• No se han encontrado resultados

1.2. ENUNCIADO DEL PROBLEMA

2.2.1. Derecho indígena

2.2.1.6. Los derechos de los pueblos indígenas en el sistema

A human breast cDNA library in Xgtl 1 (Clontech), and a mouse mammary gland cDNA library (from C. Watson) in Uni-ZAP XR (Stratagene) were used in

screening for PGM4. The human library mRNA source was breast tissue, excised during mastectomy in the eighth month of pregnancy, which was well-

differentiated and showed lactational competence. The mouse mammary gland library mRNA source was 11-day lactating tissue. The number of independent recombinants were 1.2x10® for the mouse library and 1.6x10® for the human library.

5.1.1 A search for PGM4 cDNA using antibody probes

Three anti-PGM antibodies were available for use as probes. The anti­ rabbit muscle PGM antibodies produced by immunising a sheep with a purified preparation of rabbit skeletal muscle PGM (Whitehouse etal, 1989) and two anti­ human PGM1 polyclonal antibodies, designated 6' and 10', produced by

immunising a sheep with fusion protein fragments of PGM1 (Edwards, Lovegrove and Whitehouse, unpublished data). The 6' and 10' constructs extend from amino acid residue 448 to 561 (domain IV of the PGM1 protein) and from residue 156 to 561 (domains IV, III, II and 31 residues at the carboxyl end of domain I),

respectively as determined from 3D protein crystallography studies by Dai e ta l (1992) (Fig.5.1). The anti-human PGM and anti-rabbit PGM antibodies were used to screen both the human and mouse libraries. Cross-reactivity between both the human 6' antibodies and the anti-rabbit antibodies and mouse PGM has been has been demonstrated by activity staining following lEF separation (Whitehouse, unpublished data).

At each primary screen of the libraries between 1.8x10® and 6x10® pfu were examined using the anti-PGM 1 antibodies. Binding of the anti-PGMI antibody was detected with a peroxidase conjugated rabbit anti-goat second antibody. Plugs containing positive plaques were picked and independently subjected to successive rounds of screening at decreasing plaque densities to purify each positive recombinant. A total of 1.08x10® pfu were screened from the human library (67.5% of the total number of independent clones). While 3.0x10® plaques were screened from the mouse library (2.5 times the total number of recombinants).

N)

CO

1 189 301 420 561 amino acid residue

I_________ ! I XX_____ I_____ III I______ ly ______ I protein domains

6' anti-PGM 1 antibody

10' anti-PGM 1 antibody

Fig.5.1

Illustration of the relative positions of PGM1 exons and protein domains (bold print) (Dai etal, 1992). The dashed horizontal lines represent the regions of the protein expressed from the 6' and 10' pEX vector constructs which were used to raise anti-PGMI antibodies (Edwards and Whitehouse, unpublished).

After screening the mouse mammary gland library with the anti-human PGM1 6' antibodies and the anti-rabbit PGM antibodies, 28 potential positive recombinants were isolated. However, these were all false positives as none tested positive at the secondary screen. Similarly, a number of false positives,

19, were identified after screening the human breast tissue library with the anti- human PGM1 antibodies and the anti-rabbit PGM antibodies. However, five positives selected after screening with the anti-human PGM1 10' antibodies were immunopositive after four rounds of screening and were purified to homogeneity. Table 5.1 summarises the screening results of the human and mouse libraries with the three antibodies. The failure to detect mouse PGM positive recombinants may be because by chance none of the cDNAs are in-frame in the fusion proteins (only 1 in 6 cDNAs will be in the correct reading frame) and/or the affinity of human and rabbit antibodies for mouse PGM protein may not be adequate for library screening.

PCR was used to amplify the cDNA inserts of the 5 human PGMI-like recombinant clones (MPL-1, -4, -5, -6, -7) for further analysis. Purified phage stocks were amplified to titres of between 7x1 O'*0 and 1.6x10'*'* pfu mb'* and used in amplifications with primers which flank the EcoR cloning site, within the Lac Z gene in Xgtl 1 (Fig.5.2). The sizes of the amplification products of MPL-1, -5, -4, -6 and -7 (shown in Fig.5.3A) were 340bp, 440bp, 400bp, 450bp and 400bp respectively (the region between the Xgtl 1 primers is 85bp).

Autoradiography following Southern blot analysis of these amplification products showed no hybridisation to the PGM1 cDNA probe (Fig.5.3B).

Clones MPL-1 and MPL-5 were chosen for sequencing. The PCR products were purified after electrophoresis in low melting point agarose gels. The products were sequenced using the Xg\11 forward and reverse primers. Sequence data using both primers was overlapped to ensure that the whole of the recombinant insert was sequenced. When sequenced, MPL-1 was found to be 252 bp long with one open reading frame of 26 amino acid residues

Library Antibody No. pfu No. false No. PGM1

probe screened positives positive

recombinants HUMAN anti-human PGM1 6' 3.6x105 9 0 anti-human PGM1 10' 3.6x1 qS 3 5 anti-rabbit PGM 3.6x1 qS 7 0 MOUSE anti-human PGM1 6' 1.2x106 16 0 anti-human PGM1 10' nt nt nt anti-rabbit PGM 1.Sx106 12 0

Table 5.1 Summary of the screening results of the human and mouse mammary tissue libraries with anti-rabbit PGM and anti-human PGM1 6' and 10' antibodies. False positives are those only detected at the primary screen. PGM1 positive recombinants are those which remained immunopositive after four rounds of screening and purification to homogeneity, nt is not tested.

left arm Xgtii forward primer LacZ reverse primer right arm

B

Xgtii

forward primer- ggtggcgacgactcctggagcccgtcagtatcggcggattccagctgagcgccggtcgctaccattaccagttg gtctggtgtcaaa IV) O) c caccgctgctgaggacctcgggcagtcatagccgcctaaggtcgactcgcggccagcgatg|gtaatggtcaaccagaccacagtt|t: Xgt11 — reverse primer M--- 85bp ► Fig.5.2

A: Position of A,gt11 forward and reverse primers relative to LacZ gene and Xgt11 left and right arms (each arm is 43.7kb). The EcoRI cloning site is indicated.

B: Sequence of Xgt11 across the EcoRI cloning site. Forward and reverse primers are boxed: the Xgt11 forward primer is 5' GGTGGCGACGACTCCTGGAGCCCG 3'; the sequence of the Xgt11 reverse primer is 5' TT G AC ACC AG ACC AACTGGTAAT G 3'. The amplification product, with no insert, is 85bp.

M

bp 1 5 4 6 7 C 1 5 4 6 7 C

rv>

Fig.5.3 Panel A: PCR amplification products of clones 1, 4, 5, 6 and 7. C, a positive control for the PGM1 probe, is a 308bp PCR product spanning nt 1909 to 2217 of PGM1 cDNA (numbering as

Whitehouse et al, 1992). M is a DNA size marker (indicated in base pairs (bp)).

Panel B: Autoradiograph following Southern blot of gel in A with PGM1 cDNA as probe; lanes are