synthase
2.10.1 Vector design
Coding regions of wild type Arabidopsis PSY and mutants identified in this study were codon- optimised and cloned into pRSETA (ThermoFisher Scientific) through restriction sites Xho I and
EcoR I that were attached respectively to the 5’- and 3’-end of the chemically synthesized sequences. Following the prediction of chloroplast-targeting peptide of PSY on ChloroP 1.1 Server (http://www.cbs.dtu.dk/services/ChloroP/), 55 codons at the 5’-end of PSY gene, exclusive of start codon, were deleted from the designed coding sequences. Codon optimisation was done using the GeneOptimizer portal of ThermoFisher Scientific https://www.thermofisher.com/au/en/home/life-science/cloning/gene-synthesis/geneart- gene-synthesis/geneoptimizer.html). To facilitate the purification of recombinant PSY without additional tags, sequence “GAAAATCTGTATTTTCAGGGT” that encodes TEV protease (Tobacco Etch Virus nuclear-inclusion-a endopeptidase) was inserted between Xho I site and start codon. Chemical synthesis and cloning were carried out by ThermoFisher Scientific, and the plasmids were verified by sequencing and restriction enzyme digestion in our lab. pRSET-PSY-WT, pRSET- PSY4, pRSET-PSY90 and pRSET-PSY130 were transformed to E. coli strain DH5α for propagation, followed by transforming BL21 (DE3) strain for the expression of recombinant PSY.
2.10.2 Transformation
-73-
strains were streaked on LB plates containing no antibiotics and single colonies were inoculated in 5 mL of LB. Following an overnight culture at 37°C, cells were diluted by 100-fold in LB medium and cultured at 37°C with constant shaking at 250 rpm until OD600 reached 0.4- 0.6. The LB culture was incubated on ice for 20 min and cells were pelleted by centrifugation at 4,000× g for 10 min at 4°C. Cell pelleted were washed once with 1/2 volume of cold 100 mmol.L-1 CaCl2 and resuspended in 1/100 volume of 100 mmol.L-1 CaCl2. The resuspended chemical competent cells in a 50-μL aliquot were then mix with 100 ng plasmid DNA and incubated on ice for 30 min, followed by heat shock at 42°C for 90 s and incubation on ice for 2 min. The mix of competent cells and plasmid DNA was diluted by 500 μL LB medium and incubated at 37°C for 45 min. Cells (100 μL) were then spread on an LB plate containing 100 mg.L-1 Ampicillin and incubated for 14 h at 37°C. Single colonies were inoculated and cultured overnight at 37°C for the extraction of plasmid DNA if in DH5α strain, or for the expression of recombinant PSY if in BL21 (DE3).
2.10.3 Induction and verification of the expression of recombinant
PSY protein
For induction, overnight small cultures were diluted 100-fold in fresh LB medium containing 100 mg.L-1 Ampicillin and grown at 37°C to mid-log phase (OD600=0.5-0.7). Induction was initiated by the addition of 0.5 mmol.L-1 IPTG (Isopropyl β-D-1-thiogalactopyranoside, final concentration) and constant shaking at 28°C. Cells were harvested after 4-h induction by centrifugation at 5,000× g and washed once in 1/2 culture volume of phosphate-buffered saline (PBS). Cells were resuspended in 1/20 culture volume of lysis buffer (100 mmol.L-1 Tris.HCl pH 7.0, 5 mmol.L-1 EDTA, 5 mmol.L-1 DTT), and disrupted by lysozyme treatment (200 mg.L-1 ) for 20 min at 30°C followed by sonication on ice (50-100 cycles of 10 s on /10 s off). The soluble and insoluble (inclusion body) fractions were separated by centrifugation at 22,000× g for 1 h at 4°C, and the insoluble fraction was washed 3 times with 1/20 culture volume of wash buffer (100 mmol.L-1 Tris.HCl pH 7.0, 5 mmol.L-1 EDTA, 5 mmol.L-1 DTT, 2mmol.L-1 urea and 2% w/v Triton X-100) and once with wash buffer without Triton X-100, centrifuging at 22,000× g for 30 min at 4°C to clarify the suspension. Recombinant PSY in the inclusion bodies was extracted from washed pellets using 1/100 culture volume of extraction buffer (50 mmol.L-1 Tris.HCl pH 7.0, 5 mmol.L-1 EDTA, 5 mmol.L-1 DTT and 8 mol.L-1 guanidine.HCl),
-74-
and was diluted by 5-fold before loaded to a Bolt 17-well 4% – 12% Bis-Tris Plus gel (Thermo Fisher Scientific). To examine the expression of recombinant PSY in both soluble fraction and inclusion bodies, 10 μL of each sample was mixed with equal volume of 2× LDS buffer and heated for 10 min at 70°C followed by incubation on ice for 3 min. The gel was run for 42 min at 165 volt after 20 μL of each treated protein sample was loaded; gel was stained with GelCode Blue Safe Protein Stain (ThermoFisher Scientific) to visualise protein bands.
