• No se han encontrado resultados

4. ANÁLISIS E INTERPRETACIÓN DE RESULTADOS

4.1. Encuesta aplicada a los estudiantes de la Unidad Educativa

To confirm the relative expression of sperm-specific miRNAs in HFD and AMC mice, a qRT-PCR (Applied Biosystem) was carried out on the isolated RNA. A set of 84 spermatozoal miRNAs were selected using custom miScript miRNA PCR array and Pre-Amplification protocol from Qiagen-UK.

139

Relative expression levels were normalized to a panel of six housekeeping genes (cel-miR-39-3p, SNORD 61, 68, 72, 95, 96A). miRTC was a gene for the reverse transcription reaction control and PPC as a positive PCR control. The other controls were used for data normalization. The analysis demonstrated that 29 of them were overexpressed (fold changes greater than 1) or significantly upregulated (p <0.05) in the sperm of HFD mice, while three miRNAs were downregulated (fold changes less than 1), but only miR-883a-3p was significant (p <0.05) as listed in Table 5.8, and highlighted in the scatter plot (Figure 5.5). The remaining 54 miRNAs showed no significant differences in the expression of miRNA in the sperm of HFD male mice when compared to controls.

Table 5.8 Fold change and P values of miRNA miScript PCR Array in HFD comparing with AMC,

All miRNAs are highly expressed significantly, only miR-883a-3p was downregulated. The underlined sequences are representing the miRNA seed regions

miRNA Fold Regulation

P value Mature miRNA Sequence location

let7a-5p 70.2859 0.005627 UGAGGUAGUAGGUUGUAUAGUU ch13 let7b-5p 54.3505 0.022252 UGAGGUAGUAGGUUGUGUGGUU ch15 let7c-5p 63.9943 0.005654 UGAGGUAGUAGGUUGUAUGGUU ch16 let7e-5p 9.9594 0.027242 UGAGGUAGGAGGUUGUAUAGUU ch17 miR-10b-5p 180.004 0.00995 UACCCUGUAGAACCGAAUUUGUG ch2 miR-145a-5p 146.8859 0.032656 GUCCAGUUUUCCCAGGAAUCCCU ch18

miR-148a-3p 291.5883 0.004335 UCAGUGCACUACAGAACUUUGU ch6

miR-17-5p 196.3796 0.040346 CAAAGUGCUUACAGUGCAGGUAG ch14

miR-19a-3p 146.7403 0.021939 UGUGCAAAUCUAUGCAAAACUGA ch14

miR-20a-5p 206.3355 0.018187 UAAAGUGCUUAUAGUGCAGGUA ch14

140

miR-200b-3p 21.262 0.003506 UAAUACUGCCUGGUAAUGAUGA ch4

miR-204-5p 122.5673 0.020412 UUCCCUUUGUCAUCCUAUGCCU ch19

miR-214-3p 39.8525 0.009967 ACAGCAGGCACAGACAGGCAGU ch1

* miR-21a-5p 61.3726 0.000643 UAGCUUAUCAGACUGAUGUUGA ch11

miR-22-3p 32.5092 0.039342 AAGCUGCCAGUUGAAGAACUGU ch11 miR-222-3p 55.6404 0.04257 AGCUACAUCUGGCUACUGGGU chX miR-223-3p 60.5419 0.005702 UGUCAGUUUGUCAAAUACCCCA chX miR-24-3p 111.0388 0.016333 UGGCUCAGUUCAGCAGGAACAG ch13 miR-27a-3p 86.0089 0.026101 UUCACAGUGGCUAAGUUCCGC ch8 miR-29a-3p 169.679 0.043498 UAGCACCAUCUGAAAUCGGUUA ch6 miR-30e-5p 95.771 0.024435 UGUAAACAUCCUUGACUGGAAG ch4 miR-320-3p 31.0873 0.00703 AAAAGCUGGGUUGAGAGGGCGA ch14 miR-34a-5p 99.449 0.03182 UGGCAGUGUCUUAGCUGGUUGU ch4 miR-34c-5p 80.3869 0.020111 AGGCAGUGUAGUUAGCUGAUUG ch9 miR-342-3p 23.2586 0.017736 UCUCACACAGAAAUCGCACCCGU ch12 miR-375-3p 47.665 0.010424 UUUGUUCGUUCGGCUCGCGUGA ch1 miR-465b-5p 23.6548 0.015052 UGCAAUGCCCUAUUUAGAA chX miR-183-5p 92.3576 0.004631 UAUGGCACUGGUAGAAUUCACU ch6 miR-883a-3p -4.233 0.045197 UAACUGCAACAGCUCUCAGUAU chX

*miR21 is highly significant upregulated via the Bonferroni correction method (p<0.0006).

