Conclusiones

5.4.1 Introduction

The amiR gene encodes a transcription antitermination factor which, under inducing conditions, mediates the extension of a short, constitutively produced leader transcript through a iho-independent transcription terminator and into the amidase operon (Drew and Lowe, 1989; Wilson and Drew, 1995). Previous evidence^ that AmiR is an RNA binding protein came from in vivo titration experiments in which it was shown that the production of ami leader RNA in trans partially saturated out the available AmiR, causing a reduction in AmiR-dependent antitermination activity (Wilson et a/., 1996). Studies of the antitermination reaction by mutant analysis have identified two critical elements, L and R, at the 5’ and 3* ends respectively of the proposed AmiR binding site on the leader transcript which are independently essential for antitermination (Figure 5.7) (Wilson et al., 1996). There is no sequence similarity between the two critical regions and thus it seems likely that the bases make contact with different domains of AmiR and not with the same region on adjacent monomers. Furthermore, it has been proposed that mechanistically binding of an AmiR dimer to the RNA in the vicinity of the terminator region disrupts the formation of the stem-loop structure sufficiently to allow transcription to proceed into amiE. Using purified AmiCVAmiR complex and continuously labeled leader RNA, RNA gel retardation assays were carried out to investigate the protein/RNA interaction.

Chapter 5: RESULTS 3 20 C G G U 80 U U A C G A C -G G -C A -U G -C C -G G -C U C -G G -C _{C -G} C -G _{C -G} G -C _{U -A} U # G C -G A G _A U # G C -G C G C -G ₁ U -A 4 A A G -C 0 G -C 0 C - G 60 G -C 0 1 A U C A G -C G A A C C U A A C G C A U A C G -C A A A U G # UUUUUU

F ig u re 5.7 RNA fold o f the leader region transcript residues 1 to 100.

Complementary residues are shown by lines and G -U interactions by filled circles (Zuker, 1989; Jaeger et al., 1989a, b). The L (36-41) and R (54-62) regions are shown in bold.

5.4.2 Ligand d e p en d e n t RNA b a n d sh ifts

Plasmid pMW42 (Figure 5.8A)(Wilson et al., 1996) was linearized with BstEIl (Figure 5.8B) and used to produce T7 RNA polymerase generated run-off, continuously labeled RNA transcripts. These were gel purified (section 2.2.3.4) to yield a single RNA species of the correct length (Figure 5.9). The concentration of labeled transcripts^ was determined spectrophotometrically. RNA gel retardation assays were initially carried out (section 2.2.3.7) using a fixed amount of labeled transcript with increasing amounts of pure AmiC/AmiR complex in the presence and absence of acetamide (Figure 5.10).

In the absence of added protein the transcript migrates as a single main band with small amounts of degradation products and smaller amounts of an apparent higher MW uncharacterised form (lane 1). Addition of the AmiC/AmiR complex to the RNA in the absence and presence of acetamide has no effect at low complex concentrations (lanes 2 to 5). However, addition of AmiC/AmiR complex at a concentration of 16.3pM AmiR dimers in the presence of acetamide leads to reduced mobility of the transcript through the gel (lane 7). This is due to the increased molecular weight provided by AmiR bound to the transcript Some transcript with reduced mobility is evident in all lanes (2 to 7) containing AmiC/AmiR complex. Since it is present in all lanes containing protein it is probably secondary structure formation stabilised by the ionic environment provided by the protein rather than by direct binding.

