EVALUACIONES CURSO 17-
3 CRITERIOS EVALUACIÓN
Extracted plasmid DNA was linearised in a 2 hour restriction digest reaction in a thermal cycler (Applied Biosystems Verti 96 well thermal cycler) at 370C for use in
downstream amplification. A 50µl reaction volume was prepared for each cDNA clone as follows. SLC22A6: 32.2µl (2µg) of SLC22A6 cDNA clone DNA, 0.1µl (10 units) EcoRV, 5µl of NEB buffer 3 (1x final concentration), 0.5µl (1µg/ml final
concentration) of BSA and 12.2µl water. SLC22A7: 8.64µl (2µg) of SLC22A7 cDNA clone DNA, 0.1µl (10 units) XbaI, 5µl of NEB buffer 4 (1 x final concentration), 0.5µl (1µg/ml final concentration) of BSA, 35.76µl water. SLC22A8: 9.02µl (2µg) of SLC22A8 cDNA clone DNA, 0.1µl (10 units) XbaI, 5µl of NEB buffer 4 (1x final concentration), 0.5µl (1µg/ml final concentration) BSA, 35.38µl water. The resulting DNA was then analysed by gel electrophoresis (see section 2.2.4 for protocol) to confirm DNA was successfully linearised (linearised DNA migrates less far than the
99 supercoiled form on an agarose gel). SLC22A7 and SLC22A8 cDNA clone plasmid DNA was successfully linearised by restriction with XbaI, however EcoRV failed to linearisethe SLC22A6 cDNAclone DNA (figure 4.1). Linearisation of the SLC22A6 cDNA clone DNA was achieved following a second attempt with XbaI instead of EcoRV (32.2µl (2µg) of SLC22A6 cDNA clone DNA, 0.1µl (10 units) XbaI restriction endonuclease, 5µl of NEB buffer 4 (1x final concentration), 0.5µl (1µg/ml final
concentration) BSA, 12.2µl water; figure 4.1). Restriction digest reactions were then repeated in a total volume of 150µl (3 x 50µl reaction volumes) to achieve enough DNA for amplification and purified using the GenElute PCR clean up kit (Sigma Aldrich; see section 2.2.6 for details of manufacturer’s protocol).
Figure 4.1: Visualisation of linearised SLC22A6, SLC22A7 and SLC22A8 cDNA clones pre and post restriction digest with XbaI and EcoRV on a 1% agarose gel using NEB 10kb DNA ladder as a reference (A). From left to right: 1kb DNA ladder (1),
supercoiled SLC22A6 DNA (2), SLC22A6 DNA post restriction digest (3), supercoiled SLC22A7 DNA (4), SLC22A7 DNA post restriction digest (5), supercoiled SLC22A8 DNA (6), SLC22A8 DNA post restriction digest (7). SLC22A7 and SLC22A8 were successfully linearised by restriction digest. Linearisation of the SLC22A6 cDNA clone was unsuccessful and restriction digest subsequently repeated successfully with XbaI and visualised on a 1% agrose gel using NEB 10kb DNA ladder as reference (B). From left to right: 1kb DNA ladder (1), supercoiled SLC22A6 DNA (2), SLC22A6 DNA post restriction digest (3).
100 4.2.4Amplification of SLC22A6, SLC22A7 and SLC22A8 templates from plasmid DNA
Purified, linear SLC22A6, SLC22A7 and SLC22A8 cDNA clone plasmid DNA was amplified by PCR using Fast Start High Fidelity PCR system reagents (Roche Diagnostics, Burgess Hill, UK) as described in section 2.2.5 (see table 4.1 for primer sequences) using the following thermal profile: an initial denaturing step for two minutes at 950C, followed by 40 cycles of denaturation at 950C for 30 seconds,
annealing at 670C (SLC22A6) or 690C (SLC22A7) or 720C (SLC22A8) for 30 seconds, and elongation at 720C for two minutes. This was followed by a terminal elongation
step at 720C for seven minutes. The annealing temperature for each template was determined based on primer melting temperatures (Tmo).
