4.3. MARCO TEORICO
4.3.1. La evaluación educativa La evaluación es una tarea que está inmersa en muchas de las acciones que realizamos a diario, pues constantemente estamos valorando
The work presented in this chapter describes the re-engineering of an Avr3 promoter:GFP reporter construct by restoring a missing upstream part of the promoter. The new construct, pAvr3proGFP, was used to transform Fol race 3. The missing part of the promoter consisted of around 300 bp of upstream sequence that contains a qa-1F-like element, a putative activator-binding site that may be necessary for efficient Avr3 expression. The results presented in this chapter showed that inclusion of the extra promoter sequence did in fact restore Avr3 promoter activity in transformants carrying ectopic insertions. Although the -1 to -575 region of the Avr3 promoter seems to be conserved between the promoters of Avr3 homologues in other formae speciales of Fusarium oxysporum, the regions further upstream seem to be unique to Fol. It is therefore possible that the 300 bp region added to the promoter contains cis- elements responding to a signal unique to tomato roots. This region has not been investigated further for possible cis-acting elements, because it is beyond the scope of this thesis. However, future studies could focus on a bioinformatic and experimental analysis of this region.
Fol race 3 was transformed with pAvr3proGFP in order to obtain Fol transformants with an ectopic insertion of an Avr3 promoter:GFP reporter as well as an intact Avr3 gene. Fifteen Fol transformants were recovered. The majority of these transformants showed weak GFP fluorescence when grown in axenic culture on PDB (Figure 2.5). This was not completely unexpected because van der Does et al. (2008) showed weak expression of the Six1 gene in Fol cultures grown on PDB. However, when these transformants were used to infect plants,
they only showed GFP fluorescence inside roots, not on the outside where fungal mycelia would also have been present (Figures 2.6, 2.7, 2.9, 2.10 and 2.12). Unfortunately, all transformants that showed GPP fluorescence upon infection of tomato roots also showed reduced virulence (Figures 2.7, 2.8, 2.9, 2.10 and 2.11). Fol is haploid so the insertion of GFP into coding or regulatory sequences could have a disruptive effect, e.g. insertion into a gene required for normal growth and viability, or pathogenicity. If this was the case, then it may have been possible to overcome the problem by screening many more transformants. However if the GFP insertion had a disruptive effect, differences in growth, morphology or viability might have been expected between the WT and Fol transformants together with the loss of pathogenicity. Morphology, growth rate, and both colony appearance and colour of the best transformant were similar to those observed in the WT, providing no evidence for a disruptive effect on fungal development due to the GFP insertion in this transformant (Figure 2.14).
There is also the possibility that an ectopic copy of the Avr3 promoter may have an interfering effect on the endogenous Avr3 promoter, and may diminish Avr3 expression, thereby affecting pathogenicity. In addition, the fact that the 5’ and 3’ UTRs of Avr3 are present in the Avr3 promoter:GFP:Avr3 terminator construct and that these are transcribed along with the GFP coding sequence, creates the possibility of interference with the activity of the endogenous Avr3 gene at the RNA level. Alternatively, the fact that all transformants showing GFP fluorescence had reduced pathogenicity and that Fol 3 Avr3pro:GFP transformant 6 (the only fully virulent transformant) showed no GFP expression could suggest that GFP may be toxic to Fol race 3. However, transformant 4 showed normal growth and development in vitro suggesting that GFP is not toxic per se. As these possibilities were not related to the intended use of a suitable transformant, they were not investigated further.
Even though the present work might suggest that GFP has affected pathogenicity of the Fol transformants obtained, GFP has been used widely and successfully to study various plant–pathogen systems. Moreover, other studies with GFP-tagged F. oxysporum, have not reported an effect of GFP on pathogenicity. For example, F. oxysporum f. sp. radicis-lycopersici was transformed with GFP, and transformants tested for pathogenicity on tomato
59
were all found to be just as pathogenic as the parental isolate (Lagopodi et al., 2002). Similarly, it was shown that the transformation of F. oxysporum f. sp. niveum race 1 with GFP did not affect pathogenicity on watermelon (Lü et al., 2014).
