• No se han encontrado resultados

Evaluación del impacto ambiental producto de las emisiones, mediante el

5.3 EJEMPLO DE APLICACIÓN PARA LA METODOLOGÍA DE BENEFICIOS ECONÓMICOS,

5.3.3 ANÁLISIS DE LAS EXTERNALIDADES

5.3.3.1.2 Evaluación del impacto ambiental producto de las emisiones, mediante el

A multiple human tissue Northern blot (Human MTN Blot2, Clontech) was probed with a radioactively labelled RT-PCR product generated using primers GSP2 and R6 (figure 111.21). Pre-hybridization and hybridization were carried out for 2 hours at 60° C and 20 hours at 65 °C respectively in solutions made according to the manufacturer’s recommended protocol. The blot was washed twice in 2xSSC and 0.05% SDS for 30 min at room temperature and once in O.lxSSC and 0.1% SDS for 40 min at 55°C. The blot was exposed to X-ray film (Kodak-Biomax-MR) for 36 hours.

11.2.6 5 RACE

For all 5 RACE experiments the 5 RACE system for the rapid amplification of cDNA ends, version 2.0 (Life technologies, GIBCO BRL) was used following the manufacturer’s instructions. In brief, first strand cDNA is synthesised from total RNA using a gene-specific primer and Superscript^™ 11, an RNase H- derivative of Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLVRT). The primer, 3pg of total RNA and DEPC treated water were heated to 75°C (for two minutes) and added to a reaction mix containing 20mM Tris-HCl (pH 8.4), 50mM KCl, 2.5mM MgCH, lOmM DTT, lOOmM cDNA primer, and 400|iM each of dATP, dCTP, dGTP, dTTP (final concentration). The reaction mix was incubated at 42°C for one minute. Ipl (200 units) of the Superscript™ 11 RT was added, mixed and incubated at 42°C for 60 minutes.

The reverse transcription reaction was stopped by incubating at 70°C for 10 minutes, the RNA template was digested by treatment with an RNase mix

(containing RNase H which is specific for RNA: DNA heteroduplex molecules, and RNase T l) at 37°C for 30 minutes. Following brief centrifugation the reaction mix was passed through a Glassmax column. Prior to application to the column 120pl of

binding solution (6M Nal) was added to the newly synthesised cDNA. The column was centrifuged at 13000g for 20 seconds, the flow-through collected and kept at-20°C. The column was washed four times with the wash buffer (supplied by manufacturers), and twice with 70% ethanol to remove any unincorporated dNTPs,

^ S P l A A A A A A A A A A A ... , .. <GSP1 G SP l

A

Tccc:cccc G S P l cccccccc GSP2 G S P l ---GIGGIGGG Ad. CCCCCCCC --- ^ ---GSP3 GSP2 .A A A A A A A A A A A Ad. .C C C C C C C d . GSF3

1- Specific cDNA synthesis using mRNA or total RNA and Gene Specific Primer l(GSPl).

2- Single strand cDNA was prepared and mRNA was removed by using RNase H.

3- Single strand cDNA was cleaned and all dNTP and primers were removed from the reaction.

4- A polyC tail using dCTP and TdT enzyme was made.

5- The first RACE-PCR using GSP2 (or GSPl) and Poly G with an adapter primer (abridged anchor primer)

6- The second RACE-PCR using GSP3 (or GSP2) and the adapter primer

7- The PCR result band from an agarose gel was cut out for sequencing

Name Sequence (5' to 3') Note 5'RACE abridged

anchor primer

GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG For 5'RACE

Abridged universal amplification primer

(AUAP)

GGCCACGCGTCGACTAGTAC For 5'RACE

Adaptor-poly(dT)i8- VN primer

TTGCAGTGGTAACAACGCAGAGTACTTTTTTTTTTTTTTTTTTV (A,C or G) N (A,C,G or T)

For 3'RACE

Adaptor primer TTGCAGTGGTAACAACGCAGAGT For 3'RACF

5'GAPDH primer ACCACAGTCCATGCCATCAC

3'GAPDH primer TCCACCACCCTGTTGCTGTA

PGMl-forward primer TCCGACTGAGCGGCACTGGGAGTGC Exon 9 PGM 1 -reverse primer GCCCGCAGGTCCTCTTTCCCTCACA Exon 11

T7 primer TAATACGACTCACTATAGGG Vector primer

T3 primer ACAGCTATGACCATG Vector primer |

U19 primer TTTTCCCAGTCACGACGT Vector primer |

gene-specific primer and proteins. The cDNA was eluted from the column with 50|il of sterilised, distilled H2O at 65°C by centrifugation at 13000g for 20 seconds.

