20 bp CACACCACTGCATTCTCACCCGCAAGCACC GAOAAAATÊACTT lAQTACAGCCAGCACCTTTCCTACAGACCCAGTTTC CD45 exon C CD45 exon B
Legend: S ch em atic rep resen tatio n o f ex o n s A , B , an d C in clu d in g com m on sequence elem ents. E xons are illu strated as boxes w ith the ap p ro p riate nu cleo tid e seq u en ces sh o w n w ithin. C is-elem en ts d efin ed by lin k er scan n in g analysis (S treuli et al. (1 9 8 9 ); T sai et al. (1989)) are m ark ed in green. R egions th at share c o m m o n elem en ts b etw een ex o n s A and C are en larg ed u n derneath o r ab o v e the a p p ro p riate e x o n , resp ectiv ely . T h e re are no co m m o n seq u en ce ele m e n ts b etw een ex o n s A and B o r exons B and C. T h e hig h ly hom o lo g u o n s region is show n in y ello w ; the p u rin e-rich seq u e n c e -e le m e n t is sh o w n in red. R eg io n s w ith in th ese elem en ts th at did no t e ffe c t altern ativ e m inigene splicing in lin k er scan n in g ex p erim en ts are shaded. T h e C D 4 5 exon
A m u tatio n is rig h t at the b o rd er o f the h ighly h o m o lo g o u s reg io n b etw een exons A and C (arrow ). K)
Discussion
In the previous chapter it was demonstrated that it is possible to isolate a mutated allele in cells displaying the variant pattern of CD45 splicing by the somatic cell hybridisation technique. The CD45 isoform phenotype in hybrids carrying this allele corresponded to the expression pattern of variant peripheral blood T cells. Furthermore, by analysis of the exon A sequence the same mutation at position 77 was detected as in individuals examined by Thude et al. However, the possibility remained that this polymorphism associated with the variant splicing pattern was not the underlying cause. Rather, a different mutation was present within the same allele that had not been detected. Support for this idea was provided by the finding that this mutation was not present in a family exhibiting the variant phenotype in association with the im m unological disorder HLH (W agner et al., 1995). Consequently a different approach had to be developed in order to prove indisputably whether the position 77 mutation caused a retention of CD45RA isoforms on T cells. This was achieved by the use of m inigenes which offer the advantage that only the region o f interest in CD45 will be examined.
Effect of the CD45 exon A point mutation in alternative splicing of minigenes
It has been demonstrated that alterations in secondary structures around the splice consensus sites can inhibit the splice reaction (Eperon et al., 1988; Solnick, 1985; Solnick and Lee, 1987)and it seemed possible that this applies to CD45, too. However, no such motifs have been detected and in their absence it appears most likely that the binding specificity of negatively or positively transacting factors to CD45 pre-mRNA transcript is somehow affected by changes in their consensus sites.
To test the effect of the exon A mutation on CD45 splicing in preliminary experiments we introduced it into a minigene (LCA-18 from M. Streuli) containing the exons 2, 4 (A) and 8 of CD45, by site directed mutagenesis and transfected the construct into several different cell lines. Unfortunately multiple bands were observed after RT-PCR using specific human exon 2 and 8 primers and the results could not be interpreted. We decided to use COS-7 cells, because they are easily transfectable and give high expression of genes under the control of the SV40 promoter. Specific bands of the correctly spliced CD45 minigene were identified by RT-PCR and sequencing. COS-7 was therefore chosen as the model cell line for all further experiments with the minigenes. However exon A exclusion from LCA-18 transcripts was very weak in this cell type.
It appeared that alternative exon A splicing was somehow inhibited if the natural surrounding exons 3, B, C and 7 and large parts of the introns were absent in this construct. Therefore a
different construct, referred to as LCA-2, was used in these assays, because it contained exons 3 and 7 and included surrounding intron sequences. A construct containing all natural exons and introns of CD45 was not available at this time, but Streuli's studies into the involvement of cis-sequences within CD45 indicated that these constructs were spliced reliably in different B and T cell lines.
To mimic the mutation at position 77 of CD45 in humans which was found to be associated with the variant splicing pattern on T cells, it was introduced into the same exon A position of the corresponding wild-type minigene. Our results indicate that splicing towards CD45RO was greatly diminished in the mutated minigene when compared to the wild type minigene in three different cell lines tested (COS, HeLa and CHO). Although there were differences in the ratio of the two alternatively spliced forms (RA and RO), retention o f the RA form with the m utant product was always observed. Taken together, these data prove a causal relation betw een the m utation at position 77 of CD45 exon A and the variant splicing pattern observed.
A mutant CD45 gene retains the ability to produce CD45RO isoforms
It has been suggested that T cells from variant individuals affected by this mutation still retain the ability to splice to CD45RO because of the presence of the normal allele. This model implies that homozygous mutant individuals (not yet identified) would be unable to generate the lowest molecular weight isoform CD45RO (Schwinzer et al., 1992). Our results using the minigenes do not support this model, since splicing to the RO form was only inhibited, but not completely abrogated. These results conform with data from human/mouse somatic cell hybrids, showing that if only the mutant allele of CD45 was present, CD45RA was expressed but the ability to produce CD45RO was retained (chapter 4). Taking both methods together, it appears that the mutation exerts a quantitative rather that a qualitative effect on alternative splicing.
