Due to this project being heavily dependent on accurately assessing Ezh2 excised vs unexcised states (and their intermediaries), it was very important able to quantify these accurately at various stages during setup and analysis of these experiments. In order to do this, a qPCR strategy was developed and optimised through guidance from Dr George Giotopoulos (Huntly group) in order to better quantify/estimate levels of excision. A standard PCR and gel method, though able to provide an assessment of “excised or unexcised”, was at best semi-quantitative.
33 Therefore, primers coding for a 150bp sequence within the loxp sites surrounding exon 9 of Ezh2 were designed and a similar pair of primers (with identical melting temperatures) for an equal length 150bp sequence very closely downstream of the loxp sites (that would be unaffected by excision and therefore maintained during PCR amplification) were created (Figure 2.2).
Ezh2 fl/fl primers - Forward sequence: TATGGGGGATGAAGTTCTGG
Reverse sequence: CCACTGTCATGGCAACAAGA
Ezh2 unexcised primers - Forward sequence: CTTCTTCCTCCGGGTCTCTC
Reverse sequence: GATCTTGGGGCATTGCAGTA
In the Ezh2 unexcised state, these primers would amplify their respective sequences at an approximately 1:1 ratio given identical sequence sizes. In the Ezh2 excised state, the “Ezh2 fl/fl” primers would fail to amplify whilst the “Ezh2 unexcised” primer pair would amplify. All qPCR was done using a Stratagene MX3000P machine and data analysed through MxPro qPCR software. Each reaction used 10-20ng DNA and SYBR Green reagent (Ultrafast III, Agilent Technologies).
Trialling these two pairs of primers on control DNA (where Ezh2 was known to be floxed but not excised i.e. “Ezh2 fl/fl”) showed almost identical amplification between both primer pairs as evidenced by very
FIGURE 2.2 Primer design for assessing Ezh2 excision via qPCR
In the unexcised state, both pairs of primers amplify at a 1:1 ratio by qPCR due to similar melting temperatures and identical sequence length. In the excised state, “Ezh2 fl/fl” primers are unable to amplify the region in relation to “Ezh2 unexcised” primers. This difference was consistent and when compared within the sample and then to a control sample subjected to the same qPCR reaction, the ratio of the difference in Ct values was used to provide an estimation of level of excision
34 similar average Ct values (average Ct: 23.27 for “Ezh2 fl/fl” primers vs average Ct: 23.795 for “Ezh2 unexcised” primers), (Figure 2.3):
When tested in an Ezh2 deleted scenario (“Ezh2 -/-”, Figure 2.4), as expected, amplification with the “Ezh fl/fl” primer pair was significantly decreased, therefore the average Ct value for this was typically higher when compared to the normal amplification attained by the “Ezh2 unexcised” primer pair (average Ct: 27.685 for “Ezh2 fl/fl” primers vs average Ct: 23.635 for “Ezh2 unexcised” primers):
In both the control (Ezh2 fl/fl) and test sample (Ezh2 -/-), this change in average Ct value between both pairs of primers was calculated (∆Ct) (Figure 2.5):
As seen in Figure 2.5, the ∆ Ct value for the Ezh2-/- sample (4.05) was considerably different to the ∆ Ct value attained in the control DNA (-0.525). This reflected the difference in Ezh2 states (unexcised in the control, and excised to an unknown proportion in Ezh2 -/-). Using the control DNA ∆ Ct value as the normal, the ∆ Ct value for Ezh2-/- was then subtracted from it, providing an estimation of the differences in amplification seen between the control and Ezh2-/- (∆∆Ct) (Figure 2.6):
fl/fl Unexcised
Average Average
EZH2 fl/fl 22.93 23.39 23.49 23.27 23.63 23.96 23.8 23.795 -0.525
Un. (3) ∆Ct
Sample fl/fl (1) fl/fl (2) fl/fl (3) Un. (1) Un. (2)
fl/fl Unexcised
Average Average
Ezh2 -/- 27.8 27.57 27.685 23.74 23.53 23.635 4.05
fl/fl (1) fl/fl (2) fl/fl (3) Un. (1) Un. (2)Un. (3) ∆Ct
Sample
fl/fl Unexcised
Average Average
EZH2 fl/fl 22.93 23.39 23.49 23.27 23.625 23.96 23.8 23.795 -0.525
Ezh2 -/- 27.8 27.57 27.685 23.74 23.53 23.635 4.05
fl/fl (1) fl/fl (2) fl/fl (3) Un. (1) Un. (2) Un. (3) ∆Ct
Sample
FIGURE 2.3 Ctvalues on qPCR using Ezh2 fl/fl primers versus Ezh2 unexcised primers
“Ezh2 fl/fl” is Control DNA obtained from Ezh2fl/fl; wild-type for Mx1-Cre murine HSPCs. Mean average from triplicates
FIGURE2.4 Ct values on qPCR using Ezh2 fl/fl primers versus Ezh2 unexcised primers
Ezh2 -/- is test DNA from Ezh2 fl/fl; Mx1-Cre+ murine HSPCs that have undergone pIpC to induce Ezh2 deletion.
FIGURE 2.5 ∆ Ct values for control and test samples
“Ezh2fl/fl”: control unexcised DNA as above; Ezh2 -/- is test DNA (where Ezh2 deletion is expected, as above)
35 This ∆∆ Ct value reflected the number of additional cycles required by the primers to amplify in Ezh2 - /- compared to the control sample and when this was resolved using 2^(∆∆ Ct), a final value was generated (termed “2nd Ct”), which reflected the proportion of unexcised DNA in the sample. Knowing that no excision had taken place in the control sample, the unexcised proportion was taken to be 100%. By comparison in Ezh2-/-, there was only 4.2% unexcised, therefore approximately 95.8% excision (Figure 2.7):
Thus, by comparing test sample ∆ Ct values with control DNA ∆ Ct values (where 100% of Ezh2 was intact) each time, it was possible to generate an approximation of Ezh2 excision, expressed as a percentage.
