5.2. El rito de exorcismo en la parroquia de San Miguel Arcángel
5.2.2. Tipología del rito de exorcismo
5.2.2.1. Exorcismos menores
M
Figure 4.7: S egre gation o f D l S N i m r l . G enom ic D N A from the sam e 23 C 57B L/6 backcross mice as in Figure 4.5B was amplified using prim ers JS139 and P L 0 1 6 derived from the marker REVEAL-1. Products were run on a 2% agarose gel against the (pxl74/HaeIII marker (M ). The arrow indicates the position o f the D l S N i m r l product at 22S bp. 22 out o f 23 backcross anim als show the presence o f the band, indicating linkage.
4.3.4 - Mapping of REVEAL markers by somatic cell hybrids:
To ascertain which chromosome contained both REVEAL markers, a mouse-hamster somatic cell hybrid panel was screened (Williamson et al. 1995). Each of the 22 cell lines contains a unique complement of mouse chromosomes so that the pattern of PCR products generated across this panel makes it possible to determine whether DNA has been amplified from a particular chromosome.
Initial attempts to map D13Nimr2 in this panel using the primers J S I4 0 and PLOlO failed,
as no PCR products were seen in either the cell lines or the mouse DNA control. The CBA/H strain was used to set up this panel, and it was therefore possible that CBA-derived sequence in the region containing D13Nimr2 was different to that of the 129 strain. PCR products obtained from the D13Nimr2 primer pair JS134 and PLOll were cloned into the pCR-TOPOn vector and sequenced, revealing a region of 12 nucleotides that are deleted in CBA mice compared to a 129 control (see Figure 4.8). This lies directly over the position of the primer PLOlO, explaining the earlier panel screening problems.
The panel was subsequently screened with the D13Nimrl primers and PLOl^, with 16 of the 21 cell lines showing the presence of a mouse-specific band (see Figure 4.9). An identical pattern was observed using alternative primers specific for D13Nimr2, suggesting that both markers derive from the same chromosomal fragment. Unfortunately, it was not possible to conclusively predict the chromosome number as the arrangement of positive cell lines did not match one of the expected combinations. It was possible that the chromosomal region containing the markers was not represented in the panel, having been somehow lost during maintenance of the somatic cell lines. The data were identical to that of a chromosme 13 sequence apart from cell hne number 21, which was originally typed as negative for two markers (Williamson et al. 1995). This sample was consistently positive with the D13Nimrl and D13Nimr2 primers. Possibly only a fraction of chromosome 13 has been retained in cell line number 21.
It was therefore decided to map both markers on a radiation hybrid panel to obtain a more precise chromosomal location.
PL011
129
CTAATAACACTCATCAACTGATATCATTTACTGATATAAACATACBA
...
AGTATCACGGCGGAAGTACAGATCTTTAGATGCTTCTGCAGAGAGGTTGG PLOlO GACACGGCATGGTGGCCCATGGAGTAGAATTATTTATTTACTTTAAGTATATGAAC AC ACTATAG- C - TGGTCTTC AGACACTCCAGAAG ... T . . T G . G ...
4--- JS134
Figure 4.8: Sequence of REVEAL-2 differs in CBA and 129/SvEv strain s.
Primers JS134and PLO ll were used to amplify the REVEAL-2 marker from 129 and CBA genomic DNA, which was cloned into the pCRll-TOPO vector and sequenced. Sequence alignment reveals a 12 bp deletion in CBA DNA. Homology is marked with dots, with dashes indicating deleted bases. The position of the relevant markers are indicated.
F igu re 4.9: S c r e e n in g o f the m o u se so m a tic cell h ybrid panel w ith R E V E A L - 1 p r i m e r s .
The prim ers JS136 and P L 0 1 3 were used to am plify DNA sam ples from the som atic cell hybrid panel (cell lines 1 to 27), with control D NA from CB A /H m ouse (C) and ham ster (H). Amplified products were run on a 2% agarose gel against the (pxl74/HaeIII marker (M).