A homopolymeric poly -C tail was added to the 3 end of the cDNA using terminal dexynucleotidyl transferase (TdT). TdT tailing creates the binding site for the abridged anchor primer on the 3 end of the cDNA, which is the primer used for the creation of the second cDNA strand. A reaction mix containing the cDNA in lOmM Tris-HCl (pH 8.4). 25mM KCl, 1.5mM MgCb, 200|xM dCTP was prepared and incubated at 94°C for three minutes. The mix was placed on ice and Ipl of TDT added. After incubation at 37°C for ten minutes, the reaction was stopped by heat inactivation at 65°C for ten minutes.

The tailing buffer is PCR-compatible. This means that the reaction can be directly amplified without intermediate organic extractions, ethanol precipitation, or dilutions. PCR amplification was carried out using Taq polymerase, a nested gene- specific primer corresponding to a site located within the cDNA molecule, and a novel deoxyinosine-containing anchor primer provided with the kit. The thermal cycler was preheated to 94°C prior to use and reaction mixes were prepared on ice. The first amplification used the abridged anchor primer in a reaction mix of final composition, 20mM Tris-HCl, 50mM KCl, 1.5mM MgCl], 400mM gene-specific primer (termed either GSPl or GSP2), 400mM abridged anchor primer, 200p,M each of dATP, dCTP, dGTP and dTTP, tailed and 2.5 units of Taq polymerase. Several different Taq polymerase enzymes were tried for the best result. Each reaction was covered with three drops of mineral oil to prevent evaporation during thermal cycling. The reaction was heated at 94°C for 3 minutes and then cycled for 30 cycles using conditions established for each primer pair on a thermocycler machine as follows:

Dénaturation step 94°C 20 seconds.

Annealing of primer (varied depending on GSPs) 45 seconds.

followed by a final extension at 72°C for 7 minutes. lOjil of the first 5 RACE product was analysed on a 2 % agarose gel. In general, no product was visible at this stage.

The second amplification was carried out using second nested gene-specific primer (GSP2) and various dilutions of the first amplification product as template. Generally the first amplification products were diluted in double distilled sterilised water so that the following dilutions, 1:5, 1:100 and 1:500 were obtained. The PCR mix for each sample contained the following, 20mM Tris-HCl (pH8.4), 50mM KCl, I.5mM MgCl], 200nM GSP2, 200nm AUAP (universal primer), 200p.M each of dATP, dTTP, dGTP and dCTP (final concentration), diluted first round PCR

product and 2.5 units of Taq DNA polymerase. Each reaction mix was covered with mineral oil and the reactions heated at 94°C for 3 minutes and then cycled for 30 cycles using conditions established for the primer pair.

Dénaturation 94°C 45 seconds.

Annealing step (varied) 45 seconds

Extension step 72°C 90 seconds

A final extension period of 7 minutes at 72°C. 10|il of each reaction mix was analysed by electrophoresis on a 1.2% agarose gel.

Details of the primers used for each 5 RACE (figure 11.1) reaction are listed in table 11.1, figure 111.22, figure IV. 10 and figure V.4.

II.2.7 3'RACE

3'RACE is the acronym for Rapid Amplification of 3'cDNA Ends. In this procedure mRNA (about 0.5-1 jig) was converted into cDNA using reverse

transcriptase enzyme (Superscript 11) and an oligo(dT) adapter primer consisting of 25 nucleotides of arbitrary sequence with a T18-VN 3'tail (see table 11.1). The reverse transcription reaction was set up using the protocol explained in section 11.2.2.7 for making cDNA using an oligo(dt) primer. Gene specific cDNA was then amplified by PCR using a specific primer that anneals to an internal region of the cDNA sequence and an adapter primer which is identical to the arbitrary 5'end of the RT-PCR primer (see table 11.1 and figure IV. 10). To generate a specific

amplification product, I found it advantageous to design a second semi-nested, gene specific primer at sequence within the cDNA further downstream and for use in a second amplification reaction with the adapter primer. 0.2|il of the first 3'RACE- PCR product without further purification or 0.5-lp.l of DNA extracted from an excised gel was used for the second 3'RACE-PCR. This gave a single band on an agarose gel. The band was cut from the gel and, after DNA extraction was used for sequencing using either the second gene specific primer or a third downstream primer. Genomic DNA and water (ddH20) were always used as controls during amplifications. In the second 3'RACE-PCR, a control reaction was also set up using the first PCR product from genomic DNA.

A schematic of the procedure of the 3'RACE is shown in figure IV.5 in chapter IV.

II.2.8 Screening human adult testis and mouse spermatocyte cDNA libraries