4.1: Estado del arte
DESCRIPCIÓN DE TEXTOS
Quantification o f mRNA levels was accomplished by using reverse transcription (RT) real time- PCR (RT-PCR). The first step, reverse transcription, converts mRNA into eomplementary DNA (cDNA) that is then amplified by real-time PCR. The real-time PCR technique is widely used, replacing the traditional PCR which is less sensitive and accurate, and also more laborious. RT- PCR allows amplification of minimal nucleic acid segments to generate a huge number of exact copies of DNA which may be detected by fluorescence.
2.2.9.1 RNA Extraction
Slices were prepared as described in Section 2.2.2. Optimum incubation time was established and subsequently used to study the effect of PEITC on the mRNA levels o f the genes of interest;
three slices per replication were used (n=3). In each experiment, all slices were obtained from the same animal to avoid inter-individual variation. At the end o f the incubation period, slices were washed thoroughly to remove residual test media, and rapidly frozen utilising liquid nitrogen, prior to storage at -80 °C. RNAlater ice was used for long- term storage, 0.3ml per
Chapter 2: Materials and Methods
three slices, to protect RNA from degradation. The slices were thawed at -20 °C for 24 hr prior to homogenisation utilising UVed hand-held micropestles. RNA extraction was carried out according to NucleoSpin® RNA II, total RNA isolation, system. All apparatus and solutions were RNase-free to minimise degradation of RNA. Finally, pure RNA was eluted by RNase- free water and stored at -20 °C prior to quantification.
2.2.9.2 RNA quality determination
Purity of RNA is essential for investigation of gene expression. To assess purity, a ratio of absorbances at 260 to 280 nm was determined using a spectrophotometer (Nanodrop; LabTech, East Sussex, U.K.); a ratio >1.8 indicated acceptable RNA purity. Moreover, a second check was carried out involving electrophoresis analysis. RNA extract aliquots (2pl) were mixed with Orange G dye (5 pi) and loaded onto 1% agarose gel containing 5 pg/ml ethidium bromide in Ix TAB, a mixture of 40 mM Tris base, 40 mM acetic acid and 1 mM EDTA. On the gel, RNA migrates according to size and the 285' and 185" rRNA bands were visualized by ethidium- bromide staining. Sharp ribosomal bands at 285" and 185' were expected, and a 285': 185' ratio greater than 2.0 was considered to denote high quality intact RNA (Vendrely et al., 1968).
Nanodrop was also used to determine the concentration of RNA (ng/ml).
2.2.9.3 DNase I treatment
Since the method is very sensitive and will amplify any contaminating genomic DNA, elimination of DNA is indispensable. Concentration of RNA was calculated, and 5 pg was put through the DNase I treatment prior to cDNA synthesis. The reaction mixture for the DNase I treatment eomprised 2 pi o f lOx DNase buffer, and 2 pi o f enzyme, RNase-free DNase I.
RNase-free water was added to make up the total volume to 20 pi; however, this also included 2 pi of DNase stop solution (20mM EGTA, pH 8.0) which was added at the end of the incubation of these mixtures at 37 °C for 30 min in an oven. After addition o f the DNase stop solution, the
Chapter 2: M aterials and Methods
mixture was incubated once again at 65°C for 10 min in the pettier thermal cycler (MJ Research PCT-225) to inactivate the DNase.
2.2.9.4 cDNA synthesis
cDNA synthesis was further carried out by mixing 1 pg (4pl) of DNased RNA with 5 pi of RNase-free water, 1.5 pi of 10 mM dNTPs, and 1.5 pi o f 150 ng/pl random hexamers. The mixtures were incubated at 65 C for 5 min in pettier thermal cycler and cooled down on ice for at least 2 min.
In the mean time, the RT mix (RT+) was prepared as a bulk mix. The mixture for one RNA sample involved addition of 0.75 pi of RNase-free water, 4 pi of 5x RT buffer, 2 pi of 0.1 M DTT, 1 pi of 40 U/pl RNase OUT RNase inhibitor, and 0.25 pi of 200 U/pl Superscript II reverse transcriptase. A bulk mix for control RT mix (RT-) was also prepared as described above by omitting addition of RNase OUT and Superscript II reverse transcriptase. Any amplification of the control will indicate the presence of a residual contaminating genomic DNA in the RNA sample preparation. To 12 pi of DNased-RNA, 8 pi of the mixture (RT+ or RT- mix) was added and the new mixture was incubated at 25 °C for 10 min followed with 50 min at 42 C, and finally 15 min at 70 °C in PCR machine. The samples were stored at -20 and were mixed with 80 pi of RNase-free water before use.
