El nuevo sistema internacional

Real-time quantitative PCR (RT-PCR) is a routinely used technique to measure gene expression. RT-PCR is usually performed on a small subset of gene transcripts and is a relatively low cost and sensitive profiling technique. In the case of TaqMan RT-PCR, the real time monitoring of PCR amplification of an amplicon is monitored by the incorporation of a probe consisting of two fluorophores. When the probe is either tethered or untethered to the template DNA and prior to polymerisation, the quencher fluorophore (usually long wavelength coloured dye) reduces the fluorescence from the reported fluorophore (usually short wavelength coloured dye) via fluorescence resonance energy transfer (FRET). The reporter dye is located on the 5’ end of the probe and the quencher at the 3’ end. Once the TaqMan probe has bound to its specific target piece of template DNA (and following denaturation at high temperatures), the primers anneal to the DNA and Taq polymerase incorporates nucleotides which removes the TaqMan probe from the template DNA. This polymerization separates the quencher from the reporter and allows the reporter to emit its fluorescence which is then quantified internally. RT-PCR allows the time at which the level of fluorescence passes a threshold level (known as the Cycle Threshold or Ct) to be determined. The higher the copynumber of the target gene, the faster the fluorescence passes the Ct, and thus, by comparing Ct values for different reactions, it is possible to determine the relative gene expression between samples

71

2.18.1. G

P

TABLE 2.7: Details of the primers and probes used for in vitro RT-PCR experiments. Table shows the details for the 15 genes selected for RT-PCR analysis (G6pd used as the housekeeper/normaliser gene). All genes had a FAM-NFQ reporter/quencher. The context sequence describes the nucleotides to which the assay was targeted. Gene

Symbol

Gene Name Assay ID Lot Number RefSeq

Accession No.

Context Sequence

Pck1 phosphoenolpyruvate carboxykinase 1 (soluble) Hs01572978_g1 1312055 NM_002591 TGACAACTGCTGGTTGGCTCTCACT

Chac1 ChaC, cation transport regulator homolog 1 (E. coli) Hs00225520_m1 1294249 NM_001142776 TGAAGATCATGAGGGCTGCACTTGG

Gapdh glyceraldehyde-3-phosphate dehydrogenase Hs02758991_g1 1317397 NM_001256799 GACTCATGACCACAGTCCATGCCAT

Ppargc1a peroxisome proliferator-activated receptor gamma,

coactivator 1 alpha Hs01016719_m1 1308701 NM_013261 AAGGCAATTGAAGAGCGCCGTGTGA

Lpin1 lipin 1 Hs00299515_m1 1169040 NM_001261427 AGAGAAAGTGGTTGACATAGAAATC

Foxo1 forkhead box O1 Hs01054576_m1 1301006 NM_002015 GGCTGGAAGAATTCAATTCGTCATA

Hmox1 heme oxygenase (decycling) 1 Hs01110250_m1 1305084 NM_002133 TGCTCAACATCCAGCTCTTTGAGGA

Pdk4 pyruvate dehydrogenase kinase, isozyme 4 Hs01037712_m1 1316401 NM_002612 TTTAAGAATGCAATGCGGGCAACAG

Nr4a1 nuclear receptor subfamily 4, group A, member 1 Hs00374226_m1 1259635 NM_001202233 GGCTTCTTCAAGCGCACAGTGCAGA

G6pd glucose-6-phosphate dehydrogenase Hs00166169_m1 1295896 NM_000402 GGGTGCATCGGGTGACCTGGCCAAG

Nr4a2 nuclear receptor subfamily 4, group A, member 2 Hs00428691_m1 1290694 NM_006186 CTGGACTATTCCAGGTTCCAGGCGA

Irs2 insulin receptor substrate 2 Hs00275843_s1 1289193 NM_003749 CACGACGGTCACCCCCGTGTCCCCG

