II. REVISIÓN DE LITERATURA
2.2. Marco teórico de la investigación
2.2.4. El proceso contencioso administrativo urgente
7.1 Introduction
Despite expression in what might be considered a more native cellular environment,
Drosophila nAChR subunits (as assayed by radioligand binding) could not be detected in the Drosophila S2 cell line unless Drosophila nAChR subunit cDNAs were co-expressed with vertebrate nAChR subunits. The results strongly suggest that the inability of these Drosophila nAChR subunits to generate functional channels in the absence of vertebrate subunits is due to a requirement for co-assembly with, as yet unidentified Drosophila nAChR subunits. I was aware of several attempts to identify novel Drosophila nAChR cDNAs by conventional hybridisation methods
. For this reason PCR techniques were employed in an attempt to identify novel nAChR cDNAs in several Drosophila cDNA libraries using probes designed to various regions of cloned Drosophila and rat nAChR subunits.
7.2 The novel Drosophila nAChR subunit Doc3 (ADR)
During the course of my project we became aware of a novel (fifth) nAChR subunit cDNA which had been cloned from Drosophila. Although this subunit (D a3 or ADR) is unpublished we were provided with this cDNA clone in the expression vector pBluescript by Dr Bertram Schmitt, Frankfurt.
This novel subunit has been classified as an a nAChR subunit because it has two adjacent cysteine residues at positions equivalent to cysteine residues 192 and 193 in the Torpedo nAChR a subunit. The nucleotide sequence for this subunit had not been fully elucidated. Uncertainties, especially in the intracellular loop between TM3 and TM4, were evident. The third intracellular loop is much longer than in the other
7.3 Subcloning the novel Drosophila nAChR subunit D a3 into the Drosophila
expression vector pRmHa3
The pBluescript-Da3 construct contained a 5' untranslated region which had an upstream ATG close to the signal sequence. Due to the lack of a complete nucleotide sequence and the lack of suitable restriction sites to subclone the D a 3 subunit from pBluescript into pRmHa3 in such a way to remove the upstream ATG and to optimise the start codon consensus sequence, the D a3 was subcloned by PCR.
Two PCR oligonucleotides of 26 and 32 bases in length were designed to the 5' and 3' ends of D a3. The primers were designed to introduce an EcdRV and a BamUl site at the ends of the PCR product which could be used to subclone the D a3 fragment directly into the pRmHa3 expression vector.
The PCR primers 5'- CGGAATTCGAGATGAAGTGGTTTCAAGTGACC- 3' and 5'- CGGGATCCGCTATCCTCCGTCTCTGG -3' were used to amplify the D a3 subunit from the pBluescript-Da3 cDNA. The conditions used were: 30 s at 95°C, 45 s at 55°C and 180 s at 72°C for 25 cycles with a ramp of 0.5°C/second using Pfu DNA polymerase (Strategene). The resultant PCR product was digested with EcoBl and BamHI and purified from a low melting point agarose gel. The PCR product was subcloned into the plasmid expression vector pRmHa3 which had been digested with
EcoBl and BamHI. The pRmHa3-Da3 construct was checked for correct orientation of the cDNA by restriction mapping and nucleotide sequencing.
7.4 Radioligand binding studies with stably transfected S2 cell lines expressing the novel Drosophila nAChR subunit Do3
Stably transfected 82 cell lines were established expressing various nAChR subunit combinations: D a3 alone, D a3 with rat (32, D a3 with rat p4 and all five cloned
Drosophila subunits Da3/ALS/ARD/S AD/SBD. Membrane preparations of the each of cell lines were assayed by pH]-epibatidine binding (3 nM) in the presence or
absence of 1 mM carbachol to determine non-specific binding. No specific binding was observed with any of the S2 cell lines expressing D a 3 in any of these combinations (data not shown).
7.5 Metabolic labelling and immunoprécipitation
The expression and co-assembly of the D a3 nAChR subunit with the rat p2 nAChR subunit was investigated by co-precipitation studies using the monoclonal antibody mAb290 which is specific for the rat P2 subunit. This antibody had been used successfully to show co-assembly of the Drosophila a subunits ALS and SAD with p2 (Figure 5.3). The results of the co-precipitation experiment are shown in Figure 7.1. The rat P2 subunit was immunoprecipitated by mAb290. The Drosophila Da3 subunit did not cross react with and was not co-precipitated by mAb290 when co expressed with the rat P2 subunit.
7.6 Screening Drosophila cDNA libraries for potential novel nAChR subunits
The inability of the Drosophila nAChR subunits to co-assemble into nAChRs in the absence of vertebrate subunits suggests that this could be due to a requirement for co assembly with, as yet, unidentified nAChR subunits. In an attempt to resolve this, several Drosophila cDNA libraries were screened by PCR using various combinations of primers designed to conserved regions of nAChR subunits. Primers and degenerate primers were designed to the conserved regions of the cloned Drosophila TM2, TM3 and TM4 domains. Another PCR screening strategy which was used, employed a forward primer designed to the library vector sequence and a reverse internal primer to a highly conserved region in all previously identified nicotinic subunits. Full details of the primers and techniques used are described in Section 2.27 and one of the strategies used is summarised in Figure 7.2.
Specific and degenerate PCR primers designed to TM3 and TM4 of the four cloned