6. METODOLOGÍA
6.3. POBLACIÓN Y MUESTRA
7.2.3. EVALUACIÓN ILUMINACIÓN
Yeast transformations were performed essentially as described in Gietz et al (2002). Briefly, cells were grown overnight in 10 mL 2x YPD in 50 mL Erlenmeyer flasks. Cells were then inoculated into fresh 2x YPD in order to obtain high-density exponential phase cells. Cells were centrifuged at 2,000 rpm for 5 min and washed in sterile water. The transformation mixture was made up as listed in the table below.
Reagents Volume ( L)
PEG 3350 (50% w/v) 240
1.0 M Lithium Acetate 36 Denatured salmon sperm DNA 50 PCR DNA product (~5 g DNA) 34
PEG 3350 (Sigma) was dissolved in water and sterilized using 0.22 m filter. Salmon sperm carrier DNA was denatured prior to making the reaction mix, by placing it on ice for 2 min and then in boiling water (x3) for 0.5 min. Washed cells were re-suspended in transformation reaction mixture and heat shocked at 42 C in a water bath for 40 min. Cells were centrifuged at 13,200 rpm for 30 sec and the supernatant removed. Cells were gently re-suspended in 500 L sterile water, centrifuged again and re-suspended in 2x YPD and then recovered overnight. Then 200 L of the transformation mix was spread onto selective medium. Plates were incubated at 30 C until colonies appeared, which was usually within 3 days. Colonies of transformants were streaked onto fresh plates.
Chapter 2
46 2.18 Southern blot
Southern blots were performed as described in Current Protocols in Molecular Biology, Unit 2.9A. All Southern blot solutions listed below apart from Blocking solution were autoclaved at 121˚C for 15 min.
Denaturing Solution Reagent Concentration (M) NaOH 0.5 NaCl 1.5 Neutralization Solution Reagent Concentration (M) Tris.HCl 0.5 NaCl 3 20xSSC Reagent Concentration (M) Sodium Citrate 0.3 NaCl 3
10x Maleic Acid Solution Reagent Concentration (M)
Maleic Acid 0.1
47 Detection Buffer Reagent Concentration (M) Tris.HCl 0.1 NaCl 0.1 10x Blocking Solution Reagent Amount Blocking Powder 5 g 10 x Maleic Acid* 45 mL
2.18.2 Digoxygenin (DIG) probes for Southern blots
Probes for Southern blots targeting auxotrophic markers HIS3, LEU2 and URA3
were made by amplifying the markers from a S288C gDNA. The following table lists the primers used to amplify the markers using PCR.
Auxotroph primer Sequence 5’-3’ Product size (bp) Histidine Fwd CACCCCGTAATTGGTCAAC 2089 Histidine Rvs ATCCTCGGGGACACCAAATA Leucine Fwd GCGGAACCGGCTTTTCATAT 1274 Leucine Rvs TAACTTCTTCGGCGACAGCA Uracil Fwd AAGAACGAAGGAAGGAGCACA 1127 Uracil Rvs TTGGTTCTGGCGAGGTATTG
Chapter 2
48 For the amplification of the auxotrophic markers, the following listed PCR master mix was used. A DIG/dNTP mix was made up to a ratio of 1:2. The PCR cycle consisted of the following 92°C for 2 min, (92°C for 1 min, 58°C for 2 min, 72°C for 2 min) x 30, and 72°C for 10 min in a Thermocycler.
Solution Stock Concentration Volume ( L)
Sterile Water N/A 10.8
Reaction Buffer 10x 2.5 Magnesium Chloride 25 mM 2.5 DIG/dNTP mix 10 mM 5.0 Primer 1 100 mM 1.0 Primer 2 100 mM 1.0 Taq polymerase 5 U/ L 0.2 Template DNA ~500 ng/ L 2.0
2.18.3 DNA Restriction digests
Genomic DNA was isolated form yeast using the method described in Section 2.10. Samples were diluted with Tris buffer, so that all DNA extracts were equivalent concentrations and digested with suitable restriction enzymes; restriction enzymes were chosen on the basis that they did not have any sites within the genes of interest according to the SGD (http://www.yeastgenome.org). Fragments containing genes of interest would be of known size. 10 g of DNA was digested for 12 hrs with 10 units of the restriction enzyme and x1 buffer.
2.18.4 Gel electrophoresis for resolution of restriction digests
Digested DNA (50 L) was run on a 1% agarose gel in 1x TBE. Following this the gel was stained in a solution of 1 g/mL ethidium bromide and visualized on a UV transluminator.
49 2.18.5 Southern blot assembly
The Southern blot was assembled as shown in the figure below
(http://www.currentprotocols.com/protocol/mb0209a).
Figure 2.1 Schematic diagram of Southern Blot assembly
2.18.6 Probing the southern blot
The Southern blot membrane was placed between two mesh sheets (Diversified Biotech) previously soaked in Easy Hyb (Roche) solution. The sandwiched membrane was placed into a roller bottle (Schott) and 20 mL Easy Hyb added. The membrane was pre-incubated in the Easy Hyb solution for 2 hrs at 42 C. The DIG probes (10 ng/mL) were denatured at 100 C for 10 min then placed on ice until ready for use. The Easy Hyb solution was then removed from the roller bottle and the denatured DIG probe were added to the appropriate membrane accordingly. The blot was hybridized overnight at 44 C.
2.18.7 Stringent washes and probe detection
All washes and incubation steps described below were performed at room temperature unless stated otherwise. The southern blot membrane was removed from the roller bottle and washed twice in 2x SSC/0.1 % SDS solution with gentle
Chapter 2
50 rocking for 5 min. The blot was then washed twice in 0.5x SSC/0.1 % SDS at 55 C for 5 min. The membrane was then placed in 1x Maleic acid buffer/ 0.03 % Tween 20 for 15 min. The membrane was then placed in blocking solution for 45 min. The blocking solution was decanted and 50 mL 0.075 U/mL Anti-Digoxygenin-Alkaline Phosphatase (Roche) was added. The membrane was incubated in the antibody for 60 min with gentle rocking. The antibody solution was then discarded and washed twice in 1x Maleic acid buffer/0.03 % Tween-20 for 15 min. The membrane was incubated in detection buffer for 5 min and then placed between two sheets of plastic. The membrane was then incubated in CPD-Star (Roche) left for 30 min and then exposed to X-ray film (Amersham) for 1 min. The film was developed using the Kodak imager X-ray film developing machine (Cowanman 2000 IR).