The aim of this thesis was to develop and evaluate bacterial-based biotechnological processes capable of using hemicellulose sugars as a carbon source. The strains P. putida KT2440 and C. japonicus were used as microbial biocatalysts.
Since P. putida KT2440 is not able to metabolize xylose and arabinose, the first purpose of this project was to construct strains that can metabolize these two sugars. Furthermore, the growth characteristics of these strains on glucose, xylose and arabinose as single sugars and as mixtures were displayed. The second goal was to evaluate the potential of biotechnological conversion of lignocellulose hydrolyzates by P. putida KT2440. In this context different hydrolyzates were screened as a carbon source for this bacterium. Later, the inhibitory effect of major toxic substances in lignocellulose hydrolyzates on the growth of this strain were investigated. Last, initial feeding strategies for applying lignocellulose sugar mixtures as a carbon source in fed-batch bioreactor cultivations with P. putida KT2440 were developed. The third goal was to evaluate C. japonicus as a potential host strain for one-step bioconversion of xylans to rhamnolipids.
25
2 Manuscripts
Authors´ contributions to these publications
1. Wang Y, Horlamus F, Henkel M, Kovacic F, Schläfle S, Hausmann R, Wittgens A, Rosenau F, Growth of engineered Pseudomonas putida KT2440 on glucose, xylose and arabinose: Hemicellulose hydrolysates and their major sugars as sustainable carbon sources, Global Change Biology Bioenergy 2019, 11:249–259. doi: 10.1111/gcbb.12590 • YW and FH contributed equally to this work. YW and FH designed, planned, executed
and experiments, collected and interpreted the data, created the graphs and drafted the manuscript. MH designed and planned the experiments. KF contributed to interpretation
of the experiment. SS produced hydrolyzates and contributed to interpretation of the
experiments. AW significantly contributed to conception and design of the study and
interpretation of the experiments. RH and FR substantially contributed to conception
and design of the conducted experiments. All authors read and approved the final version of the manuscript.
___________________________ ______________________________ Place, Date Signature of the supervisor
26 2. Horlamus F, Wang Y, Steinbach D, Vahidinasab M, Wittgens A, Rosenau F, Henkel M, Hausmann R, Potential of biotechnological conversion of lignocellulose hydrolyzates by Pseudomonas putida KT2440 as model organism for a bio‐based economy, Global Change Biology Bioenergy 2019, 102:1254 2019. doi: 10.1111/gcbb.12647
• YW and FH contributed equally to this work. FH designed, planned and executed
the experiments, collected and interpreted data, created the graphs and drafted the manuscript. YW executed part of the bioreactor cultivations and contributed to
interpretation of the experiment. MV executed part of the experiments and collected
and evaluated corresponding data. DS produced hydrolyzates, performed quantitiave
analysis of organic acids and furfural aldehydes in hydrolyzates and contributed to interpretation of the experiment. AW and FR contributed to interpretation of the
experiment. MH significantly contributed to conception and design of the study and
interpretation of the experiments. RH substantially contributed to conception and
design of the conducted experiments. All authors read and approved the final version of the manuscript.
3. Horlamus F, Wittgens A, Noll P, Michler J, Müller I, Weggenmann F, Oellig C, Rosenau F, Henkel M, Hausmann R, One-step bioconversion of hemicellulose polymers to rhamnolipids with Cellvibrio japonicus: A proof-of-concept for a potential host strain in future Bioeconomy, Global Change Biology Bioenergy 2019, 11:260–268. doi: 10.1111/gcbb.12542
• FH designed, planned and executed the experiments, collected and interpreted data,
created the graphs and drafted the manuscript. AW and FR generated the plasmid
pSynPro8oT and contributed to interpretation of the experiment. NP, WF executed adjustments for the HPTLC method. MI and MJ executed or performed part of the
experiments and collected and evaluated corresponding data. OC helped to evaluated
the mass spectrometric experiments. MH significantly contributed to conception and
design of the study and interpretation of the experiments. RH substantially
contributed to conception and design of the conducted experiments. All authors read and approved the final version of the manuscript.
______________________________ ______________________________ Place, Date Signature of the supervisor
27
2.1 1
stPublication:
Growth of engineered Pseudomonas putida KT2440 on
glucose, xylose, and arabinose:
Hemicellulose hydrolysates and their major sugars as
sustainable carbon sources
Wang Y*, Horlamus F*, Henkel M, Kovacic F, Schläfle S, Hausmann R, Wittgens A, Rosenau F (*The authors contributed equally to this work)
Global Change Biology Bioenergy 2019, 11:249–259 DOI: 10.1111/gcbb.12590
Lignocellulosic biomass is the most abundant bioresource on earth containing polymers consisting mainly of D‐glucose, D‐xylose, L‐arabinose, and further sugars. In order to
establish this alternative feedstock apart from applications in food, we engineered Pseudomonas putida KT2440 as microbial biocatalyst for the utilization of xylose and arabinose in addition to glucose as sole carbon sources. The growth characteristics on various mixtures of these sugars and the possibility of using lignocellulosic hydrolysate as substrate for the recombinant strains were investigated.
