• No se han encontrado resultados

red (Sciurus vulgaris) and grey (Sciurus carolinensis) squirrels

Abstract

Pathogens are increasingly being cited as impacting wildlife populations. The red squirrel (Sciurus vulgaris) is one declining species in the UK that has had disease attributed to its demise. For this reason there is an increasing need for knowledge on the epidemiology of diseases in squirrels and of wildlife populations in general. Such studies are underpinned by reliable diagnostic techniques that are required to be both sensitive and specific. The data presented herein details the development of quantitative PCR assays to detect two important viruses that are documented as causing red squirrel mortality in existing and re- introduced populations, squirrelpox virus (SQPV) and adenovirus (ADV). A segment of the phosphoglycerate kinase gene was identified as a good candidate for an endogenous internal control and reference gene in order to allow relative quantification of the two viral target genes. Separate assays for both species of squirrel found in the UK were optimised and were shown to run reliably in both duplex and triplex forms. The assay developed for the grey squirrel (Sciurus carolinensis) is used to assess the reliability of cutaneous swabs in predicting SQPV infection and rectal swabs in detecting ADV in this species. High prevalence of both viruses are reported at 77% and 58% for SQPV and ADV respectively (n=13). Swabs from the palmar aspect of the antebrachium (forearm) proved to be the most reliable investigated area to detect SQPV DNA, while skin samples from the flank showed the highest SQPV loads. ADV was detectable in both sample types investigated; blood and rectal swabs. The assays developed should provide a sound foundation for investigations into the epidemiology of the two potential pathogens that are highly likely to be important in the long term conservation of the red squirrel in the UK.

Keywords: squirrel, quantitative, PCR, multiplex, squirrelpox, virus, adenovirus, wildlife, disease

124

Introduction

The red squirrel (Sciurus vulgaris) in the UK has suffered a severe reduction in its abundance and distribution (Battersby and Tracking Mammals Partnership 2005). This demise has coincided with the introduction of the non-native grey squirrel (Sciurus carolinensis) in the 1900’s (Usher et al. 1992, Gurnell and Pepper 1993). Initial theory suggested competition for resources resulted in the displacement of red squirrels in much of England and Wales (Okubo et al. 1989). However, the speed of decline observed could not be explained by competition alone, when infectious disease was included in theoretical models the witnessed decline could be mapped much more accurately (Tompkins et al. 2003). As such there has been much interest in disease diagnosis of red squirrels, in particular that of squirrelpox virus (SQPV) and adenovirus (ADV), both of which are known to cause mortality in red squirrels (Tompkins et al. 2002, Duff et al. 2007). The former is expected to have played a pivotal role in the replacement of the red squirrel with grey squirrels in much of the U.K. (Rushton et al. 2006). The grey squirrel is believed to act as a reservoir host for the virus, suffering little clinical disease but shows a high seroprevalence in wild populations (Sainsbury et al. 2000, Bruemmer et al. 2010).

In order to increase understanding of the red and grey squirrel system in the U.K., greater knowledge is required about the epidemiology of the diseases in squirrels. Early studies have relied upon ELISA to indicate previous infection status of the populations investigated however this has the disadvantage of only indicating previous exposure and not the current infection status of the animal. More recently, PCR has been used to determine current infection status in both conventional form (indicating presence or absence) (McInnes et al. 2009) and in quantitative form (QPCR) (indicating a quantity of viral DNA present) (Atkin et al. 2010). As expected from the differing clinical presentations of the two species, they differ in their viral loads, with greys showing much lower concentrations thus the more sensitive QPCR is preferred especially when analysing viral presence in this species (Atkin et al. 2010).

125

No previous test has incorporated an internal control whether exogenous or endogenous. Internal endogenous controls are frequently used in gene expression studies but rarely used in pathogen detection assays. However, such controls should be considered essential in all pathogen detection assays allowing the detection of true negatives rather than positive individuals being identified as negative due to failed DNA isolation/purification, or PCR reaction inhibition which can occur commonly with microbial samples (Brankatschk et al. 2012). Correct identification of negative animals is especially important when other diseases are believed to show clinical signs very similar to SQPV (Simpson et al. 2010).