1 2 3 6 7 8 9 12 13 14 15 18 19 20
4.3.5 - Mapping of REVEAL markers by radiation hybrids:
The T31 mouse whole-genome panel comprises 100 hybrid cell lines derived by fusing irradiated 129aa embryonic stem cells with cells from a hamster fibroblast line (McCarthy et al. 1997). Different hybrids retain different fragments of mouse chromosomes and these have been extensively characterised by microsatellite mapping. Scoring D13Nimrl on this panel was carried out by PCR, and based on the pattern of positive cell lines, analysis of the data confirmed that it mapped to mouse chromosome 13. An example of the screening results are shown in Figure 4.10. Samples that gave a mouse-specific band in only one of the three replicate sets of reactions was classified as unknown. Analysis of the data placed the marker between the previously mapped microsatellites D13Mitl57 and D13MÜ66 (see Figure 4.11) with LOD scores of 11.8 and 9.0, respectively. Linkage to both flanking markers is significant (L. Rowe, pers. comm.), and D13Nimrl therefore lies at approximately 37cM from the proximal end of the chromosome 13. Not only did this result confirm the somatic cell hybrid mapping, but this region of chromosome 13 is also part of the fraction of the mouse genome which could not be excluded by the DNA pooling method (see Figure 4.4).
Figu re 4 .10: S c r e e n in g o f the m o u se rad iation hybrid panel for R E V E A L - 1 . The primers JS139 and P L 0 1 6 were used to am plify DNA sam ples from the T31 radiation hybrid m apping panel, with the control m ouse (129), ham ster (H) and water controls. Products were run on a 2% agarose gel against a 100 bp ladder (M).
M
M
Ilia'
I I I129 I HgO
rlo o a\ o CTN CC O' so in "V m CN <T> O CO ON CO œ 00 H CO so CO m CO ^ CO m CD r q CO 00 o ES u" r- ^ r- ro oq <-f s § s s S 3 so in m i n GO m in sd in n m in <s in f* in o : s rN m o CN3 ON <N CO rq 5 rq m (N <N 03 ^ —I ^ r-f m T- ^ tH O ON 00 'O m m X z 2 o & c so '0> CC z z z Û Û c =* c ON so r- in CN m 00 m so so jj 0/ z z > rn S rl CC c a a o
Figure 4.11: Mapping of REVEAL m arkers by analysis of radiation hybrid data. The positive cell lines scored by PCR from the T31 radiation hybrid mapping panel for both REVEAL-1 and REVEAL-2 were analysed using the Map Manager QT program at the Jackson Laboratories. The markers were positioned on chromosome 13 based on the optimum LOD score obtained between the flanking microsatellites shown.
Amplification of D13Nimr2 from the T31 panel yielded only 12 mouse-specific bands (see Figure 4.12). This was a much lower figure than expected, although the smaller hamster- specific band visible in every sample acted as a positive control for the PCR reaction. The data was analysed as above (see Figure 4.11), and the highest LOD scores were 5.8 to
D13MU99 and 4.9 to D13Mit94\ a score above 6.0 is considered as being significant (L. Rowe, pers. comm.). The low retention frequency of this sequence in the panel could reflect the expression of a gene that favours the loss of a small region of chromosome 13 from the hamster cell line. For these purposes, the best fit of the data places D13Nimr2 at approximately 34cM from the centromere of mouse chromosome 13.
As D13Nimrl showed tighter linkage to G vl than D13Nimr2, this suggested that the gene maps distal to the marker at 37cM based on the lower recombination frequency. Microsatellite markers around this region of chromosome 13 were therefore ordered for the mapping of Gvl in the C57BL/6 backcross.
I I I I 129 H HgO
F igu re 4.12: S c r e e n in g o f the m o u se rad iation hybrid p anel for R E V E A L - 2 . The primers P L 0 8 and P L O ll were used to am plify DNA sam ples from the T31 radiation hybrid m apping panel, with the control m ouse (129), two ham ster (H) and w ater controls. Products were run on a 2% agarose gel against a 100 bp ladder (M).