GCB Bioenergy. 2019;11:249–259. wileyonlinelibrary.com/journal/gcbb | 249
O R I G I N A L R E S E A R C H
Growth of engineered Pseudomonas putida KT2440 on glucose,
xylose, and arabinose: Hemicellulose hydrolysates and their
major sugars as sustainable carbon sources
Yan Wang1* | Felix Horlamus2* | Marius Henkel2 | Filip Kovacic3 |
Sandra Schläfle4 | Rudolf Hausmann2 | Andreas Wittgens1,5,6 | Frank Rosenau1,5,6
This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
© 2019 The Authors. GCB Bioenergy Published by John Wiley & Sons Ltd.
*Contributed equally. 1Institute for Pharmaceutical
Biotechnology, Ulm University, Ulm, Germany
2Department of Bioprocess Engineering
(150k), Institute of Food Science and Biotechnology, University of Hohenheim, Stuttgart, Germany
3Institute for Molekular Enzyme
Technology (IMET), Heinrich‐Heine‐ University Düsseldorf, Forschungszentum Jülich GmbH, Jülich, Germany
4Department of Yeast Genetics and
Fermentation Technology (150f), Institute of Food Science and Biotechnology, University of Hohenheim, Stuttgart, Germany
5Ulm Center for Peptide Pharmaceuticals
(U‐PEP), Ulm‐University, Ulm, Germany
6Department Synthesis of
Macromolecules, Max‐Planck‐Institute for Polymer Research Mainz, Mainz, Germany
Correspondence
Andreas Wittgens, Institute for Pharmaceutical Biotechnology, Ulm University, Ulm, Germany. Email: [email protected]
Funding information
EU project Horizon 2020 “AD GUT”, Grant/Award Number: 686271; Ministry of Science, Research and the Arts of Baden‐ Württemberg, Grant/Award Number: 7533- 10-5-86 A and 7533-10-5-86 B
Abstract
Lignocellulosic biomass is the most abundant bioresource on earth containing poly- mers mainly consisting of D‐glucose, D‐xylose, L‐arabinose, and further sugars. In
order to establish this alternative feedstock apart from applications in food, we engi- neered Pseudomonas putida KT2440 as microbial biocatalyst for the utilization of xylose and arabinose in addition to glucose as sole carbon sources. The D‐xylose‐me-
tabolizing strain P. putida KT2440_xylAB and L‐arabinose‐metabolizing strain P. putida KT2440_araBAD were constructed by introducing respective operons from Escherichia coli. Surprisingly, we found out that both recombinant strains were able to grow on xylose as well as arabinose with high cell densities and growth rates comparable to glucose. In addition, the growth characteristics on various mixtures of glucose, xylose, and arabinose were investigated, which demonstrated the efficient co‐utilization of hexose and pentose sugars. Finally, the possibility of using lignocel- lulose hydrolysate as substrate for the two recombinant strains was verified. The re- combinant P. putida KT2440 strains presented here as flexible microbial biocatalysts to convert lignocellulosic sugars will undoubtedly contribute to the economic feasi- bility of the production of valuable compounds derived from renewable feedstock.