This result shows an acetamide dependent RNA bandshift by the AmiC/AmiR complex. One possible interpretation is that acetamide displacing butyramide in the AmiC/AmiR complex causes a structural rearrangement of the complex which exposes the RNA binding domain(s) of AmiR. A second interpretation is that acetamide binding causes complex dissociation and free AmiR binds to the RNA. The second option seems more likely at this stage for various reasons. First, AmiR by itself causes unregulated antitermination in vivo (Wilson et al., 1993). Second, in vivo titration using excess leader RNA in trans occurs in the absence of AmiC (Wilson et al., 1996). Third, the

Chapter 5: RESULTS 3 H indlll BstEII T7 pGEM4Z JLJL -3 5 - 1 0 SD am iE Termination loop

B

T7 Transcription start TAATACGACTCACTATAGGGAGACAAGCTTCCGTGCGAAT T7 Promoter _{H indin} 20 40 GATGGCATGCATGCTATCTCAGGCTCGCACCATGTGCTTT 60 80 CGCGATCGCGCCGATTACATAACGTTACACGAACCTTGAC -3 5 100 120 AGCCCCTTCCGACGGGGCTTATAAGTGGCGCCATCAGGTC -1 0 140 160 ATGCGCATCAGCGTCGATGTCGCGGGACCGAACCTAACGC 180 200 A T A C G C A CA G A G CA A A TG G G CTCTC CCG G G Figure 5.8 Plasmid pMW42.

(A) Structural map o f pMW 42, The locations o f the T7 prom oter sequence, the ami

prom oter sequences, the leader ORE, the rho-independent transcription term inator, the

am iE Shine-D algam o sequence (SD), the start o f the amiE gene, the M CS and some restiction enzyme targets are shown. (B) DNA sequence o f pM W 42, The sequence runs from the T7 prom oter to the BstEII site. Features within this sequence are underlined and labelled. The sequence o f the amidase operon leader region is num bered from the H indlll to the BstEII sites. Part o f the transcription terminator is shown in bold.

L a b e lle d tra n s c rip t

Figure 5.9 Preparative denaturing gel o f in vitro transcripts.

Lanes 1-4 are identical and contain 5.0pL o f the in vitro transcription reaction using BstEII

linearized pMW42. One main species o f RNA is evident (213 nucleotides) as indicated by the arrow, although some degradation/incomplete products are evident.

• S e c o n d a ry s tru c tu re ^ ^ 3 L a b e lle d tra n s c rip t/

A m iR c o m p le x L a b e lle d tra n s c rip t

k'" "-..« A

Figure 5.10 RNA bandshifts with pure AmiC/AmiR complex.

All lanes contain labelled transcript (26nM). Lanes 2-7 contain labelled transcript with purified AmiC/AmiR complex. Lanes 2 and 3 contain 1.6|iM AmiR dimers; lanes 4 and 5 contain 3.3|iM AmiR dimers; lanes 6 and 7 contain 16.3pM AmiR dimers. Lanes 3,5 and 7 contain acetamide (34mM).

Chapter 5: RESULTS 3

RNA bandshift is relatively small and the AmiC/AmiR complex is large and would be expected to generate a large bandshift upon binding. Fourth, the analytical gel filtration studies show complete complex dissociation upon acetamide addition (sections 5.2 and 5.3.1). Furthermore, it seems likely that the functional unit which binds RNA is an AmiR dimer since gel filtration and the crystal structure of the AmiC/AmiR complex show that AmiR exists as a dimer. It is clear from Figure 5.10 that AmiR dimers need to be in excess before an AmiR/RNA complex is seen and that the molar ratios between AmiR and RNA are non-equivalent The most probable explanation is that upon complex dissociation the majority of AmiR is forming (soluble) aggregates, as seen in the Analytical Gel Filtration experiments in section 5.3. This explanation would indicate that the affinity of AmiR for itself is higher than that for the RNA.

In order to show that AmiR RNA binding is leader RNA specific competition experiments were set up using cold specific and non-specific RNA.

5.4.3 AmlR/RNA specificity stu d ie s

5.4.3.1 Cold specific RNA competition

Cold specific RNA transcripts were generated using pMW42 linearised with BstEII as a template (section 2.2.3.6). The concentration of cold transcripts^ was determined spectrophotometrically. RNA gel retardation assays performed using 8nM of labeled transcript and AmiC/AmiR complex containing 2.7pM AmiR dimers with increasing amounts of cold transcript (Figure 5.11 A).

