely stained band showing a molecular mass of 37 kDa and a fainter one of around 40 kDa.

Mass spectrometric analysis of PgChP digestions

Figure 2 shows typical survey spectrum peptide profiles obtained by mass spectometry for the 37 kDa protein band digested with trypsin and chymotrypsin. The 40 kDa band was also analysed in a similar manner. Overall, the peptide mass spectrum profiles obtained for the upper and lower bands showed a high degree of similarity (Figure 3).

Figure 1. SDS-PAGE of PgChP protein, showing two bands of 40 kDa (1) and 37 kDa (2). M: Pharmacia low molecular weight standard.

Figure 2. Mass spectra showing typical peptide profiles obtained from trypsin (A) and chymotrypsin (B) digestions of PgChP (37 kDa band).

De novo amino acid sequences

Tandem MS was also performed on peptides from PgChP trypsin and chymotrypsin digestions to obtain amino acid sequences. All of the 40 kDa band peptide sequences obtained were also present in the 37 kDa band. Together with the mass spectrum profiles, the data indicated that the two bands observed on SDS-PAGE analysis were likely to represent the same protein or two very similar proteins. The 37 kDa band was subjected to extensive tandem MS analysis to provide increased amino acid sequence coverage of the protein.

A total of twelve de novo peptide sequences were obtained from trypsin and chymotrypsin digestions from the 37 kDa band and four from the 40 kDa band (Table 1).

Figure 3. Mass spectra showing the highly similar peptide profiles obtained from trypsin digestion of the 37 kDa (A) and 40 kDa (B) bands from SDS-PAGE of PgChP.

Table 1. PgChP-de novo peptide sequences obtained from trypsin and chymotrypsin digestions from 37 kDa and 40 kDa. L and I are interchangeable. Italic letters indicate amino acids which were tentative assignments.

*: Indicates sequences from the 40 kDa band.

-: indicates the presence of additional unassigned amino acids.

Sequence

Number de novo sequence

Peptide mass Charge Digestive enzyme 1 NKPDGGPPGSYF 618.29 +2 Chymotrypsin 2a -FAAGSSLPVAALQSAAAK 959.81 +3 Trypsin 2b* YFAAGSSLPVAALQSAAAK 911.48 +2 Trypsin 2c* PVAALQSAAAK 1026.61 +1 Trypsin 3 -PDATYPLDGDNGA- 866.40 +2 Trypsin 4 -TIHSDWAK 528.79 +2 Trypsin 5 -WLADMDVDCDGLD- 1139.03 +2 Trypsin 6 GNPDGQHQTNFGAL- 728.33 +2 Trypsin 7 -AAYEVPFFVIPDR 988.21 +3 Trypsin 8a GALPGNNVGAVICDGK 771.40 +2 Trypsin 8b GALPGNNVGAVICDGK 720.89 +2 Chymotrypsin 9a -PQVLGEASWLMAR 1053.50 +2 Trypsin 9b* MFYGIYGDSDGDTPQVLGEASRFFAR 972.43 +3 Trypsin

10a FTGDDSVLPSSALNK 775.87 +2 Trypsin

10b* -TYILFTGDDSVLPSSALNK 1352.95 +3 Trypsin

11 NYVTNFTTLR 614.82 +2 Trypsin

Analysis for glucidic residues

After enzymatic deglycosylation of PgChP with the PNGase F or the E-DEGLY deglycosylation kit, only the band of 37 kDa was detected (Figure 4). However, chemical deglycosylation with HCl and NaOH revealed no changes in spectra with untreated and treated PgChP by ESI-MS.

Molecular mass determination of PgChP protein by electrospray ionization mass spectrometry

ESI-MS was used to establish the accurate mass of intact PgChP. The m/z spectrum was deconvoluted and converted to the molecular mass profile using Maximum Entropy processing (Figure 5A). The mass profile shows a dominant peak of 30,771.9 Da with a series of surrounding peaks differing from each other by approximately 162 Da (Figure 5B).

Figure 4. SDS-PAGE of purified PgChP untreated (lane 1), and treated with PNGase F (lane 2). The arrow indicates the 37 kDa band which remains after deglycosylation. M: Precision Plus Protein Standard.

Figure 5. Molecular mass profile from Maximum Entropy processing of PgChP. The most abundant peak has a mass of 30771.9 Da (A). Detailed view revealing a series of peaks separated by approximately 162 Da (B). Additional peaks surrounding the major peaks represent sodium adducted forms (+/- 22 Da).

Isoelectric point estimation

2D-PAGE analysis showed that PgChP migrates on a broad pH range gel in a discrete region of the gel at approximately pH 5 (Figure 6).

DISCUSSION

In previous studies the strain AS51D was characterized as P. chrysogenum using methods based on morphology and biochemical characteristics, including the production of secondary metabolites by high performance liquid chromatography (Acosta et al., 2009a). In the present study, the sequence of the 18S-28S rRNA intergenic spacer confirmed the previous characterization. P. chrysogenum is regarded as a safe mould of starter cultures (Núñez et al., 1996; Benito et al., 2003) together with other close species, such as Penicillium nalgiovense (Geisen, 2000). To fulfill this role, AS51D could be used either as a source for antifungal proteins or as protective culture.

Figure 6. Isoelectric point (pI) determination of PgChP by 2D SDS-PAGE. A: PgChP is indicated with an arrow. B: 2D SDS-PAGE standards. Numbers within figure B indicate the pIs of 4 standard proteins that migrate as a series of spots.

A)

B)

Two bands were found in the concentrated PgChP fraction by SDS-PAGE analysis with estimated molecular weights of 37 and 40 kDa. The comparison between the amino acid sequences obtained from both bands showed a high degree of similarity (Table 1). All sequences obtained from the 40 kDa band were derived from three different regions of the 37 kDa protein: sequences 2a, 2b, and 2c in one region; 9a and 9b in a second; and 10a and 10b in a third region. Where they overlapped, peptide sequences from the 40 kDa band were identical to those from the 37 kDa band, with the only exception being for peptide 9b for which 3 of the 5 C-terminal residues could be only tentatively assigned from the