Current PCR methods described to date for both ADV and SQPV are uniplex, i.e. they use a single pair of primers to target a single gene. The current published QPCR uses SYBR® green as the fluorescent dye, limiting the assay’s specificity and use to uniplex assays only. The use of hydrolysis probes can improve specificity and allow assays to be multiplexed, allowing the detection of multiple target genes in a single reaction saving on costs and resources without any reduction in test quality parameters. Here assays are developed for each species of squirrel using hydrolysis probe technology to detect conserved regions in the SQPV G8R gene and the squirrel ADV DNA polymerase gene with an incorporated endogenous control utilising an identified conserved region of the squirrel phosphoglycerate kinase (PGK) gene.

126

Methods

Endogenous control selection

Potential gene targets for the endogenous control were identified based on previously published studies for other species (de Jonge et al. 2007). Although consistent transcription was not a prerequisite for our function, here they provide genes found throughout species used for common cellular processes and as such are likely to be highly conserved across all mammals. NCBI’s Blast (Altschul et al. 1990) was then used to align highly conserved areas of the published mouse (Mus musculus) genes with that of thirteen-lined ground squirrel (Ictidomys tridecemlineatus), the only Sciuridae family genome freely available in GenBank® (Benson et al. 2010). Any regions of genes that were conserved (indicated by a high score and low E value) between the mouse and thirteen-lined ground squirrel were assumed to be indicative of a good candidate for conservation between the two squirrel species of interest.

Primers where designed based on the thirteen-lined squirrel sequences identified during the blast search using the freely available Primer3Plus software (Untergasser et al. 2007). Two primer pairs for each reference gene were selected for trial. The primers (Eurofins MWG Operon, Edersberg, Germany) were then tested using 10µl of Precision™ mastermix SYBR® green (2x concentration) (Primer Design, Southampton, UK), 200nM final concentration of each primer, 5µl of DNA template and the total volume made up to 20µl with molecular grade water. DNA templates were assessed for DNA concentration using a NanoDrop 1000 Spectrophotometer (Thermo Scientific, Asheville, United States) and diluted to 20ng/µl resulting in 100ng of DNA template in each reaction. Reactions were carried out on a Lightcycler® 480 II real-time cycler (Roche, Welwyn Garden City, UK), programmed with the following reaction conditions; enzyme activation occurred with a single cycle of 10 minutes at 95oC followed by 40 cycles consisting of denaturation for 15 seconds at 95oC, followed by annealing for 60 seconds at 52oC. A relatively low annealing temperature (Ta) was selected

to encourage primer binding and facilitate the selection of primers with high specificity even at lower temperatures. The primers were tested against DNA templates extracted from mouse fibroblasts (originating from cell culture), cultured grey squirrel kidney cells, grey

127

squirrel skin and blood, red squirrel skin and blood and avian hepatic tissue. All were extracted using a DNeasy® blood and tissue kit (Qiagen, Manchester, UK) following the manufacturer’s protocol. The resultant amplified products were then separated by agarose gel electrophoresis (3% agarose, 8 V/cm, 90 minutes). Those primers that showed a single band of approximately equal size to the predicted amplicon size were then selected for sequencing.

PCR product sequencing

Excess primers and nucleotides were removed from the PCR products using the ExoSAP-IT® kit containing shrimp alkaline phosphotase and exonuclease (Affymetrix, High Wycombe, UK) following the manufacturer’s protocol. The BigDye® Terminator v3.1 Cycle Sequencing kit (Applied Biosystems, Life Technologies, Paisley, UK) was then used for the sequencing reaction using the PCR primers. One µl of the cleaned product was added to 9µl of reaction mix (5x sequencing buffer, 0.75µl BigDye® 3.1 (Applied Biosystems, Life Technologies, Paisley, UK) and 1.6pM of left or right primers). These then underwent 25 cycles; denaturation 96oC for 10 seconds, annealing 50oC for 5 seconds and extension 60oC for 4 minutes. This was then precipitated using 3M sodium acetate followed by re-suspension in HiDi™ formamide (Applied Biosystems, Life Technologies, Paisley, UK). The sequence of products was then determined using an ABI 3130xl (Applied Biosystems, Life Technologies, Paisley, UK). Alignments of the determined sequence with the target sequence were performed in Mega 5.1 (Tamura et al. 2011). Two candidate endogenous target genes were selected; those primer pairs that produced sequences contiguous with each other and to the target region in both species of squirrel in both sample types (skin and blood).