Template Reverse (upstream) primer sequence (5’-3’) Forward (downstream) primer sequence (5’-3’)
SLC22A6 CTTCTCACAGTCCTCAGAGTCC CCCAATGGCCTTTAATGACCTC
SLC22A7 TTAGTTCTGGACCTGCTTCATGGG GCCACCAGCATGGGCTTT
SLC22A8 CGTTGTCCTCAGCTGGAG GCCACCGTGCCATGACCTTCT
Table 4.1 Full sequence of each primer pair used in SLC22A6, SCL22A7 and SLC22A8 template DNA amplification.
Templates were analysed by gel electrophoresis (figure 4.2) to ensure successful amplification of the correct size template (gel electrophoresis protocol is described in section 2.2.4). Template DNA was then purified using the GenElute PCR clean up kit (see section 2.2.6 for details of manufacturer’s protocol). At this point due to the inability to amplify the SLC22A7 template from its respective I.M.A.G.E cDNA clone, SLC22A7 cloning was abandoned. Following further troubleshooting it was discovered that the SLC22A7 I.M.A.G.E. cDNA clone contained a truncated SLC22A7 sequence; no alternative full sequence cDNA clones with the correct SLC22A7 template were available.
101 Figure 4.2: Amplified SLC22A6(A) and SLC22A8(B) and SLC22A7(C) templates visualised on a 1% agarose gel using NEB 10kb ladder as reference. From left to right: 1kb DNA ladder (1), cDNA clone (2), amplified template (3). SLC22A6 and SLC22A8 template DNA containing its respective protein coding sequence (1.6kb) was
successfully amplified from its respective cDNA clone. The SLC22A7 template could not be amplified from its respective cDNA clone.
102 4.2.5Ligation of SLC22A6 and SLC22A8 templates into a mammalian expression vector
SLC22A6 and SLC22A8 template DNA was ligated into a mammalian expression vector (pcDNA 3.1/V5-His-TOPO®) and transformed into chemically competent E. coli (One Shot® TOP10). The pcDNA 3.1/V5-His TOPO® TA Expression kit provides a high efficiency one step cloning strategy for direct insertion of Taq polymerase amplified PCR products into a plasmid vector. Topoisomerase I from Vaccinia cleaves the duplex plasmid DNA and binds to phosphate residues at the 5’ and 3’ ends of a cloning site within the plasmid, holding it in an ‘open’ conformation. The additional
deoxyadenosine base added to the DNA templates by Taq amplification binds to the 3’ deoxythymidine residue overhang of the plasmid, releasing the Topoisomerase and ligating the PCR template into the plasmid vector.
Firstly, agar plates (autoclaved, 1M agar supplemented with 50µg/ml ampicillin) were prepared and incubated at 370C for later transformation. The ligation reaction was prepared in a 1.5ml Eppendorf tube according to manufacturer’s protocol and contained the following: 3µl fresh PCR product (SLC22A6/SLC22A8 template), 1µl salt solution, 1µl sterile water, 1µl Topo vector. A control ligation reaction was also prepared for each ligation reaction containing: 1µl salt solution, 4µl sterile water, 1µl Topo vector. 3 ligation reactions were prepared in total (SLC22A6/SLC22A8 ligation and a vector only reaction). The vector only reaction acts as a control to detect non-plasmid
expressing bacterial growth; no growth should be observed in the control, only bacteria expressing the pcDNA 3.1/V5-His TOPO® TA plasmid (expressing ampicillin
resistance gene) should grow. Each ligation reaction was mixed by flicking the Eppendorf tube 3-4 times and incubated at room temperature for 30 minutes.
Thereafter, each ligation reaction was placed on ice and 2µl of each reaction added to thawed chemically competent E.coli bacteria that had previously been stored at -800C. The bacterial solutions were then incubated with the ligation reaction on ice for 15 minutes before being heat-shocked at 420C for 30 seconds. After heat-shock, the bacterial solution was immediately returned to ice for a further 5 minutes to complete transformation of the ligated plasmid into the E.coli host. A 250µL volume of SOC medium was then added to the E.coli and the bacteria allowed to multiply for 1 hour at 370C with vigorous shaking (200rpm; ThermoScientific Thermo Max Q 4450). A 200µl aliquot of the transformed bacterial cultures was then streaked onto agar plates
103 using a sterile loop at various serial dilutions (neat, 1 in 10, 1 in 100, and 1 in 1000) and allowed to incubate overnight at 370C.