2.2.9.5 Quantitative PCR
Primer and probe sets for rat C Y PlA l, 1A2, IB l and NQOl genes were designed using Primer Express® version 2 (Applied Biosystems, Warrington, U.K.). A housekeeping gene, 185 rRNA, was used as an internal standard in order to normalise gene quantification. Dual label probe was labelled with the reporter dye (6-FAM) at the 5'-end. The 3'-end was labelled with the TAMRA quencher. Custom oligonucleotide sequences of the primers and probes are as follows:
Chapter 2: Materials and Methods
C YPlA l
5' primer : GCCTTCACATCAGCCACAGA 3' primer : TTGTGACTCTAACCACCCAGAATC Probe : TGGCCGTCACCACATTCTGCCTT
CYP1A2
5' primer : AAGCGCCGGTGCATTG
3' primer : TGCAGGAGGTAGGCTAAGAAG Probe ; CCCGGCCAAGTGGGAAGTCTTCC
CYPIBI
5' primer : TTCAGCTGTTCAAACGAAGCA 3’ primer : TCCCAAAGTTGAAAGCTTACGTTA Probe : CGAGTTATGAGGGAGAAAAAGGTTTGCCA
NQOl
5 'primer : GAGGTTCAAGAGGAGCAGAAAAAG 3 'primer : GTTGTCGGCTGGAATGGACTT Probe : TTTGGCCTTTCTGTGGGCCATCA
185 rRNA
5' primer : CGGCTACCACATCCAAGGAA 3' primer : GCTGGAATTACCGCGGCT Probe : TGCTGGACACAGACTTGCCCTC
Probes and primers were diluted to the appropriate concentrations using O.lx TAE. Bulk mix was prepared for a number of genomic standards and cDNA of RNA samples (from RT+)
Chapter 2: M aterials and Methods
including its individual control (from RT-); the volumes given below were used for one RNA sample:
Forward primer (10 pmol/pl stock) 1.0 pi
Reverse primer (10 pmol/pl stock) 1.0 pi
Probe (5 pmol/pl stock) 0.5 pi
RNase-free water 5.0 pi
Taqman® Universal PCR MasterMix 12.5 pi
To each well of the 96-well plate, 20 pi of bulk mix and 5 pi o f cDNA or genomic standard were added. The samples were assayed in triplicate, whereas genomic standards were analysed in duplicate. The reaction plate was well sealed with an optical adhesive cover, and then spun using a centrifuge (Eppendorf, Centrifuge 5810, Hamburg, Germany) at 1000 xg for 2 min prior to loading onto the ABI Prism 7000 sequences detection system (Applied Biosystem, Warrington, U.K.) as shown in Figure 2.3. Using real-time PCR, gene expression and quantity (number of copies) were determined. Cycle by cycle fluorescent detection of accumulated PCR product was performed under the thermo cycler settings indicates in table 2.1.
Table 2.1 Thermal cycling conditions for quantitative PCR.
Stage Temperature (°C) Time Cycles
1 50 2 minutes 1
2 95 10 minutes 1
95 15 seconds
3 40
60 1 minute
A threshold cycle (Ct) was then set in the exponential phase o f the amplification to obtain the most accurate reading. The rate at which the cycle number reached the established threshold
Chapter 2: Materials and Methods
determined the quantity of DNA present in each sample; the earlier the threshold was achieved indicates the more DNA.
2.2.9.6 Genomic DNA standard
Absolute PCR quantification can be achieved using a standard curve constructed by amplifying known amounts o f target DNA. Rat genomic DNA standard was prepared and serial dilution was performed to provide a stock solution of 0 to 10^ single strand per 5 pi using O.lx TAE. The stock solution was kept at -2 0 °C for long-term storage.
Figure 2.3 The ABI Prism 7000 sequences detection system (Applied Biosystem, Warrington, U.K.).