Multiplex PCR design

Primers and probes based on the G8R SQPV gene, ADV DNA polyermase gene (accession number: JN205244) and the endogenous control sequences determined previously were designed using AlleleID® 7 software (Premier Biosoft, California, USA). The primers were trialled with known positive and negative DNA templates (for SQPV samples included DNA extracts previously tested positive using the Atkin et al 2010 assay, for ADV DNA extracts from material that had shown a high ADV load by electron microscopy were used) and

128

squirrel tissue DNA extracts. Reactions were initially run in uniplex using Precision™ SYBR® green mastermix (Primer Design, Southampton, UK) with the same reaction constituents and cycle parameters mentioned previously, although the Ta was increased to 60oC.

Products were assessed for specificity by using melt curve analysis and gel electrophoresis (as detailed previously).

Individual primer concentrations were optimised; the primer concentration that gave the lowest crossing point (Cp) without the appearance of additional peaks in the non-template

control (NTC) on the melt curve was considered optimum, indicating good reaction efficiency and specificity. The optimum annealing temperature was checked by using a Hybaid Px2 thermal cycler (Thermo Scientific™, Asheville, USA) with a temperature gradient ranging from 55-65oC. The amplified products were separated by gel electrophoresis (as stated previously) and assessed for band intensity and the presence of additional bands to indicate non-specific binding at lower temperatures.

In selecting the fluorescent label for the probe it is important that there is a little spectral overlap of the reporter dyes (Marras 2006), the reporter dyes used were FAM, Texas Red and Cy5 for PGK, SQPV and ADV respectively. These were quenched with BHQ-1, BHQ-2 and BHQ-3 respectively. Hydrolysis probes designed concurrently with the primers using the AlleleID® 7 software (Premier Biosoft, California, USA) were trialled in uniplex for those multiplex sets that had been optimised, using Precision™ mastermix without SYBR® green (Primer Design, Southampton, UK). Cp values using SYBR® green and probes were compared

on identical DNA template samples. Probe concentrations were then optimised; the probe concentration that gave the lowest Cp was selected.

Multiplex sets were initially assessed for their multiplex ability by comparison of Cp values

obtained with identical DNA templates with the primer sets in uniplex (single assay per reaction), duplex (double assays per reaction) and triplex (triple assays per reaction) reactions. To create a DNA template that was known to be positive to the reference and both target genes samples determined positive in previous trials were combined. For the

129

multiplex trial the mastermix was changed to a multiplex specific mastermix; QuantiTect® virus mastermix (Qiagen, Manchester, UK). Each reaction consisted of 4µl of QuantiTect® virus mastermix (5x concentration), predetermined final concentration of each primer and probe, 10µl of DNA template (previously diluted to 5ng/µl) and the total volume made up to 20µl with molecular grade water. The following reaction conditions were carried out; one cycle of enzyme activation of 5 minutes at 95oC followed by 40 cycles consisting of denaturation for 15 seconds at 95oC, followed by annealing for 75 seconds at 60oC. Reactions were checked for amplification fluorescence and products separated by gel electrophoresis (as described previously).

On identifying viable multiplex sets the efficiencies of the reactions were then assessed using serial dilutions of reaction standards prepared from synthetically manufactured oligonucleotides (single-stranded DNA) based on the target sequence of each assay (<120bp - Eurofins MWG Operon, Edersberg, Germany, >120bp – Integrated DNA Technologies, Leuven, Belgium). This allowed the accurate creation of serial dilutions and standards of known quantity using the calculation outlined in (O’Callaghan and Fenech 2011). For the calculations performed for the selected assays and the protocol for the creation of serial dilutions using Lambda DNA (Fisher Scientific, Loughborough, UK) as a carrier to ensure the same quantity of DNA in each dilution, see Appendix 2; Protocols 1 and 2. Only those sets that displayed efficiencies between 90-110% for all assays were selected.

