9.1.
Conclusions
This PhD project is composed of 3 parts:
(i) Characterisation of the glyoxalase system and dicarbonyl metabolism in a beta cell line model and investigation of the effects of high glucose and dicarbonyl stress on this system.
(ii) Investigation of the effect of MG-glycation of the ECM protein collagen IV on the functionality and adhesion of MIN6 cells in vitro.
(iii) Characterisation of dicarbonyl metabolism in the pancreas of diet induced insulin resistant C57BL6 male mice. The extent of damage to the proteome by glycation, oxidation and nitration is also assessed.
An LC-MS/MS assay was validated for the detection and quantification of GSH and related metabolites and had a LoD of 0.92, 1.46 and 0.54 pmol for GSH, GSSG and S-D-lactoylglutathione respectively. This method is shown to be robust and takes into account important aspects of sample preparation to ensure that quantification of analytes is reliable.
Results from the beta cell line model, MIN6, indicate that MIN6 cells cultured in high glucose have an increased nutrient consumption and that this in turn increases the glycolytic flux. There is a consequential increase in the flux of formation of D-lactate, indicative of higher MG production and higher flux through the glyoxalase system but the proportion of flux from glycolysis was not affected by culture in high glucose. The cellular content of MG, glyoxal and 3-DG did not increase when MIN6 cells were incubated in high glucose. This indicates that although there is more MG production, as indicated by the D-lactate flux, this is largely within the capacity of the cells to metabolise it and therefore changes in MG were not detected in the MIN6 cells. This is despite the measured activity of the glyoxalase system not increasing when the cellular demands upon it have increased. Glycation, oxidation and nitration of MIN6 cellular proteins occurred in vitro but the amounts of these adduct residues on cellular proteins were not affected by the increase in glucose. Impaired adhesion to collagen IV was demonstrated following methylglyoxal-glycation of collagen. This was suggestive of altered beta cell
196 function through changes in the expression of genes involved in both cell-cell and cell-extracellular matrix interactions.
Observations from experimental diabetes suggest that whilst methylglyoxal does increase in the pancreas of HFD fed mice this is not associated with quantifiable changes in glycation adduct residues on protein. It is concluded that whilst an increase in MG-H1 formation does occur as a result of the higher methylglyoxal content of the pancreas, a combination of increased protein turnover in the pancreas and renal clearance of damaged proteins and free adducts results in no measurable increase in glycated or oxidised protein. The pancreas is therefore highly effective in removing damaged and dysfunctional proteins which would otherwise impose cell stress. Supplementation of the HFD with omega-3 fatty acids has not been observed to have any significant effect on the glycation status of the pancreas in this model, despite going some way to prevent insulin resistance and associated metabolic disturbances. Immunostaining images have also indicated that glycation damage observed within the pancreas is predominantly ECM directed.
In summary, the data generated from this in vitro model of beta cells and in vivo model of diabetes suggests there are indications of dicarbonyl stress within beta cells and the pancreas - increased flux of methylglyoxal formation in MIN6 cells in vitro and increase concentration of methylglyoxal in the pancreas in HFD fed mice in vivo. Increased pancreatic methylglyoxal in HFD-fed mice without increased methylglyoxal modified protein does not mean that the pancreas is resistant to protein glycation. Since glycation by methylglyoxal is non-enzymatic pancreatic proteins are likely being increasingly damaged and degraded. Consequential decreases in protein concentration or compensatory gene expression may increasingly drive the pancreas into a state of increased protein turnover which eventually takes its toll as pancreatic dysfunction sets in. Clearance of damaged protein and an increased protein turnover are vital to maintenance of beta cell health. In times of continued stress, it is likely that this increased protein turnover will impact detrimentally on other aspects of beta cell function and contribute to the decline in beta cell function observed in T2DM. This study has also indicated that ECM proteins of the pancreas are particularly susceptible to glycation and that this could contribute to the demise of beta cell mass through cell-detachment stimulated cell apoptosis – anoikis.
197 A limitation of this study has been that the pancreas is a heterogeneous cell population and that the cells of interest, pancreatic beta cells, are only a small subset of this organ. However, this thesis has shown that glycation occurs within both cultured beta cells and in the pancreas, and that methylglyoxal does accumulate. The effect of protein glycation on beta cell function is limited by the high rate of protein turnover and clearance of damaged proteins from the system. Perhaps under more prolonged glycation stress, further impairments in beta cell function would be observed, especially with regards to their interactions with ECM proteins such as collagen IV.
9.2.
Further work
In this thesis a method to quantify S-D-lactoylglutathione was developed. This analyte was, however, below the LoD in all samples tested. Further development of this assay on the more sensitive Xevo triple quadrupole mass spectrometer may enable detection and quantification of this analyte which would give a more complete picture as to dicarbonyl metabolism and the activity of the glyoxalase system in these cell systems.
The studies with MIN6 cells require follow-up with mature mammalian beta cells and pancreatic islets since transformed insulinoma cells can give misleading metabolic effects as models of beta cells.