Influence of the exon A mutation on variablv spliced exons B and C
The results using the LCA-2 minigene exon A mutant are in agreement with Streuli's view that sequences within and in direct proximity to the differentially spliced exons are necessary and sufficient to ensure proper regulation of CD45 alternative splicing. Sequences within neighbouring or distant exons have no effect on alternative splicing o f exons A or C. In the light of these data a solo-exon model was proposed assuming that all the inform ation necessary for the regulation is confined within an individual exon itself. This notion applies for all experiments using the single variable exon construct provided by Streuli.
However, when a different construct was used that contained the natural sequence of the variably spliced region of CD45 (LCA l-7, G. ten Dam) i.e. including exons A, B, and C this theory does not seem to hold true. Clones of LCA-1-7 containing the exon A 77 (C>G) mutation showed a retention of the ABC splice form, compared to the norm al minigene. Therefore, regulation of exon B and C splicing appears to be determined by exon A splicing, as an isoform with exon A only was never observed. This is in contrast to the prediction of the solo-exon model of alternative splicing which assumes that cis-sequences confined within a particular exon are sufficient for its regulation (Streuli and Saito, 1989).
The observation that splice events involving exon B of human CD45 is not regulated independently had been suggested earlier. The majority of possible exon combinations of the variably spliced region of CD45 have been detected using RT-PCR in a variety of human cell lines, although some were found to be in greater abundance than others. However, the AC combination of exons has never been detected in humans, suggesting that exon B cannot be spliced out on its own (Rogers et al., 1992). These results conform with studies using deletion and linker scanning analysis of exon B LCA-constructs, showing that splicing of this exon is less well regulated than of exons A and C, i.e. no sequences confined within exon B were found that affected its alternative splicing pattern (Streuli et al, 1987; Streuli and Saito, EMBO, 1989).
Our results finding is neither entirely consistent with Schwinzer's observations on variant T cells, where an accumulation of the AB form and not exon A alone was detected. At least in COS cells mutation of exon A appeared to affect all three exons. It is possible, however, that cells with a strong CD45RO pattern (as in stimulated T cells) splice out exon C more efficiently. This may be due to a completely different set of endogenously expressed splicing factors acting in these cells, thus resulting in the AB combination of alternative exons, but this possibility has not been tested.
In conclusion we hypothesise that exon B itself cannot be controlled independently o f exons A and C by any trans-acting splicing factor present in the analysed cells, even though it is defined as an alternative exon. Therefore the only alternatively regulated exons spliced in CD45 are exons A and C, that contain binding sites for these factors, which if coordinate with each other allow elimination of the entire region between exons A and C (leading to O). If the factors act independently, the result is the excision of either exon A (leading to BC) or exon C (leading to AB) or A and C separately (leading to B). In the presence of the exon A mutation binding of the proposed trans-acting factor is inhibited with the consequence that a) exon A is retained in the mRNA and b) factors acting on exon C cannot communicate with exon A factors, leading to the inclusion of exon B in conjunction with exon A.
Sequence homologies and common elements in variable CD45 exons
As both normal A and C exons seem to be regulated in a similar fashion it is likely that evolutionary conserved trans- as well as cis-acting factors are involved in alternative CD45 splicing. Purine-rich sequences were found in both exon A and C (11 and 12 mer, respectively) which had been reported to act as splicing enhancers (figure 5.7) (Cooper, 1992; Graham et al., 1992; Libri et al., 1992; Sun et al., 1993; W atakabe et al., 1993; Xu et al., 1993), but are absent within exon B. In addition to this, a 12 mer located immediately downstream of the exon A mutation is very conserved (11 out of 12 basepairs) between exon A and a sequence within exon C, suggesting that this may represent a consensus binding site for possible splicing factor that regulates both exons (figure 5.7).
It is noteworthy in this respect that these homologous regions between exons A and C, but not in B are located within critical segments defined by mutational analysis (Streuli and Saito, 1989). Moreover, sequence analysis of exon A of CD45 revealed that the region surrounding this position is highly conserved between humans, rats and mice, even though most of the sequences coding for the extracellular domains of CD45 are not homologous. However, it is not clear whether this region represents a binding site for a postulated trans-acting splicing factor or whether it mediates alternative splice site choice as a consequence o f secondary structure formation. Therefore any conclusions about the functional significance of this region will require further investigation.
CD45 splicing is only one example of common alternative splicing processes regulating expession patterns of a variety of other genes, which may be controlled by a sim ilar mechanism. A recently well studied family of splicing factors that conform with the above features comprise a highly homologous group of SR proteins. These proteins have been shown to be involved in the process of differential splicing and were tested for their activity in alternative splicing of CD45 in experiments described in the next chapter.