Grey squirrel sample trial

In order to assess the performance of the multiplex set on practical samples and to help identify the best samples for reliable viral detection in grey squirrels, a trial was carried out on samples collected from 13 grey squirrel carcases selected at random from those submitted during 2011. Swabs were taken from sites believed to have a predilection for SQPV infection (oral/lip, eyelids and arm scent/sensory gland) along with a rectal swab believed to be the most likely place to indicate ADV enteric infection. Corresponding skin samples were also taken along with flank and chest skin samples. Blood where available was also collected. All samples were stored at -20oC until DNA purification could be carried out, using a DNeasy® blood and tissue kit (Qiagen, Manchester, UK) following the

130

manufacturer’s protocol for tissue and blood sampling and the protocol detailed in Protocol 3 of Appendix 4 for swabs. DNA extracts were then stored at -20oC until PCR analysis was undertaken. All extracts were run in triplicate with one non-template control (NTC) for each sample following the optimised protocol determined previously. With each reaction plate, a single separate positive control for the reference gene and the target genes were included, along with a standardised calibrator (common to all reaction plates) and a triplicate of a standard of known quantities of all assay genes. A sample was only considered positive if all three replicates showed a positive reaction, the median Cp value was used for all

subsequent calculations. A relative quantitative ratio (RQ) between the number of copies of the target gene to reference gene was then calculated using the equation below;

(

)

(⁄

)

Where RQ = relative quantification ratio, T = target concentration and R = reference gene concentration.

131

Results

Endogenous control gene selection

The following genes were identified as having at least one highly conserved region between the mouse genome and that of the thirteen-lined ground squirrel; aldolase A (ALDOA), β- actin (ACTB), glyceraldehydes-3-phosphate dehydrogenase (GAPDH), lactate dehydrogenase A (LDHA), phosphoglycerate kinase (PGK), ribosomal protein large (RPL) 9, 27a and 30, ribosomal protein small (RPS) 13 and vimentin (VIM). Results of the trial of the primers are summarised in Table 1.

132

Reference Gene

Primer set Squirrel species (G/R) Single band (Y/N) Predicted band size (bp) Band size (bp) ALDOA 1 G N 203 400,550,600 R Y 203 550 2 G N 179 300,400,500 R Y 179 200 ACTB 1 G Y 121 70 R Y 121 70 2 G Y 121 120 R Y 121 120 GAPDH 1 G Y 185 180 R Y 185 180 2 G Y 126 150 R Y 126 150 LDHA 1 G N 109 R N 109 2 G Y 112 120 R Y 112 120 PGK 1 G N 117 R N 117 2 G Y 184 175 R Y 184 175 RPL9 1 G Y 153 150 R Y 153 150 2 G Y 152 155 R Y 152 155 RPL27a 1 G Y 139 120 R Y 139 120 2 G Y 141 400 R N 141 400, 450 RPL30 1 G N 162 300, 450 R Y 162 300 2 G N 102 100, 250 R N 102 100, 300 RPS13 1 G N 109 200, 450 R Y 109 550 2 G N 166 200, 550 R N 166 200, 550 VIM 1 G N 107 120, 400, 550 R N 107 120, 400, 1000 2 G N 141 450, 600, 900 R Y 141 250

Table 1. Summary of PCR product size after initial trial of primers sets. Those sets that show a single band in the region of the predicted size are shown in bold. Those highlighted in grey are the candidate genes selected for sequencing.

133

Primers designed based on those sequences identified as being highly conserved can be found in Appendix 2; Table 1.

Determined sequences and subsequent alignments of the selected candidate genes based on the results are shown in Appendix 2; Figures 1-6. Both PGK (primer set 1) and RPL9 (both primer sets) showed good conservation of DNA sequence between the thirteen-lined ground squirrel and those sequences determined. However the target region for the red squirrel RPL9 gene showed a large number of single nucleotide polymorphisms (SNPs) (15/179bp, Figure 1). This may lead to difficulties with primer and/or probe binding so the RPL9 as a reference gene candidate was discounted for both species. Although the RPL 9 sequence for grey squirrels showed few SNPs (2/176bp, Figure 1) in order to allow a final comparison between viral loads of both species it was a prerequisite that the same reference gene was used for both. Figure 1 shows that PGK in both species of squirrel is relatively conserved within the target region and displays few SNPs and thus was selected as the candidate reference gene although both sequences were adequately different to warrant the design of different multiplex sets for each squirrel species.