This assay was validated against a semi-quantitative PCR strategy developed separately, consisting of one forward primer upstream (F1) of the initial loxp site and two reverse primers (R1: within the loxp sites and R2: downstream of the second loxp site). The PCR products of F1+R1 and F1+R2 yield the following bands depending upon Ezh2 state (Figure 2.8):
Ezh2 fl/fl unexcised Ezh2 fl/fl excised Wild-type
F1+R1 = 533bp F1+R1 = no band F1+R1 = 316bp F1+R2 = 1254bp F1+R2 = 407bp F1+R2 = 955bp fl/fl Unexcised Average Average EZH2 fl/fl 22.93 23.39 23.49 23.27 23.625 23.96 23.8 23.795 -0.525 0 Ezh2 -/- 27.8 27.57 27.685 23.74 23.53 23.635 4.05 -4.575
fl/fl (1)fl/fl (2)fl/fl (3) Un. (1) Un. (2) Un. (3) ∆Ct ∆∆Ct
Sample
Sample ∆Ct ∆∆Ct 2ndCT Unexcised proportion Excision efficiency
EZH2 fl/fl -0.525 0 1 100 0
Ezh2 -/- 4.05 -4.575 0.042 4.195539071 95.80446093
FIGURE 2.6 ∆∆Ct values for control and test samples
“Ezh2fl/fl”: control unexcised DNA as above; Ezh2-/- is test DNA (where Ezh2 deletion is expected, as above)
FIGURE 2.7 Calculation of Ezh2 excision in control and test samples
“Ezh2fl/fl”: control unexcised DNA as above; Ezh2-/- is test DNA (where Ezh2 deletion is expected, as above)
36 F1: CCTGCAGCAGTTTCCTTTCTTA, R1: CCCATGTGGTAGGCAGAGAA, R2: CAGCGACACCCCAGAAAATT
When known Ezh2 excised and unexcised DNA controls were run alongside four MOZ-TIF2 and four AML1-ETO9a DNA samples with an expected excised status, the qPCR strategy provided the following results (Table 2.3):
Sample fl/fl primers Unexcised primers ∆ Ct ddCt 2ndCT Unexcised Excision efficiency
average average proportion
1 (Excised) 29.32 24.525 4.795 -4.533 0.043185 4.32 95.68 2 (Excised) 29.475 24.345 5.13 -4.868 0.034236 3.42 96.58 1 (unexcised) 24.68 24.235 0.445 -0.183 0.880666 88.07 11.93 2 (unexcised)** 24.56 24.30 0.26 0 1 100.00 0.00 1 (MOZ-TIF2) 26.635 24.39 2.245 -1.983 0.252905 25.29 74.71 2 (MOZ-TIF2) 26.695 24.91 1.785 -1.523 0.347881 34.79 65.21 3 (MOZ-TIF2) 26.53 24.61 1.92 -1.658 0.316805 31.68 68.32 4 (MOZ-TIF2) 25.605 24.255 1.35 -1.088 0.470304 47.03 52.97 1 (AML1-ETO9a) 26.18 24.595 1.585 -1.323 0.399611 39.96 60.04 2 (AML1-ETO9a) 28.02 24.36 3.66 -3.398 0.094842 9.48 90.52 3 (AML1-ETO9a) 26.015 24.26 1.755 -1.493 0.355191 35.52 64.48 4 (AML1-ETO9a) 26.67 24.39 2.28 -2.018 0.246843 24.68 75.32 Con tr ol s U nk no w ns U nk no w ns
FIGURE 2.8 Primer design for assessing Ezh2 excision by PCR and Gel electrophoresis
TABLE 2.3 Assessment of Ezh2 excision in unknown Ezh2 status samples using qPCR
Samples indicated in Yellow are known excised controls and red are known unexcised controls. Levels of excision highlighting in bold (final column – “Excision efficiency”)
(** control sample in which 1:1 amplification is expected. All other sample ∆Ct values compared to this control when calculating change in ∆Ct to assess excision efficiency)
37 When the same samples were run using the PCR and gel strategy (shown in Figure 2.9 - labels are colour matched to Table 2.3), the MOZ-TIF2 and AML1-ETO9a unknowns all demonstrated clear excision, with band intensities visually comparable to the percentages of excision calculated by the qPCR method.
With successive repeats (data not shown), the qPCR method proved to be a reliable means of assessing levels of Ezh2 excision and was comparable to assessing bands on agarose gels after PCR using a traditional primer strategy as described above. It had the added advantage of being able to quantify levels of excision approximately in terms of percentages, thereby allowing a fairer comparison across
in vitro and in vivo samples that required genotyping throughout this PhD project, therefore this
method was used for genotyping and assessing Ezh2 deletion in all experiments described.
FIGURE 2.9 Assessment of Ezh2 excision in unknown Ezh2 status samples using PCR & Gel
F1+R1 and F1+R2 primers used for PCR
Excised controls (yellow): show intense 407bp band expected in excised state and less intense 533bp band reflecting a small proportion in the unexcised state
Unexcised controls (red): show a single 533bp band expected in unexcised state
Test samples (blue/green): all demonstrate varying levels of excision (both 407/533bp bands of varying intensities) directly comparable to estimated percentage of excision by qPCR method
*additional faint band seen across test samples at 316bp position reflects residual wild-type status, as samples were taken from primary transplants into wild-type recipients, therefore reflect chimerism
38