K E Y W O R D S
biocatalyst, D‐xylose, hemicellulose hydrolysate, L‐arabinose, metabolic engineering, Pseudomonas
putida KT2440
1
|
I N T RO D U C T I O NThe development of alternative feedstocks as carbon sources for the industrial biotechnology is one of the major goals to achieve cost‐effective and economically efficient bioprocesses, since the price for raw materials especially those of the carbon sources represents a significant pro- portion of total production costs. Due to insufficient global food supply, the use of feedstocks, which can primarily be used also for food production, is at least ethically question- able and not a preferable basis for the establishment of a truly sustainable bioeconomy. Nevertheless, numerous cur- rent biotechnological production processes mostly depend on glucose as carbon source (Wendisch et al., 2016). The conflict between food and biotechnology and the result- ing demand to create ethically less problematic processes, which also offer a promising potential for increasing pos- itive socio‐economical perception and acceptance by cus- tomers of biotechnological products, alternative carbon sources like lignocellulosic biomass, have moved into the focus of attention as renewable and thus sustainable raw materials with a considerable economic potential for in- dustrial biotechnology. An obvious advantage is the fact that they can be recovered from forestry and agro‐industrial waste or agricultural residuals (Anwar, Gulfraz, & Irshad, 2014; Mussatto & Teixeira, 2010). Lignocellulosic biomass mainly consists of cellulose, hemicellulose, and lignin con- taining different polymers. D‐Glucose is the only compo-
nent in cellulose while the composition of hemicelluloses highly varies among different bioresources (Himmel et al., 2010; Shahzadi et al., 2014; Taherzadeh & Karimi, 2008). Pentoses like D‐xylose and L‐arabinose are the predominant
sugars in hemicelluloses and make up to 25% of the total sugar amount in lignocelluloses especially in hardwoods and grasses like wheat, corn, and rice, thereby representing a worldwide available bioresource, but hemicellulose can also contain hexoses like D‐glucose, D‐mannose, and D‐ga-
lactose (Brodeur et al., 2011; Kumar, Barrett, Delwiche, & Stroeve, 2009; Lee, 1997). While cellulose is primar- ily used for other industrial applications, 60 billion tons of hemicelluloses remain almost completely unused every year, which can be hydrolyzed into sugar containing hydro- lysates by chemical or enzymatic hydrolysis. This is a pre- requisite to use them as substrates for bioprocesses, since typically used microorganisms in industrial biotechnol- ogy are naturally unable to use polymers directly (Sun & Cheng, 2002; Xu, Sun, Liu, & Sun, 2006). However, these sugars provided in lignocellulosic hydrolysates can poten- tially be utilized for the growth of microorganisms and can be converted into different valuable products including bio- chemical compounds, fine chemicals, food additives, and enzymes (Asgher, Ahmad, & Iqbal, 2013; Iqbal & Asgher, 2013). However, the natural limited metabolic flexibility
of many industrial‐relevant microorganisms for the use of uncommon carbon sources impedes the efficient utilization of pentose sugars (Kim & Gadd, 2009).
Therefore, several approaches have been used to address this challenge by genetic manipulation and metabolic engineering in different bacteria (Aristidou & Penttilä, 2000; Nieves, Panyon, & Wang, 2015). The pentose phosphate pathway (PPP) is the preferred biochemical route for metabolizing xylose and arab- inose present in numerous bacteria. Both xylose and arabinose enter the PPP through D‐xylulose 5‐phosphate as an intermedi-
ate (Stincone et al., 2015). For establishing a xylose degrading pathway in foreign species, heterologous expression of xylA (xy- lose isomerase) and xylB (xylulokinase) is a suitable strategy to enable growth on xylose as sole carbon source, which has been successfully performed in various bacteria like Zymomonas mo-
bilis (Zhang, Eddy, Deanda, Finkelstein, & Picataggio, 1995),
Corynebacterium glutamicum (Kawaguchi, Verte, Okino, Inui, & Yukawa, 2006), Bacillus subtilis (Chen, Liu, Fu, Zhang, & Tang, 2013), and Pseudomonas putida (Le Meur, Zinn, Egli, Thöny‐Meyer, & Ren, 2012; Meijnen, Winde, & Ruijssenaars, 2008). Therefore, D‐xylose is converted to D‐xylulose 5‐phos-
phate through D‐xylulose (Gu et al., 2010; Kawaguchi et al.,
2006). For the utilization of L‐arabinose, a group of three genes, araB (ribulokinase), araA (L‐arabinose isomerase), and araD
(L‐ribulose phosphate 4‐epimerase), is necessary, which medi-
ates the conversion of L‐arabinose though L‐ribulose and L‐rib-
ulose 5‐phosphate to D‐xylulose 5‐phosphate (Deanda, Zhang,
Eddy, & Picataggio, 1996; Xiong, Wang, & Chen, 2016). This
araBAD operon has been successfully integrated and heterolo- gously expressed in C. glutamicum (Kawaguchi, Sasaki, Vertès, Inui, & Yukawa, 2008) to enable its growth on L‐arabinose.