2.10.4 Purification and identification of recombinant proteins from
soluble fraction
In a typical preparation of recombinant PSY protein from soluble fraction, E. coli cells were harvested following induction by centrifugation at 5,000× g. The pellets were washed with cold PBS and resuspended in 50 mL buffer A (50 mmol.L-1 NaH2PO4, 20 mmol.L-1 imidazole, 1 mol.L-1 NaCl, pH 7.4), and lysed by lysozyme treatment and sonication on ice as described in the above section. After centrifugation at 22,000× g for 30 min at 4°C, the supernatant that contained the soluble fraction was loaded onto a Pierce 5-ml Ni-NTA column (ThermoFisher Scientific) that had been equilibrated with buffer A. The column was washed with 25 mL buffer A that contained 40 mmol.L-1 imidazole and then with buffer A that contained 60 mmol.L-1 imidazole. Protein was eluted using an appropriate volume of buffer A that contained 200 mmol.L-1 imidazole, 10 μL of which was subjected to gel electrophoresis (detailed above) and western blot with anti-PSY polyclonal antibody as per described in the corresponding section of this chapter. Buffer exchange to TEV digestion buffer (50 mmol.L-1 Tris.HCl pH 8.0, 150 mmol.L-1 NaCl, 20 mmol.L-1 KCl, 2 mmol.L-1 β-mercaptoethanol) was carried out using a Pierce desalting spin column (ThermoFisher Scientific). The column was equilibrated with 400 μL TEV digestion buffer three times and 100 μL purified recombinant protein was loaded with 20 μL TEV digestion buffer to improve recovery percentage. Protein samples were collected by centrifuging the column at 1,500× g for 2 min. Protein samples were pooled after buffer exchange and concentration was determined using Bradford reagent (Bio-Rad), followed by digesting 500 μL of protein using TEV (TEV:protein = 1:8) at 4°C for 14 h. A Pierce 5-ml Ni-NTA column (ThermoFisher Scientific) was equilibrated with TEV digestion buffer and TEV-cleaved recombinant PSY was loaded, followed by eluting 4 times the recombinant protein with 100 μL digestion buffer each. The concentration of TEV-cleaved and purified recombinant PSY
-75-
protein was determined again before in vitro enzymatic assays.
2.10.5 In vitro activity assay of recombinant PSY
Artificial chromosome pAC-GGPPipi, a gift from Dr. Nazia Nisar (Department of Agriculture and Water Resources) and propagated in our lab, was verified by restriction enzyme digestion and transformed to TOP 10 chemical competent cells as previously described in this chapter. After spreading the cells on LB plates containing 25 mg.L-1 chloramphenicol and incubation for 14 h at 37°C followed by 6 d at room temperature, single colonies were inoculated to 20 mL chloramphenicol-containing LB medium and cultured at 28°C for 18 h to synthesise GGPP in
E. coli. The same colonies were also inoculated and cultured in LB medium with 25 mg.L-1 chloramphenicol at 37°C for 14 h to extract artificial chromosome followed by verification. TOP 10 strain carrying pAC-PHYT was used as a positive control to verify the absorbance peek of phytoene in HPLC.
Cells were harvested by centrifugation at 12,000× g for 10 min at 4°C, and 1 g of cells (wet weight) were resuspended in 2 mL of enzyme assay buffer (100 mmol.L-1 Tris.HCl pH 7.6, 10 mmol.L-1 MgCl2, 2 mmol.L-1 MnCl2, 1mmol.L-1 3,3’,3’’-phosphanetriyltripropanoic acid, 20% v/v glycerol and 0.08% v/v Tween 80). Cells were lysed by sonication (20 cycles of 10 s on /10 s off) on ice, followed by centrifugation at 20,000× g for 30 min at 4°C. To the supernatant 5 μg of purified recombinant PSY protein was added, followed by incubation at 20°C in dark for 20 min. At a 4-min interval, 200 μL aliquots were withdraw and the reaction was stopped by adding EDTA (500 mmol.L-1 stock pH 8.0) to a final concentration of 50 mmol.L-1. Assays were extracted by adding 260 μL carotenoid extraction buffer and partitioning phytoene into ethyl acetate phase. The extractions were dried under nitrogen stream in dark, resuspended in 100 μL ethyl acetate and subjected to HPLC as described previously in this chapter.
2.10.6 In vitro activity assay of endogenous Arabidopsis PSY
The immunoprecipitation of endogenous PSY was performed using P-PER® Plant Protein Extraction Kit and Pierce Co-Immunoprecipitation kit (both from ThermoFisher Scientific) following manufacturer’s instructions and is summarised below.
For total protein extraction, 160 mg leaf tissue from a 25-d old Arabidopsis plant grown under 16-h photoperiod was homogenised in 3.5 mL P-PER® Working Solution containing 20 μL Halt™ Protease Inhibitor Cocktail (ThermoFisher Scientific). Following centrifugation at 3,500×
-76-
g for 5 min, the lower aqueous layer containing total protein was recovered for the immunoprecipitation of PSY which is described in the corresponding sections in this chapter. Five micrograms of endogenous PSY co-immunoprecipitate (with binding proteins) was subjected to enzymatic activity assay as described in the above section for recombinant PSY.
2.10.7 In vivo PSY activity assay
In vivo PSY activity was examining by measuring phytoene levels in norflurazon-treated Arabidopsis SDC. Generation of SDC and HPLC analysis were carried out as previously described in this chapter.