Lane 1 corresponds to labeled transcript in the absence of protein, although a transcript of higher MW is also evident Even though the labeled transcript has been gel purified it is possible that the RNA is forming secondary structure aggregates after a period of time. Lane 3 represents the standard bandshift in the absence of cold specific transcript Lanes 4 to 10 contain increasing amounts of cold specific competitor and cold competition is evident in lane 7 (63nM) onwards. Since AmiR dimers are in excess there is an excess of RNA binding capacity per reaction. For this reason the cold

^ For sim plicity, cold R N A run-off transcripts from pM W 42 will be referred to fix>m now on as cold transcripts.

1 2 3 4 5 6 7 8 9 10

L a b e lle d tra n s c rip t/A m iR /a n tib o d y c o m p le x ^ L a b e l l e d tra n c rip t/A m iR c o m p le x

^ L a b e l l e d tra n s c rip t

'A,' ' .

B

_{1 2 3 4 5 6 7 8 9 10}

L a b e lle d tra n s c r ip t/A m iR c o m p le x

L a b e lle d tra n s c rip t

Figure 5.11 Cold specific and non-specific RNA competition studies.

(A) Cold specific competition. Lane 1, labelled transcript (47nM); lane2, labelled transcript (8nM) + AmiR dimer (2.7pM ) + MalE-AmiR antiserum (l.OpL). Lanes 3 to 10 contain labelled transcript (8nM), AmiR dimer (2.7pM) and between 0 and 250nM cold transcript as follows: lane 3, OnM; lane 4, 13nM; lane 5, 31nM; lane 6, 44nM; lane 7, 63nM; lane 8, 94nM; lane 9, 126nM; lane 10, 250nM. (B) Cold non-specific competition. Lane 1, labelled transcript (39nM); lane 2, no acetamide, labelled transcript (39nM) + AmiR dimer (2.7|iM). Lanes 3 to 10 contain labelled transcript (39nM), AmiR dimers (2.7pM ) and between 43 and 1024nM cold yeast tRNA as follows: lane 3, 43nM; lane 4, 86nM; lane5,

Chapter 5: RESULTS 3

transcript to labeled transcript ratio needs to be approximately 8:1 before cold specific competition is observed. Lane 2 shows the result of a supershift assay in which the standard bandshift reaction was (subsequently) incubated with the rabbit polyclonal MalE-AmiR antiserum. The result shows increased retardation of the labeled transcript and an overall reduction in the signal. Signal reduction is presumably the result of RNAase activity present in the rabbit serum. This result clearly shows that the gel retardation is AmiR dependent

S.4.3.2 Cold non-specific RNA competition

A solution of yeast RNA consisting mainly of tRNA (Sigma, StLouis, MO, USA) was used in the non-speciEc competition studies. RNA gel retardation assays were set (section 2.2.S.7) containing labeled transcript (39nM) and AmiC/AmiR complex (2.7pM AmiR dimers) with increasing amounts of yeast RNA (Figure 5.1 IB).

Lane 1 contains labeled transcript with no added protein. Lane 2 was set up as a control to show ligand dependent bandshifting. As is evident the ligand dependency has been lo st This and all subsequent results presented in this chapter show loss of ligand dependency. Although the AmiC/AmiR complex preparation is different from that used in assays which showed ligand dependency it is the same preparation which was used in the Analytical Gel Filtration experiments in section 5.3. This shows that the AmiC/AmiR complex preparation is normal and points towards contamination with acetamide of one of the solutions used in the assays as the probable explanation for the loss of ligand dependency. The yeast RNA competition assays (lanes 3 to 10) show that up to a 26-fold molar excess of non-specific RNA is unable to compete out the labeled transcript binding. Gel retardation competition assays carried out using yeast tRNA at

24|liM (616-fold molar excess) showed some non-specific binding of AmiR (results not shown).

