Descripción de las clases y los métodos

presence or absence of STS markers mapping to the region. This enabled clones to be ordered into overlapping arrays which can physically connect STSs. The search for genes mapping to the region was an ongoing process. Newly assigned chromosome 7 genes were tested for their presence onto these clones. Those that were found to be positive were incorporated into the contig as gene-based STSs, to assemble a transcript map in the region. The completed contig showing the physical locations of these genes and markers is illustrated in figure 3.13.

The v4/m-PCR generated STS, A1 (section 3.2.3), was found to be present on

the D7S690 containing YACs yWSS3043, 3255, 3215 and 2597. It was also found on YACs yWSS2550 and 961-F-5, part o f a proximal contig assembled by a co-worker. The latter clone contains D7S656 and D7S683, allowing the D7S690 containing YACs to be orientated relative to other genetic markers.

D7S795 was present on all D7S690 containing YACs. The physical order of these markers is based on STS content mapping by Washington University (E. Green, personal communication). D7S1514 was found to be present in the D7S690 containing YAC yWSS298 and CEPH clones 959 3 3, 908_D_2 and 823_C_11, therefore immediately providing a physical link between the genetic markers D7S690 and D7S526.

D7S474 was present on clones yWSS298, 959 B 3 and 908_D_2. This places it proximal to D7S1514 as it not present on 823_C_11. However, this location

Physical Mapping o f the RP9 Critical Region pYAC4 Eco RI cloning site 10 20 30 40 50 ' ' ^ GAATTCCACCCACACTGGTCACGGGTGGTGGTGAAAGTAATATACGCGTA pY AC4 CTTAAGGTGGGTGTGACCAGTGCCCACCACCACTTTCATTATATGCGCAT Left arm nested 60 70 80 90 100 primer CCTGCTAGTGGCATTGTAAACTGCAGCCTGTTTGGAAAACACTACAACAT GGACGATCACCGTAACATTTGACGTCGGACAAACCTTTTGTGATGTTGTA 110 120 130 140 150 GTAATAACAACTATAAAGTGATTTATCTCCTCAGACCAAGGAATGCCACT CATTATTGTTGATATTTCACTAAATAGAGGAGTCTGGTTCCTTACGGTGA 160 170 180 190 200 CATAGGAAACCATCCTAAGGAGATAATTCAACACAAGTGAAAAGCCACAT GTATCCTTTGGTAGGATTCCTCTATTAAGTTGTGTTCACTTTTCGGTGTA 210 2 20 230 240 GCATGAGATGTTTATTAAAGTTAAAAGTGGAAAATACTAAATCAAA CGTACTCTACAAATAATTTCAATTTTCACCTTTTATGATTTAGTTT

Figure 3.11 Sequence generated from the left arm o f 271-A5. T he end clone

was isolated from A/w-vector PC R and the product w as sequenced directly. A

136 bp novel STS w as chosen. Sequences labelled in red and green represent the forw ard and reverse prim ers respectively.

H y l i r i i l C M 0 7 2 n ! ) C M 1 082011 C M I 0 2 M H H W - lK i C M I 0 I I 4 M C r O H I l A C I . 0 N K 2 I K C 4 A * C M l O U I I 7 ( i2 ( 0 i ■ I lC M laAD«)2 + 28!) C M IIW 7 !) H O I C . I 28 I1 0 H 7 i r r i i A 1.8 nixN'i'x C M I 0 f , l 2 C M K M 7 8 T I I Y l t J . l r^M K2r.NU H O K I .O X 8.73 1 2 3 4 .7 U 7 8 n 10 11 12 13 14 1.7 H i 17 18 1!) 2 0 21 2 2 X Y 4- --- - - - + - / - / / + / - - / - - / + - + . 1m l ic a la x i» rcj* ciicc ; — , in d ic a l c M iib x c i i r c : / , i m l i c a l c x c l t r o i n o s o i n c I n i n x l o c u l i i m . e x t r a f:iir(»iiuw «nilc « o r o t h e r i n m l i l t e a t i i

136 bp

■Sl-ri .0X5 , - 0 0 o. 2 = 2 22: gJx >. -r

'///

F ig u re 3.12 The H G M P m onochrom osom al som atic cell hybrid panel

(Kelsell et al. 1995). T h e individual hybrid nam e and hum an content are

listed in the table. PC R analysis o f the 27I-A 5L A STS (136 bp) on cell lines of the panel show s am plification from hybrid GM 10611 only. T his contains chrom osom e 9 as its only hum an com ponent. Sim ilarly, 34D -A 5R A was found to m ap to chrom osom e 12.