Co-localisation of collagen IV and the methylglyoxal glycation adduct MG- H1 have been observed within the pancreas and the effects of this glycation indicated within an in vitro model of beta cells. It would be interesting to follow up these findings in a primary cell model and additionally investigate whether this glycation has a direct effect on insulin secretion or on E-cadherin or Cx36 protein level. The in vivo study suggested the pancreatic proteome may suffer increased glycation with related changes in protein turnover (and possible increased compensatory gene expression). Characterisation of the HFD fed mouse pancreatic dicarbonyl proteome, proteome dynamics and changes in gene transcription are now required. Finally, studies with Glo1 transgenic and Glo1deficient mice would reveal the link between dicarbonyl stress and the development of insulin resistance and glucotoxicity.
198
Appendix A: Primer sequences
Primer Sequence (Sense, Antisense)
Glo1 5’- CCCAGCTGCTGCTCCGATCCAGACCCT -3’ 5’- CCGCGATATCGTTCTTATCCTCA -3’ Ins1 5’- CAACCGTGTAAATGCCACTG -3’ 5’- CCTGCTACGGATGGACTGTT -3’ Ins2 5’- CCATCAGCAAGCAGGAAGCCTATC -3’ 5’- CCCCACACACCAGGTAGAGAGCG -3’ (Nikolova, et al., 2006) Itgb1 5’- TTCAGACTTCCGCATTGGCTTTGG -3’ 5’- TGGGCTGGTGCAGTTTTGTTCAC -3’ (Ramirez, et al., 2011) E-cadherin 5’- AGCCATTGCCAAGTACATCC -3’ 5’- AAAGACCGGCTGGGTAAACT -3’ Cx36 5’- GGAATGGACCATCTTGGAGA -3’ 5’- TCGTACACCGTCTCCCCTAC -3’ ICAM-1 5’- TTCACACTGAATGCCAGCTC -3’ 5’- GTCTGCTGAGAGCCCCTCTTG -3’ 18S Qiagen commercial stock. Sequence not known
199
References
Abdel-Wahab, Y.H., O'Harte, F.P., Boyd, A.C., Barnett, C.R. and Flatt, P.R.
(1997). Glycation of insulin results in reduced biological activity in mice. Acta Diabetologica 34(4), 265-270.
Abdel-Wahab, Y.H., O'Harte, F.P., Mooney, M.H., Barnett, C.R. and Flatt, P.R. (2002). Vitamin C supplementation decreases insulin glycation and improves glucose homeostasis in obese hyperglycemic (ob/ob) mice. Metabolism 51(4), 514- 517.
Abdel-Wahab, Y.H., O'Harte, F.P., Ratcliff, H., McClenaghan, N.H., Barnett, C.R. and Flatt, P.R. (1996). Glycation of insulin in the islets of Langerhans of normal and diabetic animals. Diabetes 45(11), 1489-1496.
Abordo, E.A., Minhas, H.S. and Thornalley, P.J. (1999). Accumulation of alpha- oxoaldehydes during oxidative stress: a role in cytotoxicity. Biochemical Pharmacology 58(4), 641-648.
Adeva, M.M., Calviño, J., Souto, G. and Donapetry, C. (2012). Insulin resistance and the metabolism of branched-chain amino acids in humans. Amino Acids 43(1), 171-181.
Agalou, S., Karachalias, N., Thornalley, P.J., Tucker, B. and Dawnay, A.B.
(2002). Estimation of α-oxoaldehyes formed from the degradation of glycolytic intermediates and glucose fragmentation in blood plasma of human subjects with uraemia. International Congress Series 1245, 181-182.
Ahmed, M.U., Thorpe, S.R. and Baynes, J.W. (1986). Identification of N epsilon- carboxymethyllysine as a degradation product of fructoselysine in glycated protein. Journal of Biological Chemistry 261(11),4889-4894.
Ahmed, N., Argirov, O.K., Minhas, H.S., Cordeiro, C.A. and Thornalley, P.J.
(2002). Assay of advanced glycation endproducts (AGEs): surveying AGEs by chromatographic assay with derivatization by 6-aminoquinolyl-N- hydroxysuccinimidyl-carbamate and application to Nepsilon-carboxymethyl-lysine- and Nepsilon-(1-carboxyethyl)lysine-modified albumin. Biochemical Journal
364(Part 1), 1-14.
Ahmed, N., Babaei-Jadidi, R., Howell, S.K., Beisswenger, P.J. and Thornalley, P.J. (2005a). Degradation products of proteins damaged by glycation, oxidation and nitration in clinical type 1 diabetes. Diabetologia 48, 1590-1603.
Ahmed, N., Mirshekar-Syahkal, B., Kennish, L., Karachalias, N., Babaei-Jadidi, R. and Thornalley, P.J. (2005b). Assay of advanced glycation endproducts in selected beverages and food by liquid chromatography with tandem mass spectrometric detection. Molecular Nutrition and Food Research 49(7), 691-699.