In this present study, we chose P. putida KT2440 as a host for generating optimized expression strains by heter- ologous expression of the xylAB and araBAD operons to enlarge the available substrate spectrum for this remark- able platform organism. P. putida KT2440 has developed into an excellent and robust workhorse for the expression of heterologous genes (Loeschcke & Thies, 2015; Martins Dos Santos, Heim, Moore, Strätz, & Timmis, 2004), pos- sesses an outstanding tolerance toward numerous organic compounds and has been extensively studied for the bio- synthesis of biotechnological relevant products, for exam- ple, rhamnolipids (Cha, Lee, Kim, Kim, & Lee, 2008; Tiso et al., 2016, 2018; Wittgens et al., 2017, 2018, 2011). Its genome has been completely sequenced, which provides complete insights into its metabolic potential (Nelson et al., 2002; Poblete‐Castro, Becker, Dohnt, Santos, & Wittmann, 2012), and especially in Germany, the strain KT2440 is of great importance, since it is the only P. putida, which re- mained in the biosafety level 1 (S1) being a key prerequi- site for its use in many industrial applications (BVL, 2012). According to a previous study, P. putida KT2440 lacks part of the PPP and is unable for utilizing xylose and arabinose,
but carries the oprB gene encoding the outer membrane protein D1, which is responsible for the uptake of xylose and arabinose (Henkel et al., 2012). The growth behaviors of engineered P. putida KT2440 strains were investigated in detail during cultivation experiments on glucose, xylose, or arabinose as sole carbon sources as well as on mixtures of these sugars and finally real hemicellulose hydrolysates, to investigate the potential of efficiently utilizing of this cost‐effective and renewable feedstock.
2
|
M AT E R I A L S A N D M E T H O D S 2.1|
Bacterial strains and culture conditionsPseudomonas putida KT2440 (Nelson et al., 2002),
Escherichia coli DH5α (Grant, Jessee, Bloom, & Hanahan, 1990), and E. coli K‐12 strain MG1655 (Blattner et al., 1997) were routinely cultivated in lysogenic broth (LB) me- dium (10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl) at 120 rpm orbital shaking and 30°C for P. putida and 37°C for E. coli, respectively. Growth experiments using wild‐ type and engineered P. putida strains were carried out in 250‐ml baffled Erlenmeyer flasks filled with 25 ml of adapted Wilms‐KPi medium (Wilms et al., 2001) containing 13.15 g/L K2HPO4, 3.28 g/L KH2PO4, 10 g/L (NH4)2SO4,
1 g/L NH4Cl, 4 g/L Na2SO4, 50 g/L MgSO4·7H2O supple-
mented with 3 ml/L of a trace element solution consisting of 0.18 g/L ZnSO4·7H2O, 0.16 g/L CuSO4·5H2O, 0.1 g/L
MnSO4·H2O, 13.92 g/L FeCl3·6H2O, 10.05 g/L EDTA,
0.18 g/L CoCl2·6H2O, 0.662 g/L CaCl2·2H2O, and 10 g/L
thiamin HCl. A total amount of 10 g/L D‐glucose, D‐xylose, L‐arabinose, or equal mixtures of these sugars were added to
the medium as carbon source.
Hydrolysates were obtained from dried and milled wheat straw, which was first treated in a steam explosion process followed by an enzymatic hydrolysis process carried out for 5 days without using any additives (Schläfle, Tervahartiala, Senna, & Kölling‐Paternoga, 2017). These wheat straw hy- drolysates containing almost exclusively monomers of D‐glu-
cose, D‐xylose, and L‐arabinose were added to the adapted
Wilms‐KPi medium complying with a total sugar concentra- tion of 10 g/L, and artificial straw hydrolysates were prepared from single sugars imitating this composition.
Pre‐cultures were prepared from glycerol stocks using a total volume of 50 µl stock solution in 25 ml LB medium. Main cultures were inoculated to a starting optical density at 600 nm (OD600) of 0.1 using cells harvested by centrifugation
for 10 min at 5,000 g.
2.2
|
Construction of recombinant plasmids Genomic DNA of E. coli strains DH5α and K‐12 MG1655 were isolated using the DNeasy Blood and Tissue Kit (Qiagen,Hilden, Germany). The amplification of the 2.8‐kb xylAB op- eron from E. coli DH5α and of the 4.3‐kb araBAD operon from E. coli K‐12 strain MG1655 was performed by standard PCR using Phusion® High‐Fidelity DNA Polymerase (New England Biolabs, Frankfurt a. M., Germany) according to the manufacturer's instructions. The DNA sequences of the prim- ers, obtained from Eurofins Genomics (Ebersberg, Germany), were GTGAAATAACATACTCGAGCAACTGAAAGG and CCCACCCGGTCTAGAAGGGGATAA for
xylAB and CTTTTCTCGAGCCCACCATTC and GGTTTCTCTAGATTGGCTGTGG for araBAD, respec- tively. The two resulting PCR products were hydrolyzed using restriction enzymes XhoI and XbaI and subsequently ligated using T4 DNA ligase with the pBBR1MCS‐2 expression vector (Kovach et al., 1995) hydrolyzed with the same enzymes. All enzymes were used as recommended by the supplier (Thermo Fisher Scientific, St. Leon‐Rot, Germany). E. coli DH5α cells were transformed with the resulting recombinant plasmids pBBR1MCS‐2_xylAB and pBBR1MCS‐2_araBAD using a standard protocol (Hanahan, 1983). Transformation of P. putida KT2440 was performed by electroporation after Choi, Kumar, and Schweizer (2006). Agar plates and liquid media were sup- plemented with 50 µg/ml kanamycin for selection of positive cells. Recombinant P. putida KT2440_xylAB and P. putida KT2440_araBAD strains were additionally screened using solid Wilms‐KPi medium plates containing and 10 g/L xylose or arab- inose after electroporation.
