CONSTRUYENDO LA VISIÓN DE DESARROLLO PARA LOS

2.4.1 Sectioning of brain tissue for in situ analysis

Brain samples were thawed slightly at room temperature and the anterior part o f each brain in front of the hypothalamus removed. An incision was also made well behind the hypothalamus through the brain stem to provide a flat surface for mounting. Brains were mounted onto chucks in Cryo-M-Bed embedding medium (Bright Instrument Company Ltd., Huntington, UK) ready for positioning in a Bright Model OTF cryostat with chamber temperature held at -16°C. Thereafter, brains were laterally aligned using the anterior commisures as guides and distances between nuclei were mapped from the disappearance of the anterior commisure in the midline. Sections containing the periventricular (PeN), supraoptic (SON) paraventricular (PVN), arcuate (ARC), ventromedial (VMN) and dorsomedial (DM) nuclei were selected. In each case presence o f particular nuclei was confirmed visually by briefly staining test sections in 1% toluidine blue (BDH Chemicals Ltd. Poole, UK) at the time o f cutting. Coronal brain sections (12|im) were cut through the brain and mounted onto cold (placed in cryostat while cutting) gelatin and chrome alum-coated slides and then placed onto a warm hotplate for a few minutes before storing at -70°C until further use.

2.4.2 Sectioning of other tissues for in situ hybridisation

All other tissues apart from adipose tissue were sectioned at -16°C. In each case, tissue was cut until a uniform section representing the majority o f the cell types in that tissue was achieved, \2\im sections were mounted onto cold gelatin and chrome alum-coated slides, placed onto a warm hotplate for a few minutes to fix the section onto the slide and then stored at -70°C. Adipose tissue was embedded in Cryo-M-Bed embedding medium onto chucks placed on dry ice. 12pm sections were cut at -30°C and mounted onto warm (room temperature) slides and again stored at -70°C until further use.

Chapter 2________________________________________________ Materials and Methods

2.4.3 Preparation of DNA for labelling

Large scale isolation of plasmid DNA was performed using a Plasmid Maxi kit (Qiagen). Ipg o f DNA was linearised using appropriate restriction enzymes. Following the reaction, cut DNA was purified using phenol/chloroform/isoamylalcohol (Sigma) and left to precipitate overnight in 100% ethanol containing 2% 4M NaCl. The following day DNA was centrifuged for 20 minutes at 13500rpm and the resulting pellet resuspended in 4.5pl RNAse-free water. O.Spl of the DNA solution was mixed with 10|xl o f Orange-G loading buffer (Sigma, made in 40% sucrose solution) and separated on a 1% agarose gel for 30 minutes at 100 volts. Linear DNA was confirmed when a correctly sized fi-agment was observed.

2.4.4 Production of ^^S UTP-labelled riboprobes

Probes used and details are summarised in Table 2.1. cDNA riboprobes were produced using a SP6/T7 in vitro transcription kit (Roche Molecular Biochemicals). Antisense probes were generated and the corresponding sense RNA probe was produced as a negative control. Labelled probes were purified on Sephadex 0 5 0 columns (Pharmacia) and eluted using lOmM Tris (pH 7.5) / 0.1% SDS. 6-8 lOOpl aliquots were taken for each purification from which \\i\ was counted in 5ml scintillation fluid in a Beckman LS 5000CE counter.

2.4.5 Production of ATP-labelled oligonucleotide probes

Oligonucleotides were obtained from Oswel DNA Services (Southampton, UK). These were labelled using the Terminal Transferase kit (Roche Molecular Biochemicals) according to manufacturer instructions. Unincorporated label was then removed using phenol/chloroform/isoamylalcohol extraction and the oligonucleotide left to precipitate overnight. The following day oligonucleotides were centrifuged at 13500rpm for 20 minutes, the pellet resuspended and l|xl counted in 5ml scintillation fluid in a Beckman LS 5000CE counter.

