A detailed picture of HOX control of development necessitates further analysis of the conserved motifs of HOX proteins. The results of this study highlight the importance of some highly conserved HOX peptides to HOX function. However, the protein motifs of focus here are those that have been well studied in the past, such as the
YPWM and octapeptide motifs. For a thorough understanding of HOX protein structure, an analysis of uncharacterized protein regions is required. The conservation of such domains has only become apparent recently, as various researchers in the field of Evolution and Development have undertaken the
sequencing of a more representative sample of animal Hox genes. Examples of these newly identified protein motifs of SCR include the KMAS motif, which is common to all Bilateran SCR homologues, and the NANGE, PQDL and SCKY motifs, which are common to Arthropoda. Smaller, yet well conserved, motifs may also play an important role in development. Identifying the particular roles of each motif, or their relative contributions to SCR dependent functions, will assist in correlating the appearance or loss of highly conserved domains with the evolutionary acquisition of novel HOX functions.
Another interesting future initiative would be to determine if HOX proteins are regulated during development by proteins encoding leucine zipper motifs. The observation that SCR14 antimorphy may be the result of the acquisition of a leucine zipper motif, which allows SCR14 to form inactive complexes with wild-type SCR, presents a novel mechanism of HOX regulation by leucine zipper containing proteins. During development, HOX proteins are regulated by the Pc-G and Trx-G genes, which are involved in chromatin remodeling. Examples from these groups of genes that also encode leucine zipper motifs are the Trx-G protein, Moira (CROSBYet
al. 1999), and the Pc-G protein, Enhancer of Polycomb (STANKUNASet al. 1998). In addition, one study identified 27 proteins in the Drosophila genome encoding leucine zipper motifs (FASSLERet al. 2002). One protein from this screen is Cap ‘n’ collar-B (Cnc-B), which has previously been shown to inhibit DFD from inducing maxillary segmental fate in the mandibular segment (VERAKSA et al. 2000; MCGINNIS
et al. 1998). The precise mode by which Cnc-B inhibits DFD activity is not
understood, though potential explanations for this observed inhibition include Cnc- B repression of DFD transcription and Cnc-B inhibition of DFD protein activity. Given that DFD auto-activates its own expression, both scenarios are possible (VERAKSAet al. 2000). A direct link between other Drosophila leucine zipper
encoding proteins and HOX proteins may not be obvious; however, closer examination may reveal novel HOX interaction partners.
Furthermore, the leucine zipper motif of SCR14 was not detected by freely available leucine zipper prediction software (BORNBERG-BAUERet al. 1998). There are many explanations for the failure to detect a leucine zipper motif in SCR14, including the small size of the motif, which is two heptads in length, and the absence of expected charged residues in positions e and g of each heptad. This issue raises the question of whether a complete list of leucine zipper containing proteins in Drosophila has even been identified. It may be necessary to reduce the stringency for detection of putative lecine zipper motifs and empirically test the capacity of these motifs to dimerize or oligomerize.
Past studies have provided strong evidence demonstrating that HOX control of development has contributed to the evolution of animal design. Therefore, detailing the contributions of evolutionarily conserved protein domains in mediating this function is required for understanding morphological evolution in animals.
5.2
References
BORNBERG-BAUER,E.,RIVALS,E., and M.VINGRON, 1998 Computational Approaches to identify Leucine Zippers. Nucleic Acids Res. 26: 2740-2746.
S.B.CARROLL, 2005 Evolution at two levels: on genes and form. PLoS Biology 3: 1159-1167.
CROSBY,M.A.,MILLER,C.,ALON,T.,WATSON,K.L.,VERRIJZER,C.P.,GOLDMAN-LEVI,R., and N.B.ZAK, 1999 The trithorax group gene moira encodes a brahma-associated putative chromatin-remodeling factor in Drosophila melanogaster. Mol. Cell. Biol. 19: 1159-1170.
FASSLER,J.,LANDSMAN,D.,ACHARYA,A.,MOLL,J.R.,BONOVICH, M., and C.VINSON, 2002 B- ZIP proteins encoded by the Drosophila genome: evaluation of potential dimerization partners. Genome Res. 12: 1190-1200.