Grey PGK target region –

AGTAGAGAAAGCTTGTGCCAATCCAGCAGCTGGTCTATTATCCTGTTGGAGAACCTTCACTTTCATATTGAGGAAGAAGGGAAGGAAATAGATG CTTCTGGGAACAAGGAAAGCCGAGTCAGCCGAAGTAGCTTTTCCGAGCTTCACTTTCCAAACCAGGGGATGTCTATGTGAATGATGA Red PGK target region –

AGTAGAGAAAGCTTGTGCCAATCCTGCAGCTGGGTCTGTTATCCTGTTGGAGAACCTTCGCTTTCACGTGGAGGAAGAAGGGAAGGGAAAAGAT

RCTTCTGGGAACAAGGTGAAAGCCGAGCCAGCCAAAGTAGAAGCTTTCYGAGCTTCACTTTCCAAACTAGGGGATGTCTATGTGARTGATGA

Grey RPL9 target region –

TTGGTACAAGATGAGGTCTGTGTARGCTCACTTCCCCATCAACGTCTGTTATTCAGGAGAATGGGTCTCTTGTTGAAATCCGAAATTTCTTGGG

TGAAAAATATATCCGCAGGGTTCRTATGAGGACAGGTGTTGCTTGTTCAGATGTCTCAAGCTC

Red RPL9 target region –

TTGGTACAAGATGTRGGTCTGTGTRMGCTCATYTTCCCCMTCACATGCKTGTTWTCTACAGGAGAATGGGTCTCTTGTTGAAATCCRAAATTTC

TTGGGTGAAAATATATCCSCAGGGTTCGGWDKRGGACGGGYGTTGCTTGTTCAGTRTCTCAAGCTC

Figure 1. Determined sequences of candidate reference genes for red and grey squirrels. SNPs are displayed in red using IUPAC nucleotide code. RPL 9 shows a large number of SNPs in red squirrels thus was discounted as a candidate for both species.

134

The selection of multiplex primer and probe sets, designed using AlleleID®, was based on the best overall rating as determined by the software. The primer and probe sequences are shown in Table 2, their position on target gene regions are shown in Appendix 2: Figure 7.

Multiplex set Assay Primer (L/R) / Probe(P) Sequence Concentration (nM) Ta Range A SQPV L R P CATCGACCAGAAGAAGTC GCTGATGCACTTGATGAA CGTGTTCAACTTCCACCTCTACG 200 300 300 NA ADV L R P CGGGAATCTTTACAATCG TGTCCATGTTAGTCTTCC AAGAATGGACCGACACATTGCC 300 300 300 57-63 PGK L R P GGTCTATTATCCTGTTGGA CTGGTTTGGAAAGTGAAG TACTTCGGCTGACTCGGCTT 300 200 400 58-62 B SQPV L R P TGGGTCTTCGCATAAAAC GACCTCTTCCGAGAACTC CGTCACTATCTGCCTCAACCG 300 200 200 55-62 ADV L R P TCCGGGAATCTTTACAATC CAGAGATTCATTTGTCCATG AGAATGGACCGACACATTGCC 300 300 300 55-65 PGK L R P CTGGGAACAAGGTGAAAG TCATCAYTCACATAGACATCC CGAGCCAGCCAAAGTAGAAGC 300 200 300 57-62

Table 2. Primer and probe sequences for the grey (A) and red (B) squirrel assays with uniplex optimised primer and probe concentrations and Ta range showing maximum band

intensity.

Optimised primer concentrations and optimal annealing temperature range for individual assays in uniplex are shown in Table 2. An annealing temperature of 60oC is shown to be acceptable for all assays.

Sequences and alignments of each assay are shown in Appendix 2: Figures 8-13. All assays show amplification of the correct target region with little or no significant variation in the region amplified.

135

Results from the comparison of using SYBR® green or hydrolysis probe technology to detect DNA amplification are summarised in Figure 2. Both chemistries show very similar Cp values

with probe based detection showing lower Cp values in the majority of cases despite the

advantage of increased specificity.

Figure 2. Comparison of Cp values obtained; using SYBR® green and hydrolysis probe

technology for multiplex sets A (A) and B (B) and using hydrolysis probes in uniplex, duplex