GFP and Avr3 expression in the Fol 3 Avr3pro:GFP transformants was evaluated
by RT-PCR and qPCR. Although the Fol transformants tested by RT-PCR showed
Avr3 and GFP expression, pathogenicity tests showed reduced virulence for all of them. Unfortunately, Avr3 and GFP transcript levels could not be normalised in the qPCR analysis of the Fol transformants because good PCR primers targeting a fungal housekeeping gene and/or good PCR parameters could not be found to validate the results. The primers used in this study were primers targeting commonly used fungal housekeeping genes. Issues with the primers can perhaps be attributed to primer design and/or inappropriate annealing temperatures. BLAST searches (Basic Local Alignment Search Tool) (Altschul et al., 1990) of the primer sequences against the Tomato WGS Chromosomes (SL2.50) nucleotide database showed significant matches in the tomato genome, but it is unclear whether the matches would lead to inappropriate priming.
Primers targeting the fungal EF-1α sequence were found to amplify a product
from samples that were not supposed to contain Fol (mock-inoculated control
samples). As mentioned previously, it is possible that the primers used may be amplifying a homologue from tomato. Supporting this possibiity, Figure 2.17 shows an alignment of the EF-1α reverse primer to an homologous tomato
sequence found using a BLAST search against the Tomato WGS Chromosomes (SL2.50) nucleotide database available on the SOL genomics network (http://solgenomics.net/tools/blast/). The alignment reveals that the reverse
primer has a good match to the tomato EF-1α gene on chromosome 11 (95%
identity). Although the EF-1α forward primer does not match the tomato gene,
it is possible that a good match with a single primer could contribute to the generation of a PCR artefact.
Query: FoTEF-Q2 reverse primer > Chromosome 11
Query: 1 agaacccaggcgtacttgaa 20
||||||||||| |||||||
Sbjct: 54308528 agaacccaggcatacttgaa 54308509
Figure 2.17 BLAST search of EF-1α primers against the Tomato WGS Chromosomes (SL2.50) nucleotide database reveals 95% identity between the reverse primer and a segment of the tomato EF-1α gene.
Primers targeting the 3’ UTR of EF-1α, the actin and β-tubulin genes were also tested and showed amplification in some mock-inoculated samples. BLAST searches of each of these primers against the Tomato WGS Chromosomes (SL2.50) nucleotide database revealed significant matches in the tomato genome. However, it is not clear whether these matches would lead to inappropriate priming because most of them lack matches for 2 or 3 of the 3’ bases. Figure 2.18 shows an alignment of the primers to one of the tomato sequences found in the BLAST search.
3’UTR-FoTEF1a-Q1 primers
Query: 3’UTR-FoTEF1a-Q1 forward primer > Chromosome 11
Query: 3 tcaagatggttccctccaag 20 |||||||||||||||
Sbjct: 31700642 caaagatggttccctcccta 31700623
Query: 3’UTR-FoTEF1a-Q1 reverse primer > Chromosome 8
Query: 1 attatgtgcccccagacaaa 20
||||||||||||||||||
Sbjct: 36253094 attatgtgcccccagacact 36253113 3’UTR-FoTEF1a-Q2 primers
Query: 3’UTR-EF1a-Q2 forward primer > Chromosome 10
Query: 1 ctaccctcctctgggtcgtt 20 |||||||||||||||
Sbjct: 11272214 gtaccctcctctgggtgtca 11272195 Query: 3’UTR-EF1a-Q2 reverse primer
> Chromosome 8 Query: 1 agcgagtacatcagcccttg 20 ||||||||||||||| Sbjct: 22927696 tcatggtacatcagcccttg 22927677 TubulinB primers
Query: TubulinB-Q1 forward primer > Chromosome 12
Query: 7 catcctaccgtgcccagtct 20 ||||||||||||||
Sbjct: 32902112 ctagggaccgtgcccagtct 32902099 Query: TubulinB-Q1 reverse primer
> Chromosome 3
Query: 1 aattccatctcgtccataccc 19 |||||||||||||| ||||
Sbjct: 10350517 aattccatctcgtcaatacat 10350499 Actin-1 primers
Query: Actin-1 forward primer > Chromosome 7
Query: 3 tcgggtatgtgcaagg 16 ||||||||||||||
Sbjct: 23040477 aagggtatgtgcaagg 23040464
Query: Actin-2 reverse primer > Chromosome 2