These results clearly show that AmiR exhibits sequence specific RNA binding. In the next section the affinity of the interaction was investigated.

5.4.4 AmiR/RNA affinity stu d ie s

5.4.4.1 introduction

Interactions between ligands and the apposite binding site on the surface of a protein can be quantitatively described by means of a dissociation constant (K d) which is defined as the ligand concentration at which 50% of the protein binding sites are occupied. Various ways exist for measuring the Kd between proteins and ligands. One of the most common is to maintain a constant protein concentration and increase the amount of ligand up to and beyond the saturation point Measurement of the concentration of bound and free ligand can be used to generate a Scatchaid plot, the gradient of which gives a value for the Kd and the intercept with the ordinate gives a value for k, the

constant of proportionality between protein and ligand. A second way of determining the Kd between protein and ligand is to maintain the ligand concentration constant and vary the protein concentration. The data can be represented by plotting the percentage of ligand bound versus the increasing protein concentration. The protein concentration at which 50% ligand is bound corresponds to the Kd.

In a solution containing protein and ligand with affinity for that protein, ideal behaviour is represented by a rectangular hyperbola in a graphical representation of concentration of bound ligand as a function of free ligand. Since solutions which contain a homogeneous population of independent binding sites with which ligands can associate is rarely seen, and thus not all data will display ideal behaviour. Deviations from ideal behaviour can be positive or negative and are defined on the basis of how the concentration of bound ligand as a function of free ligand concentration deviate from ideal behaviour (Kyte, 1995). If values are less than those predicted by an ideal hyperbola the behaviour is considered to be a negative deviation and if the values are more then the behaviour is considered to be a positive deviation. Scatchard plots obtained from data displaying positive or negative deviation are non-linear and can be resolved by numerical analysis into their several components (Kyte, 1995).

Substoichiometric behaviour is another phenomenon observed in many situations. This is defined when the molar concentration of bound ligand at saturation is less than the

Chapters: RESULTS 3

molar concentration of protomers, in this case AmiR dimers. In this section both methods described above for determining a Kd value for the AmiR/leader RNA

interaction are carried out and the results compared.

5.4.4.2 Kd estimation varying labeled transcript concentration

RNA gel retardation assays were carried out (section 2.2.3.7) using a fixed amount of AmiR dimers with increasing amounts of labeled transcript (Figure 5.12A). Lane 1 contains labeled transcript and no protein and lane 2 was set up as a control to show ligand dependent bandshifting (section 5.4.3.2). Lanes 3 to 10 contain increasing amounts of labeled transcript and saturation of the AmiR dimers is observed from lane 6 (47nM) onwards. The levels of bound and unbound labeled transcript were quantised (section 2.2.3.8) and represented in graphical form as shown in Figure 5.12B and 5.12C respectively. The curve in figure 5.12B displays negative deviation fi*om ideal behaviour. It is possible that this is due to the presence of two subpopulations of AmiR in the binding assays; active dimeric AmiR and partially active aggregated AmiR. In a heterogeneous protein solution the concentration of bound ligand and the observed function describing binding is the sum of several individual rectangular hyperbolas, each with different initial slopes and different levels of saturation. Since the sum of two or more rectangular hyperbolas necessarily display negative deviation a heterogeneous solution of a protein will often display negative deviations from ideal behaviour simply because of its heterogeneity. Values were obtained from the curves in figure 5.12B and 5.12C and used to generate the nonlinear Scatchard plot shown in Figure 5.12D. The observed Kd for the binding of leader transcript to the site of highest affinity (dimeric AmiR) was 0.9nM and the value of K indicates that the stoichiometry between AmiR

dimers and RNA is 143 to 1. It is highly unlikely that 143 AmiR dimers bind to 1 RNA molecule and the non-linearity of the Scatchard plot indicates this.