The scatter plot and cluster gram data analysis was performed to confirm the miRNA distribution depending on their expression changes in the sperm of HFD and controls (AMC) mice through http://pcrdataanalysis.sabiosciences.com/ mirna software (Figure 5.5 and Figure 5.6).

141

Figure 5.5 Scatter plot of miRNA expression:

log 2 values of relative miRNA expression of mouse sperm versus-Log 10 of the p-value. The red colour is significant and non-significant highly expressed miRNAs, and the black colour is the downregulated miRNAs. The expression profile of 84 different miRNAs is as log10 (2^- Delta Ct) of normalized gene expression level in the sperm of HFD group (X-axis) compared with AMC mice (Y-axis) at P = 0.05. (HDF: High-fat diet mice; AMC: Aged matched control fed mice).

Figure 5.6 Hierarchical clustering heat map representation of the transcriptome analysis of miRNAs in the spermatozoa of mice.

Changes in the expression of miRNA from HFD sperm compare to AMC sperm (p< 0.05). Each row is displaying the data from different samples. Samples are depicted in columns and miRNAs are clustering in rows. The different colours indicated the miRNAs species upregulation and downregulation of red and green colour indication respectively.

143

miRNA regulation in the early stages of spermatogenesis has been studied previously (Wang and Xu, 2014) but their role in the later stage of motile sperm remains to be fully appreciated.

After Bonferroni correction, the expression of miR-21a-5p was highly significant (0.000643) in the sperm of HFD mice. The fold regulation is equal to the fold change of 2^ (- Delta Delta Ct) equals the normalized gene expression 2^ (- Delta Ct) in the sperm of HFD mice divided the normalized gene expression 2^ (- Delta Ct) in the sperm of AMC mice. It was decided to explore the epigenetic regulation of this miRNA further.

miR-21a-5p is a ubiquitous oncogene or tumour suppressor; miR-21a (mirBase Accession: MINAT0000530), and is broadly conserved among vertebrates. As this was highly upregulated in HFD mouse sperm, we were interested in investigating the epigenetic regulation of miR-21a by exploring any changes in the methylation of the promoter region responsible for its expression. The Primary transcript (Pri-miR-21a), which lies next to VmP1 (Vacuole Membrane Protein 1) promoter region, also known as Transmembrane Protein 49 (TMEM 49) gene are regulated by binding site “CCTAATAAGG” called CArG box transcription control element within the promoter region (Figure 5.7) according to a previous study(Zhang et al., 2011).

144

Figure 5.7 Putative region of miRNA-21a structure and function,

The schematic is showing the transcription site of pri-miR-21 with the red arrow and other coloured different transcription sites. Modulated and cited by (Fujita et al., 2008). SRF or CArG is representing the transcription control element.

pri-miR-21 and VmP1 regulate the mature miR-21 independently. Besides, it has been found overlapped with the upstream 3’UTR end of VmP1, of chromosome11qC in mice, in the last protein-coding exon (12 downstream) of the transcript (Figure 5.8).

145

Figure 5.8 Schematic structure of mouse sperm VmP1 transcript and miR-21a.

a. Represents chromosome11 (99.9 /kb size) in mice where VmP1 transcript is located on qc11 between 86.615.0 and 86.685.00 position. b. VmP1 containing 12 highlighted exons, P is the promoter region, the active transcribed site of Pri-miR-21; exon12 adjacent to the promoter region and the site of CpG islands. C. the miRNA and the seed region showed underlined with green marks of the two CpG sites (from UCSC genome browser, genome-

euro.ucsc.edu).

146

Documento similar