Query: 1 gtatcgttctggac 14 |||||||||||||| Sbjct: 7891613 gtatcgttctggac 78916
Figure 2.18 BLAST search of primers to Fol genes against the Tomato WGS Chromosomes (SL2.50) nucleotide database. Search results for primers to Fol 3' UTR of EF-1α (3’UTR-FoEF1a), Fol β-tubulin (TubulinB-Fol) and Fol Actin genes (Act1F and 2R) revealed a high percentage of identity between the primers and segment of the tomato genome (one alignment shown). BLAST searches used Expect (e-value) threshold 10-30 and substitution matrix BLOSUM62
Future efforts in this area would need to concentrate on identification of a gene showing uniform constitutive expression that is unique to fungi (i.e. absent from plants) in order to normalise fungal gene expression in infected plants. Another option could be to focus on designing primers targeting regions of housekeeping genes with no sequence homology to plant DNA. Primer pairs targeting regions with low sequence homology in the 3’UTR of EF-1α (3’UTR- EF1a −Q1 and Q2) and the β-tubulin gene were designed manually in an attempt to overcome this problem but amplification products were still detected from mock-inoculated samples using these primers. Also, annealing temperatures used in the PCR analysis were determined using the Tm calculator tool recommended for the DNA polymerase protocol used. It could therefore be possible that annealing temperatures were too low and needed to be increased. Optimisation of annealing temperatures in PCR reactions to avoid non-specific PCR products could have been done by testing a range of temperatures above and below the calculated Tm of the primers, but it was not pursued because of time constrictions.
van der Does et al. (2008) used the FoTEF-Q2 primers to successfully evaluate constitutive EF-1α expression in cDNA from infected plants by qPCR. However, mock-inoculated control plants were not included in their experiments so there were no data to show that these primers were not also amplifying from plant material. Corrales Escobosa et al., (2011) used the primer pair Actin 1F/2R as an internal control for constitutive expression of the actin gene in an RT-PCR experiment on cDNA from infected roots. Their results showed no detectable amplification products in the RT-PCR analysis of root or stem samples from mock inoculated plants. Because they did not report the annealing temperatures and PCR cycling conditions, it is likely that the work presented in this chapter was done under different conditions, as PCR amplification products were detected in mock inoculated samples using these primers (Figure 2.16). Therefore, this primer pair was not used for qPCR evaluation of constitutive expression. Also, BLAST searches with all the primers revealed that there are a number of potentially unintended templates in tomato (Figure 2.17 and 2.18). These primers may also have been unsuitable for the purposes described in this chapter because they were intended for RT-PCR analysis and had not been optimised for qPCR. Failure in the present project to find suitable primer pairs for normalisation of Fol transcripts could perhaps be attributed to inappropriate
63
annealing temperatures and/or cycling conditions, but primer homology with tomato sequences may also have been a contributing factor.
As a consequence of the failure to obtain ectopic Fol 3 Avr3Pro:GFP transformants without reduced virulence, fluorescence microscopy could not be used to determine the best time of RNA sampling for the RNA-Seq analysis described in the next chapter or to undertake further microscopic analysis of inoculated tomato roots in order to determine the timing of the resistant response conferred by I-7. However, fluorescent hyphae from Fol transformants were observed inside tomato roots as early as 2 dpi, suggesting that plant defense response signalling should already have started. Therefore, this time point was chosen for RNA sampling.