Las Viviendas Turísticas de Alojamiento Rural (VTAR) y Casa Rurales (CR)

The selection of the additional HA sequence to be combined with the H17 construct was guided on the basis of that the highly pathogenic H5 A/Vietnam/1194/2004 influenza strain PV had previously demonstrated a high transduction titre and as a highly pathogenic influenza did not require the addition of protease in order to generate viable PV (Ferrara et al., 2013; Molesti, Ferrara, et al., 2014; Carnell et al., 2015) . This meant that the selection of this HA for inclusion meant that unforeseen factors related to cleavage or fusion efficiency would be unlikely to have an impact on results and that the H5 components of the chimeric construct would have a high likelihood of functioning correctly. Based on this criterion the A/Vietnam/1203/2004 HA construct was selected. The phylogenetic relationship between the two HAs, is shown in figure 47, both of these viruses are likely to be compatible as although the exact relationship of the H17 virus to the other influenza viruses in still a matter of debate (Lu et al., 2012; X. Sun et al., 2013) the phylogeny of the H17 HA protein places it within group 1 of the influenza virus family. The incorporation of the H17 stalk with the H5 head allows determination of the viability of the H17 stalk to mediate cell fusion and offers the potential to investigate the potential for stalk specific antibodies to bind to the H17 stalk region thus informing stalk based investigations of cross-reactive antibodies (Steel, Lowen and Wang, 2010; Hai et al., 2012; Margine et al., 2013). In addition, the inverse of this construct with the incorporation of the H5 stalk with the H17 head allows the potential to investigate the ability of the H17 head to bind to receptors and removes the compounding factor of fusion.

154

Previous studies constructing HA chimeric proteins required the amplification of the desired region of each of the parental HA sequences using primers that included specific restriction sites, followed by multi-segment ligation (Hai et al., 2012). However, the multiple cycles of amplification and ligation make this a relatively inefficient process and the availability of enhanced ligation tools such as the Gibson Assembly (NEB, cat. # E5510) allows the combination of multiple sequences in an efficient and non-direction-sensitive method to create novel sequences. The Gibson Assembly protocol allows multiple overlapping DNA fragments to be assembled through a reaction mediated by three different enzymes simultaneously: an exonuclease which creates 3’ overhangs, a polymerase which fills sequence gaps, and DNA ligase which acts to close the final assembled DNA (Gibson et al., 2009). The intial step in the generation of a chimeric HA is the identification of the two cysteines Cys52 and Cys277 that form the dividing region between the head and the stalk of the HA protein. These residues were identified through an alignment of HA sequences of CY103892.1 (A/little_yellow- shouldered_bat/Guatemala/060/2010(H17N10)) and HM006759.1 (A/Viet Nam/1203/2004(H5N1)). DNA Dynamo™ (Blue Tractor Software LtdΨ and the complete plasmid DNA sequences were then used to identify the nucleotide sequence corresponding to the regions of interest: the N-terminus and C-terminus of both the stalk and head regions of the sequences for A/little yellow shouldered bat/Guatemala/060/2010 and A/Viet Nam/1203/2004(H5N1). Based on this analysis the desired chimeric HA sequence was assembled and primers, summarised in Table 21, were designed using the NEBuilder® online tool (New England Biolabs).

Attempts were then made to generate the proposed HA constructs using a Gibson assembly and the NEBuilder HighFidelity DNA Assembly Cloning tool to create primers. Primers were designed to amplify the respective stalk regions within the expression vector which allowed the respective head region to be ligated into the plasmid.

Table 19:Primer sequences and annealing temperatures for cloning of the chimeric HA proteins. Regions of primers highlighted in red indicate primer sequence annealing to the corresponding to a region of the stalk/plasmid which is used during the incorporation process of the two amplicons during the final amplification, the black regions of these primers anneal to the respective head region. The shorter primers correspond to their respective stalk regions and are designed to amplify both the stalk region and plasmid in which this resides.

Primer Name Sequence Annealing Temp

H5_Head_Fw CACAACGGAAAATTATGCGATCTAGATGGAGTGAAGC 59.7

H5_Head_Rv GGCATTTGGTTGAGCAGTTACCATATTCCAATTCACTTTTC 59.7

H17_Head_Fw CAATGGGAAGCTCTGCAGCCTAAATGGAGTCCCAC 61.6

H17_Head_Rv GACACTTGGTGTTGCAGTCACTAATTGGCAGCTTAC 61.6

H5_Stalk_Fw TGCAACACCAAGTGTCAAA 64.5

155

H17_Stalk_Fw TGCTCAACCAAATGCCAAAC 61.1

H17_Stalk_Rv GCATAATTTTCCGTTGTGATTG 61.1

Figure 46: Schematic summary of generalised protocol for generation of chimeric HA cloning using Gibson Assembly. Red border regions on head amplicons indicate the region of non-head sequence amplified to facilitate reassembly of the complete hybrid. This process was repeated with both a H5 head and H17 stalk and again with a H5 stalk and H17 head region.