2.3
|
Analytical methodsCell growth was determined densitometrically by measuring the OD600 using a spectral photometer. Culture supernatants
were analyzed for sugar concentrations after removing the cells by centrifugation for 5 min at 15,000 g and 4°C using the
D‐Glucose Assay Kit, D‐Xylose Assay Kit, and L‐Arabinose/D‐
Galactose Assay Kit (Megazyme, Wicklow, Ireland). The for- mation of xylonate and arabinoate was determined according to Hofmann et al. (2018).
For the analysis of growth, graphs were created with SIG- MAPLOT 13.0 (Systat, San Jose, CA, USA), and a logistic equa-
tion with four parameters was used to fit the data. Specific growth rate (μ), maximal specific growth rate (μmax), and
biomass to substrate yield (Yx|s) were calculated according to
the derivation of the polynomial fitting. A maximal standard deviation was applied for all the measurements.
3
|
R E S U LT S3.1
|
D‐Xylose and L‐arabinose as carbon sources for P. putida KT2440The wild‐type strain P. putida KT2440 is not able to utilize
D‐xylose and L‐arabinose as sole carbon sources according
to its genetic background (Henkel et al., 2012; Nelson et al., 2002). This was confirmed here by the cultivation of
P. putida KT2440 in minimal medium containing glucose in comparison with growth experiments using xylose or arabinose as sole carbon sources (Table 1). With glucose,
P. putida KT2440 reached a significant high cell density (OD600 = 12.1) with a maximal specific growth rate of
0.61 hr−1 and a biomass to substrate yield (Yx|s) of 0.37 g/g.
In contrast, no growth could be detected after cultivation in either xylose or arabinose containing media after 34 hr. However, in this time the xylose concentration decreased by about 33%, indicating a considerable consumption of xylose. In the same time, an increasing amount of xylonate could be detected, which corresponds to the consumed xylose amount (data not shown). In contrast, a similar depletion of arabinose did not occur during the cultivation.
With the intention to provide P. putida KT2440 with effi- cient pathways for the utilization of xylose and arabinose— which, in addition to glucose, represent the most abundant carbohydrates in lignocelluloses—the dedicated operons
xylAB and araBAD of E. coli, respectively, were amplified from E. coli chromosomal DNA and subsequently cloned into the pBBR1MCS‐2 shuttle vector under transcriptional regulation of the plasmid‐encoded lac‐promoter (Plac). Due to the lack of a functional lac‐operon and especially the ab- sence of the lac‐inhibitor (LacI) in P. putida KT2440, the expression of the operons controlled by Plac occurs consti- tutively omitting the addition of isopropyl β‐D‐1‐thiogalac-
topyranoside (IPTG). The resulting recombinant plasmids were finally transferred into P. putida yielding the two expression strains P. putida KT2440_xylAB and P. putida KT2440_araBAD, respectively. A P. putida KT2440 strain harboring the pBBR1MCS‐2 empty vector served as a control and showed a growth performance similar to the
P. putida wild type on glucose with an OD600 = 12.6, a
maximal specific growth rate of 0.58 hr−1, and a biomass
yield of 0.34 g/g (Table 1). As expected, this strain did not show any detectable growth after cultivation on xylose or arabinose, but the xylose concentration decreased by 21% while the xylonate concentration increased as observed for the wild type.
Next, the recombinant strain P. putida KT2440_xylAB was cultivated using one of the three sugars each as the sole carbon source (Table 1; Supporting Information Figure S1a). In contrast to the wild‐type and the P. putida strain contain- ing the empty vector, this strain was able to grow on xylose and reached an OD600 of 9.8, what is similar to its growth
on glucose (OD600 = 9.4). The calculated maximal specific
growth rate of 0.39 hr−1 on xylose was half as much than on glucose (0.98 hr−1), while the biomass yield was in compara- ble ranges (xylose: 0.30 g/g, glucose: 0.29 g/g).
It has been reported that a recombinant P. putida Sl2 strain