• No se han encontrado resultados

2.2.16.1 First strand cDNA synthesis

First strand cDNA was synthesized using total RNA isolated from LNCaP cells as described in section 2.2.15. Total RNA (3μg) was mixed with 1μl of 50μM Oligo (dT)20

primer and 2μl of dNTP mixture (10mM each dATP, dCTP, dGTP, dTTP at neutral pH). After the volume was adjusted to 13μl with nuclease-free water, the mixed solution was incubated at 65°C for 5mins and chilled on ice for 1min. Then, the solution was mixed with 4μl of 5x first strand buffer, 1μl of 0.1M DTT, 1μl of RNaseOUT (40units/μl) and 1μl of SuperScriptIII reverse transcriptase (200units/μl). The reaction mixture was incubated at 50oC for one hour, followed by incubation at 70oC for 15mins

to inactivate the reaction. The First strand cDNA was used as a template for amplification.

2.2.16.2 Polymerase chain reaction

Polymerase chain reaction (PCR) was performed to amplify a specific region of the DNA template. The forward and reverse primers are listed as below:

Forward primers sequence: 5’- ACCATGGCCACAGTTCAGCA -3’ Reverse primers sequence: 5’- CCTGTCCAAAGTGATGATGGAA -3’

The DNA template was amplified in a total volume of 50μl reaction mixture as shown in table 2.5.

Table 2.5 PCR mixture

The reaction was incubated in a thermal cycler at 95oC for 5mins, followed by 35 cycles

of PCR amplification, each cycle consisting of denaturing: 95oC for 30 seconds;

Page | 97 DNA template 50-200ng 10x PCR buffer 5µl MgCl2 (25mM) 3µl Forward primer (10µM) 1µl Reverse primer (10µM) 1µl dNTPs mixture (10mM each) 1µl Taq polymerase ( 5U /µl) 1µl Nuclease-free water Up to 50µl

annealing: 55oC for 45 seconds; extension: 72oC for 1 min, followed by one cycle

incubation at 72oC for 5mins and then maintained the reaction at 4oC. PCR

amplification products were analysed by agarose gel electrophoresis and purified as previously described in section 2.2.11.3 and 2.2.11.4.

2.2.17

Real-time PCR

The real-time PCR, also known as quantitative real time polymerase chain reaction (qPCR), was applied in order to quantify the level of C-FABP mRNA in the transfected LNCaP cells. Traditional PCR or RT-PCR uses agarose gel electrophoresis for detection of amplified DNA fragments at the end of the reaction. However, real-time PCR is designed to collect data in the exponential growth phase when the reaction is in progress, which significantly increased the accuracy for DNA and RNA quantitation compare to the traditional PCR or RT-PCR.

Several methods exist for real-time quantitation of amplification products, including fluorescence resonance energy transfer techniques using fluorescently labeled molecular beacons, SYBR Green I. During the PCR amplification, the fluorescence of SYBR Green I increases 100- to 200-fold when bound to double stranded DNA as presented in Figure 2.6 The number of amplicons generated is directly proportional to the increase in reporter fluorescent signal which was detected at the end of the elongation step of the PCR reaction by Chromo4 fluorescence detector.

Figure 2.6 SYBR Green Dye binds to the double stranded DNA and fluoresces

2.2.17.1 Real-time PCR primer design

The real-time PCR primers were designed spanning exon-exon junctions of C-FABP gene in order to avoid amplifying any genomic DNA contamination. The size of PCR amplicon was limited to between 50bp to 200bp and the primers self complimentarity and hair pins was also checked as SYBR Green Dye bound to all double stranded PCR products, including non-specific PCR products. Similarly, the house-keeping gene, β actin primers were designed as listed below:

Real-time PCR primers for C-FABP

Forward primers sequence: 5’- CATTGGTTCAGCATCAGGAG -3’ Reverse primers sequence: 5’- TTCATGACACACTCCACCACT -3’

Real-time PCR primers for β actin

Forward primers sequence: 5’- ACCATGGCCACAGTTCAGCA -3’ Reverse primers sequence: 5’- CCTGTCCAAAGTGATGATGGAA – 3’

2.2.17.2 Relative real-time PCR

The total RNAs were extracted from each cell line using RNAeasy Mini Kit as described in section 2.2.15 and reverse transcribe 1µg of total RNA to cDNA using SuperScriptIII reverse transcriptase as mentioned in section 2.2.16.1. The real-time PCR Page | 99

mixture for both C-FABP and β actin was prepared with 5µl of 2× Brilliant SYBR Green qPCR master mix (containing SureStart Taq DNA polymerase, dNTPs mixture, MgCl2 and optimized buffer), 1µl of forward primer, 1µl of reverse primer, 1µl of

cDNA generated by reverse transcription and 2µl of nuclease-free water. After gentle mix, the reactions were centrifuged briefly and placed to a real-time PCR thermocycler. The real-time PCR program is listed in table 2.6.

Table 2.6 Real-time PCR program for amplification of short target DNAs (50-400bp)

2.2.17.3 Relative quantitation analysis

Melting curve analysis was carried out to detect the presence of nonspecific products and the primer dimmers. The relative fold differences of C-FABP mRNA between transfected cell lines and parental cell line LNCaP were obtained using the formula listed below:

Relative fold difference=2 -ΔΔCt

Temperature Time

Step1 Denaturation 95oC 15mins

Step2 Denaturation 94oC 15 seconds

Step3 Annealing 60oC 30 seconds

Step4 Extension 72oC 30 seconds

Step5 Plate reading 57oC 15 seconds

Step6 Go back to step 2 and repeat 38 cycles

Step7 Final extension 72oC 10mins

Step8 Melting curve 65-95oC 1oC increment for

ΔCt was calculated as the average Ct for the gene of interest minus the average Ct for the house keeping gene, β actin.

ΔΔCt was calculated as the ΔCt of the test sample minus the ΔCt of the calibrator sample