5.4.4.3 Kd estimation varying the AmiR dimer concentration

RNA gel retardation assays (2.2.3.7) were performed using a fixed amount of labeled transcript and increasing concentration of AmiC/AmiR complex (Figure 5.13A). Lane 1 contains labeled transcript and no protein and lane 2 was set up as a control to show ligand dependent bandshifting (section 5.4.3.2). Lanes 3 to 7 contain increasing amounts of AmiC/AmiR complex and 100% bandshifting is observed in lanes 6 and 7.

B

< ^ 3 Labelled transcript/ Am iR com plex

Labelled transcript

50 ICO

L a b e lle d tra n s c tip t a d d e d (n g )

c

a.

I

3

50 100

L a b e lle d tra n s c rip t a d d e d (n g )

D

0.007 K = 0.007 0.006 0.005 - Kn = 0.9nM 0.004 V 0.003 0.002 0.001 0.01 0.015 0.005 V [u n b o u n d R N A (n M )]

Figure 5.12 Estim ation o f for the AmiR/RNA interaction using varying labelled transcript concentrations.

(A) RNA gel retardation assays with increasing labelled transcript. Control lanes ( 1 and 2) contain; lane 1, free labelled transcript (16nM); lane 2, no acetamide, labelled transcript (16nM) + AmiR dimer (2.7pM). Lanes 3-10 contain AmiR dimers (2.7p,M) and between 8 and 94nM labelled transcript as follows: Lane 3, SnM; lane 4, 16nM; lane 5, 32nM; lane 6, 47nM; lane 7, 55nM; lane 8, 63nM; lane 9, 79nM; lane 10, 94nM. (B) Plot o f labelled transcript added per RNA gel retardation assay vs. labelled transcript bound. (C) Plot o f labelled transcript added per RNA gel retardation assay vs. labelled transcript unbound. (D) Scatchard plot o f labelled transcript binding to AmiR dimers. The ordinate is the stoichiometry, v, the number o f mois of RNA bound per mol o f protein. The abscissa is the ratio o f v to the free RNA concentration.

Chapters: RESULTS 3

4 5

Labelled transcript/AmiR complex

Labelled transcript

B

0.9-

I

AmiR dimers (|iM )

1

I 0.8 I 0.7 I 0.6 I 0.5 c

I

0.2

AmiR dimers (|iM )

F igure 5.13 Estimation o f Kp for the AmiR7RNA interaction using varying AmiR dimer concentrations.

(A) RNA gel retardation assays with increasing AmiR dimer concentrations. Control lanes (1 and 2) contain: lane 1, free labelled transcript (13nM); lane 2, no acetamide, labelled transcript (13nM) + AmiR dimer (2.7pM). Lanes 3-7 contain labelled transcript (13nM) and between 0.19 and 2.7pM AmiR dimers as follows: lane 3, 0.1 QpM; lane 4, 0.35|iM; lane 5, 0 .7 IpM ; lane 6, 1.44 pM ; lane 7, 2.7pM . (B) Saturation binding curve. Gel retardation assays for saturation binding contained labelled transcript (13nM) and between 0.19 and 18.7pM AmiR dimers. (C) Expanded view o f saturation binding curve.

The levels of bound and unbound labeled transcript were quantised (section 2 2.3.8) and are shown in graphical form in Figure 5.13B. The AmiR dimer concentration at which 50% of the labeled transcript is bound is approximately 210nM, which would correspond to the Kd if the AmiR dimer/RNA stoichiometry was 1 to 1. In section S.4.4.2 the Scatchard plot indicated an AmiR dimer/RNA complex stoichiometry of 143 and taking this into consideration the "real* Kd obtained is 1.5nM which closely agrees with the value of 0.9nM obtained in section S.4.4.2.

Although a wide range of dissociation constants have been measured for RNA-protein interactions, from as high as 1.4pM for the SacY(l-55)-RAT interaction (Manival et al.^

In document La música en los juegos de patio en educación infantil (página 34-40)