Nr4a3 nuclear receptor subfamily 4, group A, member 3 Hs00545009_g1 1241861 NM_006981 AAAGAAGTTGTCCGTACAGATAGTC

Ppara peroxisome proliferator-activated receptor alpha Hs00947536_m1 1302244 NM_001001928 GCTGCAAGGGCTTCTTTCGGCGAAC

72

2.18.2. F

S

DNAS

Total RNA samples were reverse transcribed into first strand cDNA prior to RT-PCR analysis. 1µg of total RNA was used to generate cDNA using the BioScript Reverse Transcriptase kit (Bioline #BIO- 27036) according to manufacturer’s recommendations. cDNA synthesis was carried out with (RT+_{) and}

without (RT-_{) the BioScript reverse transcriptase enzyme, to enable substitution of gene expression data}

caused by amplification of gDNA. Briefly, total RNA was diluted to a concentration of 125ng/µL in 8µL of DEPC-treated water (1µg) and combined with 10mM deoxynucleotide triphosphates (DNTP) mix (Bioline #BIO-39053) and 40µM Random Hexamers (Bioline #BIO38028) in RNase/DNase free PCR strip tubes. The samples were incubated at 70°C for 5 minutes using a DNA Engine Tetrad PCR cycler (MJ Research, Massachusetts, USA) and chilled for at least 1 minute on ice. 4µL of RT-Buffer, 1µL of RiboSafe RNase Inhibitor (Bioline #BIO65027), 1µL of BioScript Reverse Transcriptase (200u/µL) and 4µL of DEPC-treated water was then added to each reaction in a master-mix and tubes centrifuged to collect the contents at the bottom of the tubes. Samples were then incubated at 25°C for 10 minutes, 42°C for 30 minutes and then the reaction was terminated at 85°C for 5 minutes. Following incubation, reactions were cooled on ice, immediately diluted 1:15 with DEPC treated water and stored at -20°C until required.

2.18.3. T

M

RT-PCR

TaqMan RT-PCR was performed in 384 well plates using the QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems, Life Technologies, Paisley, UK). Briefly, 9 µL of 1:15 diluted cDNA was loaded into each well of a 384 well plate (n=3 biological replicates with two technical replicates per sample) and the plate centrifuged at 300g for 2 minutes to collect the cDNA at the bottom of each well. 10µL of TaqMan Universal MasterMix II With UNG (Applied Biosystems, Life Technologies #4440045) and 1µL the PCR primers/probes for individual genes (table 2.7) were added to each well ensuring that both the 2X MasterMix II and the 20X primers/probes were both at 1X final concentrations in the well (TaqMan Universal MasterMix and the PCR primers/probes were combined and added to each well in one step to reduce variability due to pipetting error). One gene per plate was analysed (16 genes) with all samples included on each plate. Non-template controls (NTC’s) were included (~ 6 wells per gene) where DEPC- treated water replaced the cDNA template.

Plates were sealed with MicroAmp optical adhesive film covers (Applied Biosystems, Life Technologies #4311971) and the contents mixed thoroughly be inverting 3-4 times. Plates were centrifuged at 300g for

73

4 minutes to collect the reaction products at the bottom of each well. Plates were then placed into the QuantStudio 6 Flex instrument and run at default running conditions, for 40 cycles, with detection set at FAM-NFQ for the detection of amplification fluorescence.

2.18.4. RT-PCRS

A

Cycle threshold (Ct) values were exported from the QuantStudio software as tab-delimited text files and data were transferred to Microsoft Excel for downstream analysis. Ct values were converted to copy numbers of each gene and the RT- value was substituted from the RT+ value to correct for amplification of gDNA. Averages of duplicate (technical replicate) wells were calculated and sample copy numbers were then normalised by division against the housekeeper gene, glyceraldehyde-3-phosphate dehydrogenase (Gapdh). Statistical significance was derived using analysis of variance (ANOVA) (n=3) with post-hoc Dunnett’s test in TaqMan toolkit (Microsoft Excel plug-in).