HITTINGER,C.T.,STERN,D.L., and S.B.CARROLL, 2005 Pleiotropic functions of a
conserved insect-specific Hox peptide motif. Development 132: 5261-5270. MCGINNIS,N.,RAGNHILDSTVEIT,E.,VERAKSA,A., and W.MCGINNIS, 1998 A cap 'n' collar
protein isoform contains a selective Hox repressor function. Development 125: 4553-4564.
MERABET,S.,LITIM-MECHERI,I., KARLSSON, D., DIXIT, R., SAADAOUI,M., MONIER, B., BRUN, C., THOR, S., VIJAYRAGHAVAN, K., PERRIN, L., PRADEL, J., and Y. GRABA, 2011 Insights into Hox protein function from a large scale combinatorial analysis of protein domains. PLoS Genet. 7: e1002302.
PERCIVAL-SMITH,A., WEBER,J.,GILFOYLE,E., and P.WILSON, 1997 Genetic
characterization of the role of the two HOX proteins, Proboscipedia and Sex combs reduced, in determination of adult antennal, tarsal, maxillary palp and proboscis identities in Drosophila melanogaster. Development 124: 5049- 5062.
PRINCE,F.,KATSUYAMA,T.,OSHIMA,Y.,PLAZA,S.,RESENDEZ-PEREZ,D., et al., 2008 The YPWM motif link Antennapedia to the basal transcriptional machinery. Development 135: 1669-1679.
SIVANANTHARAJAH, L., and A. PERCIVAL-SMITH, 2009 Analysis of the sequence and phenotype of Drosophila Sex combs reduced alleles reveals potential functions of conserved protein motifs of the Sex combs reduced protein. Genetics 182: 191–203.
STANKUNAS,K.,BERGER,J.,RUSE,C.,SINCLAIR,D.A.,RANDAZZO,F., and H.W.BROCK, 1998 The Enhancer of Polycomb gene of Drosophila encodes a chromatin protein conserved in yeast and mammals. Development 125: 4055-4066.
VERAKSA,A.,MCGINNIS,N.,LI,X.,MOHLER,J.,andW.MCGINNIS,2000Cap 'n' collar B cooperates with a small Maf subunit to specify pharyngeal development and suppress Deformed homeotic function in the Drosophila head.Development 127:4023- 4037.
APPENDIX 2. Primers used for Real time PCR analysis of transcript levels in viable Scr
hypomorphs
Oligo name Oligo sequence (5’ to 3’)
Scr-Fwd TATCCGTGGATGAAGCGAGT
Scr-Rev GGTCAGGTACGGTTGAAGT
rp49-Fwd CTTCATCCGCCACCAGTC rp49-Rev GTGCGCTTGTTCGATCCG
APPENDIX 4. Crossing scheme and chromosome of insertion for UAS constructs used
in Chapter 3. (i) Crossing scheme used to produce progeny (F1) in which SCR constructs were expressed in Scr+ or Scr14 hemizygous backgrounds. (ii) The chromosome of insertion of each UAS-Scr- X121TT construct was mapped before stocks were generated.
(i) P{Arm-Gal4, w+}; Scr+
Scr+ P a y w; P{Uas-Scr- X121TT, w+}; pb34 x OR TM6B P{Arm-Gal4, w+}; Scr14 TM6B
F1 b y w; P{Uas-Scr- X121TT, w+}; Scr+ OR y w; P{Uas-Scr- X121TT, w+}; Scr14 pb34 pb34(ii) UAS Construct Chromosome of
(Scr- X121TT) Insertion
Scr+121TT 2
Scr14121TT X
Scr8aa 121TT 2
Scr8aa, octa 121TT 3c
Scr8aa, octa, LASCY121TT X
ScrLASCY121TT 2
ScrSer10Ile121TT 3
ScrSer10Ala121TT 2
_________________________________________________________________________________________________________________________________________________ aThe direction of the cross does not matter except for X chromosome insertions, in which case, females of the UAS-ScrX121TT stock were used in all crosses.
bGenotype of progeny in which UAS-Scr- X121TT is a 2nd chromosome insertion. cIf insertion of UAS-Scr-X was mapped to the third chromosome, then UAS-Scr-X was recombined onto the third chromosome with pb34.