yW SS^550 (850 kb)| yW SSi98 (800 kb) yWSS304^ (900 kb) I yW SS3255 (1000 kb) Link up toj^oxim al ' yW SS321^ (630 kb) 961 Cen ! vW SS2597(1100kb) ! I I I I yW SS3263 (1000/900 kb) I I I I I I F 5 (1720 kb) I I 34D-A5 27I-A5 460 kb) 34D-A4 (365 kb) I (461460 kb) 959 B 908 D 823 C 3 (1500 kb) 2 (1200 kb) 11( _ _(365^500_&_6]_0|kbJ _ _ y yW SSlSjlS (400 kb) I I I I yW SS922 (375 kb) i ytVSS2458(ljOO kb) Î33B-E5 (250|kb) yW SS2056 (37^ kb) pOH-A8 (285 kbl I 6B-F3 (20(1 kb)

T

I

I

D7S460/656/683 D7S795 Dres34 ADCYAPIR GHRHR n — D7S632 EST00601

D7S474 D7S526

Figure 3.13 The YAC contig which extends distal from the RP9 critical region. The disease region was originally defined by the distal

flanking marker D7S526 and D7S484. The crtitical region was subsequently refined between D7S795 and D7S484, therefore excluding this area. The horizontal thin lines depict the YAC clones with their identity and sizes above. Only a few D7S690 YACs are illustrated. Dashed horizontal lines indicate regions of internal deletions in YACs. The dashed vertical lines represent the positions that the STSs occupy in the YACs. Thick blocks depict insert ends which were isolated in this study. Those from clones 271-A5 and 34D-A5 are from chimeric portions of the clone.

Physical Mapping o f the RP9 Critical Region

is considered tentative as 823 C 1 1 was found to be deleted and unstable, therefore D7S474 could still be indistinguishable from D7S1514.

DRES34 (Drosophila related EST 34) is one of the sixty-six human ESTs which were reported to have exhibited sequence homology to Drosophila genes that cause mutant phenotypes (Banfr et al. 1996). This EST showed certain similarity to the Drosophila atonal (ato) gene, a proneural gene for olfactory sensilla which encodes a transcription factor. However, upon examination, the level of identity between these transcripts is too low to suggest that it is a true homologue of atonal. The sequence identity was limited to a portion o f the EST, possibly due to the presence of a conserved domain. Nevertheless it represents a novel human transcript. DRES34 was located to 7pl5, by radiation hybrid mapping and FISH, by these investigators. An STS for this (GDB: 3906429) was used in PCR analysis in this study and located it to clones yWSS298, 959 B-3 and 908_D_2, placing it close to D7S474.

ADCYAPIR is one of three types of receptors that mediates the actions of the pituitary adenylate cyclase activating polypeptide (PACAP) hormone, which affects secretion of many hormones e.g. growth hormone, adrenocorticotropin hormone and insulin. It is expressed in the hypothalamus, brain stem, pituitary, adrenal gland,

pancreas and testis (Stoffel et al. 1994). The human ADCYAPIR gene was previously

mapped to chromosome 7 by PCR on a panel of human-rodent somatic cell hybrids. Localisation to 7pl4 was achieved by FISH and it was found to be present on the

CEPH mega YAC 959_B_3 (Stoffel et al. 1994). The ADCYAPIR gene specific STS

primers (GDB:456105) were tested on the other YACs in this region and was also found in clones 908_D_2 and 823_C_11. The position o f this gene was deduced to lie between D7S1514 and D7S526 as it was not present on any YACs o f the D7S526/632 contig, and the positive clone 908_D_2 does not extend further past this contig. This tentative placement depends on clone 908_D_2 being unaltered. Recent high density STS content mapping ventures (Hudson et al. 1995) has suggested that this clone is

not deleted or rearranged. It also smaller in size than the other CEPH clones that overlap it considerably, and the size estimate determined in this study is in agreement with that determined by Chumakov et al. (1995).

The end clone STS 1545LA was found to be present on clones 959_B_3, 908_D_2 and 823_C_11. Its absence from clones yWSS922, 2056 and all those distal

Physical M apping o f the RP9 Critical Region

to it indicates it is located between ADCYAPIR and GHRHR. This STS did not link up with any clones from D7S1514, but it was not used to isolate further YACs as the RP9 disease region had subsequently been refined and the inclusion o f the CEPH clones had already provided the necessary link. As an example of PCR-based STS content mapping, figure 3.14 presents the results for the mapping of A1 and 1545LA STSs.

