Evaluación de Riesgos

3.5.1 Introduction

Previous analyses of recombinant FMDV polyproteins demonstrated that deletion of the

region 3' to 2A does not affect 2A cleavage activity (Ryan et al, 1991). However the

presence of the upstream context of 2A was been found to increase the efficiency of 2A

activity, although it was not necessary for cleavage (Ryan et al.,\99\). It was planned to extend the FMDV sequence, within the constructs encoding [CAT2AGUS] polyproteins, to include paits of the FMDV capsid protein ID region as well as 2A itself. It was thus hoped to gain an insight into the degree of upstream context required to return 2A cleavage activity towards 100 %. This section describes the syntheses and translation of three cDNA constmcts; pTG393, pTG394 and pTG395 each encoding CATA1D2AGUS polyproteins in which the truncated C-terminal ID regions were of 180, 39 and 5 amino acids respectively.

3.5.2 Results

3.5.2.1 Construction of pTG393

Sequences encoding the 180 C-terminal residues of FMDV ID were amplified from

plasmid pMR31 (encoding FMDV P1P2AP3) using the oligonucleotides OR393 and OR48 (Ryan et al, 1989), as forward and reverse primers, respectively. OR393 encoded an Xba I site followed by some sequence of ID beginning at its 33rd codon. OR48 was designed to anneal to the sequence encoding the 2B region. The PCR product, encoding A1D2AA2B, was doubly restricted with Xba I and Apa I, and isolated by agarose gel electrophoresis. This was ligated into the large fragment of the similarly restricted plasmid pMD2 and transformed into E. coli for mini-prepaiations. The resultant cDNA constructs

were screened for the unique Sma I site, present within the ID region, then pTG393 was sequenced and maxi-prepared via the Qiagen method.

Protein sequence encoded: S R S F I M D R

OR393: 5'- TTTTTTTCTAGATCGTTCATCATGGACAaA -3' Xba I

Protein sequence encoded A I I W P H A D complementary sequence: GCCATCATCTGGCCGCACGCCGATAC

OR48: 3'- CGGTAGTAGACCGGCGTGCGGCTATAG -5'

3.S.2.2 Construction of pTG394

Sequences encoding the 39 C-terminal residues of FMDV ID were amplified from plasmid pMR31 (see above) using oligonucleotides OR394 and OR48 as forward and reverse primers, respectively. OR394 encoded an Xba I site followed by the sequence of ID from the 173rd codon. The PCR product was doubly restricted with Xba I and Apa I and isolated by agarose gel electrophoresis. It was then ligated into the large fragment of the similarly restricted plasmid pMD2 and transformed into E. coli for mini-preparations. The

resultant cDNA constructs were screened for the presence of an Age I restriction site, maxi-prepared via the Qiagen method and sequenced.

Protein sequence encoded: S R V T E L L Y

OR394: 5 ' - TTTTTTTCTAGAGTCACCGAGTTGCTTTAC -3'

3.S.2.3 Construction of pTG395

Plasmid pTG394 was doubly digested with Xba I and Age I, and the 5517 base pair

fragment, from which most of the ID encoding sequence had been excised, was purified by agarose gel isolation. A double stranded oligonucleotide adapter prepared by annealing the two oligonucleotides TG5 and TG6 was then ligated into this fragment and the resultant cDNA constructs transformed into E, coli for mini-preparations. The mini-preparations

were screened for the additional Bbu I restriction site (there was already one present at the terminus of the GUS gene), then maxipreped using the Qiagen method before sequencing. Protein sequence encoded: R A c A P V

TG5: 5 '“ C T A G A G C A T G C G C A - 3'

TG6: S ' - ________ T C G T A C G C G T G G C C - 5'

Xba I Bbu I Age I

3.S.2.4 TnT reactions of plasmids encoding CATA1D2AGUS polyproteins Maxi-preparations of plasmid DNA, pMD2, pTG393, pTG394 and pTG395 were transcribed and translated in coupled rabbit reticuloctye lysate and wheat germ extract systems. The products were analysed by PAGE (Figure 3.5.1).

3.5.3 Discussion

The plasmids synthesised for use in this study, pTG393, pTG394, and pTG395 are shown in Figure 3.5.2. It should be noted that the sequence encoding A1D2A regions of FMDV were the wild type sequences. pMD2 DNA was mutated from the wild type FMDV sequence for 2A in order to introduce restriction sites. The translation profile derived from

pMD2 was compared to those from pTG393, pTG394, and pTG395, which have progressively shorter ID sections encoded before the 2A region. The percentage of cleavage for each polyprotein in both rabbit reticulocyte lysate and wheat germ extiact was calculated exactly as described in the Section 3.2. Since unequal amounts of CAT2A and GUS have been formed by the cleavage of such polypeptides thus far, the percentage of cleavage stated here refers to the quantity of CAT2A found, compared to that of the uncleaved [CAT2AGUS].

CAT2AGUS/ CATA1D2AGUS GUS CATA1801D2A CATA391D2A CATA51D2A/ CAT2A

Figure 3.5.1 Translation in vitro of constructs encoding CATA1D2AGUS.

Coupled transcription/translation reactions in both rabbit reticulocyte lysate, lanes labelled ‘a’, and wheat germ extract, lanes labelled ‘b’, were programmed with the plasmid DNA as indicated. Translation products were analysed by PAGE. The translation products are indicated, with the number of residues of

I