NEBuilder® designs primers that are suitable for amplification using the Q5® High- Fidelity DNA Polymerase and for this reason 25 µl PCR reactions were set-up as follows: dNTPs at a final concentration of 200 µM, 0.5 µM of each primers, 1X Q5® Reaction Buffer, 0.005 U of Q5® High-Fidelity DNA Polymerase, and 1 ng of plasmid DNA (pI.18- A/little_yellow-shouldered_bat/Guatemala/060/2010(H17N10) or the pI.18- A/Viet

156

Nam/1203/2004(H5N1)) used as the template sequence. Amplification was performed using a Mastercycler ep Gradient S and in the Mastercycler ep Gradient thermal cyclers using the programs reported in tables 22 and 23.

Table 20: PCR program for the amplification of the H5 and H17 stalk-encoding sequence combined with the pI.18 plasmid vector

Cycles Temperature Time Step

98°C 3 min Initial denaturation

30 cycles

98°C 15 sec Denaturation

59.6 - 62°C 30 sec Annealing

72°C 1 min Extension

72°C 2 min Final extension

4°C ฀ Stabile holding temperature

of amplicons

Table 21: PCR program for the amplification of the H5 and H17 head-encoding sequence

Cycles Temperature Time Step

98°C 3 min Initial denaturation

30 cycles 98°C 25 sec Denaturation 61.2 - 65 °C 30 sec Annealing 72°C 6 min Extension

72°C 8 min Final extension

4°C ฀ Stabile holding temperature of

amplicons

Amplification of the stalk in the pI.18 backbone (~5.5 kb total) and of the head (680 bp) regions were verified by gel electrophoresis using a 1% agarose gel (Section 2.8). Amplicons were purified with the QIAquick PCR purification kit (Chapter 2), and the amplification products assessed for concentration and purity by NanoDrop™. From the purified product ~500 ng DNA was digested in a total volume of 20 µl using 10 U of FastDigest® DpnI in 1X FastDigest® buffer and molecular grade water (Section 2.1). This digestion destroyed remaining parental DNA and is necessary to improve the efficiency of subsequent Gibson Assembly protocol.

157

After digestion, purification to remove buffer salts and enzyme was carried out, then samples were measured by NanoDrop™ and, to join the two overlapping fragments, a 20 µl Gibson Assembly reaction was set up in DNase/RNase free water using 10 µl of 2X Gibson Assembly mix, 80 ng of the stalk fragment, and 28 ng of the head fragment to produce a vector to insert ratio of approximately 1:3. The mix was incubated for 15 min at 50°C in the Mastercy cler ep Gradient S thermocycler, 2 l of this assembled product was added to 25 µl DH5- E. coli (New England Biolabs, cat.# C2987) for transformation according to the protocol presented in Chapter 2. The transformation mixture was inoculated onto an ampicillin -LB Agar plate and incubated for 16 hours at 37°C. Several colonies present on the plates were screened using T7 and pI.18 Forward primers in a colony PCR reaction (Chapter 2) to confirm the presence of a 1.7 kb band corresponding to the assembled chimeric HA product.

After PCR amplification and purification of plasmid DNA, some of the positive clones were then additionally screened via restriction enzyme digestion (Chapter 2) with FastDigest® BGlII: this enzyme linearises the two parental sequences but cleaves the H17 sequence in the stalk only and the H5 sequence in the head only, therefore the digestion patterns of this enzyme will yield distinct bands during electrophoresis that allow confirmation that the correct HA constructs have been produced. In addition, post transformation and mini-prep two plasmid preparations were sent for to GATC (Section 2.4) for Sanger sequencing to confirm the pI.18- H17/H5 or pI.18-H5/H17 constructs had been successfully produced. After the amino acid sequence of the HA construct was confirmed through alignment using MUSCLE algorithm (Edgar, 2004) in MEGA 6.0 (Tamura et al., 2011), the chimeric HA was used for PV production as using protocols as outlined in Section 2.9.

6.3. Results