The growth hormone releasing hormone (GHRH) plays an important role in the regulation of growth hormone synthesis and secretion, and acts via the GHRH receptor (GHRHR). The gene for the receptor was localised to 7pl4 by in situ hybridisation (Gaylinn et al. 1994) and by PCR analysis of somatic cell hybrids (Vamvakopoulos et

a l 1994). When tested on clones in this region, the STS for GHRHR

(oligonucleotides: Pf and Pr, Vamvakopoulos et al. 1994) was found to be on YAC yWSS1545. Simultaneously a publication describing its location to this YAC was released (Wanjnrajch et al. 1994). This gene was later also found on 959 B 3 and

908 0 2, but not on 823_C_11. As clone 823 C 1 1 is known to be deleted, it can be assumed that GHRHR is therefore located between 1545LA and D7S526 (figure 3.13).

Aquaporin (AQPl) functions as a water-selective transmembrane channel, and is expressed in various secretory and absorptive epithelia, and is very abundant in the anterior segment of the eye. This gene was mapped to chromosome 7p 14-15 by in situ hybridisation (Deen et a l 1994). STS content mapping placed it on clones yWSS2056, 1545 and 922 (EMBL Accession No: Z21985; Keen et al. 1995b). It was later also

found in clones 959_B_3 and 908_D_2 but not in 823_C_11, thus further supporting the presence o f a deletion in the latter clone. The localisation for AQPl could not be distinguished physically from D7S526 by STS content mapping. However it is in a 375 kb vicinity around this marker, defined by its presence on clone yWSS2056 which contains only D7S526 and AQPl (figure 3.13).

Glycyl-tRNA synthetase (GARS) is one of the aminoacyl-tRNA synthetases that catalyses the attachment of an amino acid to its respective tRNA. The GARjS cDNA was assigned to chromosome 7 by PCR-based screening of somatic cell hybrid panels and was further localised to 7pl5 by FISH (Nichols et a l 1995). The

Physical Mapping of the RP9 Critical Region A1 136 bp à 1545LA 116 bp

Figure 3.14 STS content mapping results in a selection of YACs from the RP9 distal contig for A1 and 1545LA. YACs yWSS3029, 798 and 3E-G9 are proximal contig YACs (see figure 3.16).

Physical Mapping o f the RP9 Critical Region

STS for GARs (GDB: 3750172) was used to test a pool of YACs in the region and was then more specifically localised to YACs yWSS1545, 922, 2458, 33BE5, 959 B 3 and 823_C_11. This STS was negative for 908_D_2, which indicates the clone’s boundary, thereby placing the gene distal to D7S632 but proximal to EST00601 (figure 3.13).

EST00601 (D7S552E) was first placed on yWSS2458 (section 4.2.5.1). Further analysis demonstrated it was also present in clones 33B-E5, 959_B_3 and 823_C_11. This positioned EST00601 between GARs and D7S435. It was not present in any D7S435 containing YACs, therefore leaving an uncloned break between these contigs. This could be resolved by producing further end clone STSs from EST00601 containing YACs to bridge this gap. However this was not pursued as the RP9 disease region had since been refined and the completion o f this contig was not a priority. As the partial sequence for the cDNA clone for EST00601 did not demonstrate any homology to known sequences, the EST was tested by PCR amplification on a small set o f tissue cDNAs (Clontech) to provide some idea of its expression. It was shown to be abundant in brain, less in liver and even lower in muscle (figure 3.15). This is by no means a quantitative measure, but suggests a pattern of its expression.

The location o f these polymorphic STSs and genes on the YACs allows the determination o f the maximum physical distances between them. The 1,500 kb YAC 959 B_3 physically connects 11 STSs, 6 of which are from transcripts. yWSS1545 places six STSs, three of which are genes, within 400 kb. D7S632, GARs and EST00601 are contained in both yWSS2458 (1300 kb) and 33B-E5 (250 kb). The isolation o f the latter clone was therefore beneficial as it has enabled a more accurate estimation o f the physical distance between these STSs. The incorporation of smaller YACs has also allowed the assignment and order o f these STSs relative to one another. Five YACs had singular hits with just one STS. The D7S690 YACs were subjected to further STS content mapping with new markers by a co-worker (figure 3.16). The total contig presented here includes 21 YAC clones (excluding some redundant D7S690 containing clones and the D7S435 containing YACs) with six microsatellite markers, one end clone STS, one random STS and six gene-based STSs (figure 3.13).

Physical Mapping o f the RP9 Critical Region

.

141 bp

Figure 3.15 Amplification of EST00601 (141 bp) from cDNAs which were derived from human brain, liver and muscle tissues (Clontech).

Physical Mapping o f the RP9 Critical Region

3.2.7 Estimation of the physical extent of the proximal RP9 region