Table 2.1 Probes used for in situ lybridisation

Clone Insert size Vector Enzymes used to cut/transcribe Supplied by

hGH 751bp pGem57f+ EcoRL(T3) antisense

BamHl(T7) sense

D Flavell, NIMR

OB-IC 316bp pCRII Notl(Sp6) antisense

BamEl(T7) sense

K Lindell, Gôteborg, Sweden

OB-EC 328bp pCRH Notl(Sp6) antisense

BamHl(T7) sense

K Lindell, Gôteborg, Sweden

CRF 770bp pGem3Z Hindni{T7)antisense

Kpnl(Sp6) sense

M Grino, Marseille, France

POMC 397bp pSP64 //mÆQ(Sp6) mRNA

BamHl(Sp6) cDNA

M Grino, Marseille, France

NPY 370bp pGem5Zf+ Spel (T7) antisense

Ncol(SP6) sense

D Flavell, NIMR

GRF 500bp PGem7Z Smal(Sp6) antisense

BamHl(T7) sense

D Flavell, NIMR

MC4-R 600bp pBKS Sail(T7) antisense

EcoRI (T3) sense

K Mountjoy, New Zealand

GH-R 2.9kb pT7T318u Xbal(T7) antisense

Spel(T3) sense

G Norstedt, Sweden

TUB 247bp PCRU-Topo Notl(Sp6) antisense

BamHl(T7) sense

P Le Tissier, NIMR

Exon W 145bp PGem3 BamHl (T7) antisense

Hindni(SP6) sense

P Le Tissier NIMR

AGRP oligonucleotide sequence: aggcagtgccaacagcagaacacaactcagcaacattgcagtcagcat S Dickson, Cambridge

Chapter 2________________________________________________ Materials and Methods

2.4.6 Pre-hybridisation of sections for riboprobe and oligonucleotide in situ

Frozen sections were thawed at room temperature for 10 minutes and then fixed for 5 minutes in freshly prepared 4% paraformaldehyde (Sigma) for riboprobes or 4% formaldehyde (Sigma) for oligonucleotides. Sections were then acetylated in 8.75% triethanolamine (Sigma) and 1.6% acetic anhydride (Sigma) for 10 minutes, then dehydrated through graded ethanol solutions, then delipidated in chloroform for 5 minutes. Finally sections were rinsed in 100% ethanol and allowed to air dry before hybridisation.

2.4.7 Hybridisation and post-hybridisation of sections for riboprobe in situ

Sections were hybridised overnight at 45°C, in buffer containing 1 x 10^ cpm o f denatured probe in hybridisation buffer (50% formamide, 0.025M Tris pH 7.5, 0.00IM EDTA pH 8.0, 0.4M NaCl, 1 x Denhardts solution (0.02% Ficoll, 0.02% polyvinylpyrrolidone and 0.02% BSA) and 10% dextran sulphate (MW 500,000), lOpg sheared single stranded salmon sperm DNA/ml and 5|ig yeast tRNA/ml). Nescofilm (Bando Chemical Industries Ltd., Kobe, Japan) was cut into small squares and used as coverslips. Following overnight incubation, sections were washed in 2 x SSC three times at room temperature, twice in 2 x SSC/50% formamide at 45°C each for 15 minutes, rinsed briefly in 2 x SSC at 37°C, incubated in 2 x SSC containing 20|ig RNase A/ml at 37°C for 30 minutes, rinsed in 2 x SSC, washed three times in 2 x SSC/50% formamide at 45°C for 15 minutes each, twice in 2 x SSC at room temperature for 5 minutes each, dipped in water and then 100% ethanol and air dried. Slides were exposed to autoradiographic film (Biomax MR, Kodak, NY, USA) for up to 14 days before quantifying integrated densities. The total integrated densities o f hybridisation signal were determined by computerised densitometric scanning (NIMH Image Analysis, Bethesda, Md., USA).

Chapter 2________________________________________________ Materials and Methods

2.4.8 Hybridisation and post-hybridisation of sections for oligonucleotide in situ

Sections were hybridised overnight at 37°C in 45|il of oligonucleotide hybridisation buffer (50% formamide, 4 x SSC, 1 x Denhardts solution, 10% dextran sulphate, 0.5mg/ml salmon sperm DNA, 0.25mg/ml yeast transfer RNA) containing 1 x lO^cpm of probe per slide. Following incubation Nescofilm coverslips were gently floated off in 1 x SSC and sections washed in three changes of 1 x SSC. Sections were then washed in 4 changes o f 1 x SSC at 55°C in a shaking waterbath, each wash lasting for 15 minutes, followed by two incubations for 30 minutes each at room temperature in 1 x SSC. Finally, sections were dipped in water and then 100% ethanol before air-drying and exposing to film for 5-7 days.