The PCR method used for preparation of QSTD was adapted to real-time format by using LUX primers (Invitrogen), Platinum Taq DNA polymerase (Invitrogen) and dNTP mix (Promega). The qPCR assays were performed in Rotor-Gene 6000
Number of copies/µl = DNA concentration (g/µl) x 6.023 x 1023 PCR product length (bp) x 640
92
(Corbette). For the optimization of the qPCR assay, QSTD prepared in section 3.7.1 was used as DNA template.
LUX primers
The sequences of the fluorogenic forward primer and the corresponding unlabeled reverse primer were designed and ordered using proprietary software called D-LUX Designer (Invitrogen, http://www.invitrogen.com/lux). The characteristics of the LUX primers, such as length and Tm, are included in the primer designed by the software to output primer pairs that are located throughout the target (input) sequence. The sequences of the primers were checked using the NCBI Blast software.
Each fluorogenic LUX primer is labelled with one of two reporter dyes, either FAM (6-carboxy-fluorescein) or JOE (6-carboxy-4’,5’-dichloro-2’,7’-dimethoxy- flurescein). In the present study, FAM-labelled primer set was used to detect genes of interest (p53, caspase-3 and c-myc) while a JOE-labelled primer set was used to detect a housekeeping gene (ß-actin) as an internal control. The sequence of LUX primers used in the present qRT-PCR study is shown in Table 3.8.
93 Table 3.8: The sequence of LUX primers used in qPCR
Primer Strand Sequence Dye label GC % Tm Amplicon length
p53 Reverse cgagcGTGTTGTTGGGCAGTGCTcG FAM 60 67.55 84
p53 Forward AAGAGAATCTCCGCAAGAAAGG 45.45 61.18
Caspase-3 Forward cggcTAAAATACCAGTGGAGGCcG FAM 50 62.12 84
Caspase-3 Reverse CATCCTTTGAATTTCGCCAAGA 40.91 63.44
c-myc Forward cgccGAGGAGAATGTCAAGAGGcG FAM 55 62.29 96
c-myc Reverse ATCTGGTCACGCAGGGCAAA 55 66.23
ß-Actin Reverse cgtaccCATCACGATGCCAGTGGTAcG JOE 57.14 67.07 68
94 Amplification by qPCR
Briefly, the qPCR assay was carried out in a final volume of 10 µl. A master reagent mix that contained all the components required for qPCR except the template DNA was prepared according to the number of reactions desired (included samples, non-reverse-transcriptase control (NRTC) and non-template control (NTC). The master mix was then divided into portions of 8 µl in a 0.1 ml strip tube (Corbette). Lastly, 2 µl of nucleic acid (DNA) template was added into each tube. The preparation of master mix for qPCR is shown in Table 3.9 while the thermal cycling profile is outlined in Table 3.10.
Table 3.9: Reaction components for qPCR
Component Volume / reaction (µl) Final concentration
Master mix 10x PCR Buffer* 1 1x dNTP Mix (containing 10 mM of each dNTP) 0.5 500 µM of each dNTP
LUX primer mix** 1.5 0.3 µM
Platinum Taq DNA polymerase 0.15 -
MgCl2 (20 mM) 1.5 3.0 mM
RNase-free water 3.35 -
Template DNA 2 -
Total volume 10 -
* Without MgCl2
**LUX primer mix was prepared by mixing forward and reverse primer with appropriate volume of DEPC treated distilled water and dissolving the lyophilized pellet in tube by vortexing followed by a brief spin.
95 Table 3.10: Thermal cycling and melting profile of qPCR
3step cycling: Denaturation 95 oC 15 s Annealing 55 oC 15 s Extension 72 oC 20 s Number of cycle 35 Melting condition: Ramp from 72 oC to 95 oC Rising by 1 oC each step
Wait for 90 s of pre-melt conditioning on first step Wait for 5 s for each step afterwards
Melting curve analysis
Melting curve analysis was performed after the thermo cycling of qPCR amplification to identify the presence of primer dimmers and analyze the specificity of the reaction. In the present study, melting curve analysis was programmed to hold 90 seconds of pre-melt conditioning on first step, ramp from 72 oC to 95 oC and rising by 1
o
C each step. All amplicon for a particular primer pair should have the same Tm (melting temperature), unless there are contamination, mispriming or primer dimmers artefacts. The melting profile of qPCR is outlined in Table 3.10.