Curriculum Vitae
Name: Lovesha Sivanantharajah Post-secondary University of Western Ontario Education and London, Ontario, Canada Degrees: 2001-2005 B.Sc.
The University of Western Ontario London, Ontario, Canada
2005-2013 Ph.D.
Honours and David E. Laudenbach Scholarship
Awards: November 2011
Ontario Graduate Scholarship (OGS) 2011- 2012
Malcolm Ferguson Award in Life Sciences December 2010
Dr. Irene Uchida Fellowship in Life Sciences July 2010, August 2007
Biology Travel Award
December 2009, August 2007 Graduate Thesis Research Award January 2008
Natural Sciences and Engineering Research Council of Canada (NSERC) Postgraduate Scholarship- Doctoral
2007-2010
Ontario Graduate Scholarship in Science & Technology (OGSST)
2006-2007
Related Work Teaching Assistant
Experience The University of Western Ontario 2005-2012
Publications
Sivanantharajah, L. and Percival-Smith, A. (2009) Analysis of the sequence and phenotype of Drosophila Sex combs reduced alleles reveals potential functions of conserved protein motifs of the Sex combs reduced protein. Genetics182: 191–203.
Selected Presentations
Sivanantharajah, L. and Percival-Smith, A. An altered version of the Drosophila Homeotic selector protein, Sex combs reduced (SCR), is hypersensitive to inhibition by the SCR octapeptide. (2012) 53rd meeting of The Genetics Society of America. Chicago, Illinois. Poster Presentation.
Sivanantharajah, L. and Percival-Smith, A. Investigating a genetic model for the function of Sex combs reduced, a Homeotic selector protein in Drosophila melanogaster. (2011) CanFly. St. Catharines, Ontario. Oral Presentation
Sivanantharajah,L. and Percival-Smith, A. Testing a genetic model for Sex combs reduced function in Drosophila melanogaster. (2010) 53rd meeting of The Genetics Society of Canada. Hamilton, Ontario. Oral Presentation.
Sivanantharajah,L. and Percival-Smith, A. Testing a genetic model for Sex combs reduced function in Drosophila melanogaster. (2009) 21st meeting of The European Drosophila Research Conference. Nice, France. Poster Presentation. Sivanantharajah,L. and Percival-Smith, A. Analysis of Drosophila Sex combs reduced mutant alleles. (2008) Annual Canadian Developmental Biology
Conference/Genetics Society of Canada meeting. Banff, Alberta. Poster Presentation. Sivanantharajah, L. and Percival-Smith, A. Characterizing the highly conserved, insect specific carboxy terminal domain of Drosophila Sex combs reduced. (2006) Annual meeting of the Genetics Society of Canada. London, Ontario. Oral Presentation.
Advisory Committee Member
Sept. 2009- Apr. 2010, Mathew Hall, Honors thesis student: Degradation of
Drosophila Epidermal growth factor receptor (EGFR) pathway components by RNA interference to determine which are critical in maxillary palp formation
Sept. 2008- Apr. 2009, Shaun Symons, Honors thesis student: Sfrp5 is unable to antagonize the Wnt6 signal necessary for PrE differentiation in F9 embryonic carcinoma cells
Sept. 2007- Apr. 2008, Leah Mirsky, Honors thesis student: Investigation of Proboscepedia sequences required for maxillary palp and proboscis development in the fruit fly Drosophila melanogaster
Academic Service
October 22, 2011: Biology Graduate Research Forum, Co-Chair, UWO
September 2011- August 2012: Graduate Social Representative, SOBGS, UWO
September 2009- August 2010: Graduate Education Representative, SOBGS, UWO
September 2006- August 2008: Chair, Society of Biology Graduate Students, UWO
September 2007- August 2008: Co-Chair, SOGS Orientation Committee, UWO
May 2006- August 2007: SOGS Orientation Committee Representative, UWO