Controls
Two types of negative controls were used in the present study, which were: i) non-reverse-transcriptase control (NRTC), which is a minus reverse-transcriptase control (or "No Amplification Control") that containing the master mix reagents and the
96
RNA template without reverse transcriptase procedure. ii) non-template control (NTC), which NTC includes all of the RT-PCR reagents except the DNA/RNA template. Both NRTC and NTC were used during the entire assay development and assay evaluation.
Validation and optimization of the LUX RT-qPCR assay
(i) Specificity test of primer
The specificity of each LUX primers (p53, caspase-3, c-myc and ß-actin) was assessed against the purified DNA of QSTD of each gene (p53, caspase-3, c-myc and ß-actin), to confirm that each set of primers amplified only the specific genome. The DNA-primer mix preparation is shown in Table 3.11, the preparation of master mix for primer specificity test is shown in Table 3.12 while the thermal cycling profile is outlined in Table 3.10.
Table 3.11: DNA-primer mix preparation for optimization assay
QSTD Primer
c-myc p53 caspase-3 ß-actin
c-myc A B C D
p53 E F G H
caspase-3 I J K L
97 Table 3.12: Reaction components for qPCR
Component Volume / reaction (µl) Final concentration
Master mix 10x PCR Buffer* 1 1x dNTP Mix (containing 10 mM of each dNTP) 0.5 500 µM of each dNTP
Platinum Taq DNA polymerase 0.15 -
MgCl2 (20 mM) 1.5 3.0 mM
RNase-free water 3.35 -
Template DNA-LUX primer mix** (A-P in Table 3.11)
3.5 -
Total volume 10 -
*Without MgCl2
**LUX primer mix was prepared by mixing forward and reverse primer with appropriate volume of DEPC treated distilled water and dissolving the lyophilized pellet in tube by vortexing followed by a brief spin.
(ii) Optimization of the concentrations of LUX primers and MgCl2
The optimization were performed by using a matrix of concentrations of each LUX primer mix and concentrations of the MgCl2 (Table 3.13) to determine the
optimal concentrations of LUX primer and MgCl2 yielding the lowest Ct values, hence,
the highest amplification efficiencies. The matrix of primer-MgCl2 mix is shown in the
Table 3.13, the preparation of master mix for primer specificity test is shown in Table 3.14 while the thermal cycling profile is outlined in Table 3.10.
98 Table 3.13: Concentrations of Primer-MgCl2 mix for optimization assay
[MgCl2] (mM) [Primer] (uM) 6.0 4.5 3.0 1.5 0.3 A B C D 0.5 E F G H 0.6 I J K L
Table 3.14: Reaction components for qPCR
Component Volume / reaction (µl) Final concentration
Master mix 10x PCR Buffer* 1 1x dNTP Mix (containing 10 mM of each dNTP) 0.5 500 µM of each dNTP
Platinum Taq DNA polymerase 0.15 -
RNase-free water 3.35 -
MgCl2-LUX primer mix**
(A-L in Table 3.13)
3 -
Template DNA 2
Total volume 10 -
*Without MgCl2
**LUX primer mix was prepared by mixing forward and reverse primer with appropriate volume of DEPC treated distilled water and dissolving the lyophilized pellet in tube by vortexing followed by a brief spin.
99 (iii) Optimization of the annealing temperature (TA)
The optimization of TA was carried out as described in ‘Amplification by qPCR’
under section 3.7.2, except the TA in the thermal cycling profile. Three different TA
were tested, which were 50 °C, 55 °C and 60 °C.
Determination of the lowest detection limit and sensitivity of the LUX RT-qPCR assay
The detection limit and sensitivity of the LUX qPCR assay was assessed by determining the Ct values of serial 10-fold dilutions of purified QSTD, covering the range between 103 and 1010 copies. Standard curves prepared with these dilutions were used in every experiment of each gene.